Complet list of 2x7g hssp fileClick here to see the 3D structure Complete list of 2x7g.hssp file
PDBID      2X7G
THRESHOLD  according to: t(L)=(290.15 * L ** -0.562) + 5
REFERENCE  Sander C., Schneider R. : Database of homology-derived protein structures. Proteins, 9:56-68 (1991).
CONTACT    Maintained at by Maarten L. Hekkelman 
DATE       file generated on 2013-09-22
AUTHOR     Pike, A.C.W.; Savitsky, P.; Fedorov, O.; Krojer, T.; Ugochukwu, E.; Vo
NCHAIN        1 chain(s) in 2X7G data set
NALIGN       93
NOTATION : ID: EMBL/SWISSPROT identifier of the aligned (homologous) protein
NOTATION : STRID: if the 3-D structure of the aligned protein is known, then STRID is the Protein Data Bank identifier as taken
NOTATION : from the database reference or DR-line of the EMBL/SWISSPROT entry
NOTATION : %IDE: percentage of residue identity of the alignment
NOTATION : %SIM (%WSIM):  (weighted) similarity of the alignment
NOTATION : IFIR/ILAS: first and last residue of the alignment in the test sequence
NOTATION : JFIR/JLAS: first and last residue of the alignment in the alignend protein
NOTATION : LALI: length of the alignment excluding insertions and deletions
NOTATION : NGAP: number of insertions and deletions in the alignment
NOTATION : LGAP: total length of all insertions and deletions
NOTATION : LSEQ2: length of the entire sequence of the aligned protein
NOTATION : ACCNUM: SwissProt accession number
NOTATION : PROTEIN: one-line description of aligned protein
NOTATION : SeqNo,PDBNo,AA,STRUCTURE,BP1,BP2,ACC: sequential and PDB residue numbers, amino acid (lower case = Cys), secondary
NOTATION : structure, bridge partners, solvent exposure as in DSSP (Kabsch and Sander, Biopolymers 22, 2577-2637(1983)
NOTATION : VAR: sequence variability on a scale of 0-100 as derived from the NALIGN alignments
NOTATION : pair of lower case characters (AvaK) in the alignend sequence bracket a point of insertion in this sequence
NOTATION : dots (....) in the alignend sequence indicate points of deletion in this sequence
NOTATION : SEQUENCE PROFILE: relative frequency of an amino acid type at each position. Asx and Glx are in their
NOTATION : acid/amide form in proportion to their database frequencies
NOTATION : NOCC: number of aligned sequences spanning this position (including the test sequence)
NOTATION : NDEL: number of sequences with a deletion in the test protein at this position
NOTATION : NINS: number of sequences with an insertion in the test protein at this position
NOTATION : ENTROPY: entropy measure of sequence variability at this position
NOTATION : RELENT: relative entropy, i.e.  entropy normalized to the range 0-100
NOTATION : WEIGHT: conservation weight

## PROTEINS : identifier and alignment statistics
    1 : G3HSX0_CRIGR        0.72  0.85    1  345   91  445  355    1   11  445  G3HSX0     Serine/threonine-protein kinase SRPK3 OS=Cricetulus griseus GN=I79_013969 PE=4 SV=1
    2 : B4IP29_DROSE        0.60  0.78   10  343   11  366  358    2   27  367  B4IP29     GM16236 OS=Drosophila sechellia GN=Dsec\GM16236 PE=4 SV=1
    3 : B4IP39_DROSE        0.58  0.77   10  343   11  368  358    1   25  369  B4IP39     GM16264 OS=Drosophila sechellia GN=Dsec\GM16264 PE=4 SV=1
    4 : B4IPB7_DROSE        0.57  0.77   11  343   12  368  357    1   25  369  B4IPB7     GM11747 OS=Drosophila sechellia GN=Dsec\GM11747 PE=4 SV=1
    5 : C3PSY5_DASNO        0.57  0.66    1  345   62  558  497    1  153  558  C3PSY5     SFRS protein kinase 3 (Predicted) OS=Dasypus novemcinctus GN=SRPK3 PE=4 SV=1
    6 : F7I7K2_CALJA        0.57  0.58    1  345   69  650  582    1  238  650  F7I7K2     Uncharacterized protein OS=Callithrix jacchus GN=SRPK2 PE=4 SV=1
    7 : H2T733_TAKRU        0.57  0.65    2  345   71  556  486    1  143  556  H2T733     Uncharacterized protein OS=Takifugu rubripes GN=SRPK1 (1 of 2) PE=4 SV=1
    8 : H2T9E3_TAKRU        0.57  0.69    1  345   21  490  470    2  126  490  H2T9E3     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=LOC101062457 PE=4 SV=1
    9 : F7C9L4_HORSE        0.56  0.66    1  345   31  529  499    1  155  529  F7C9L4     Uncharacterized protein (Fragment) OS=Equus caballus GN=SRPK3 PE=4 SV=1
   10 : F7E8D1_MACMU        0.56  0.65    1  345   68  567  500    1  156  567  F7E8D1     Uncharacterized protein (Fragment) OS=Macaca mulatta GN=SRPK3 PE=4 SV=1
   11 : G1P2G2_MYOLU        0.56  0.66    1  345   67  565  499    1  155  565  G1P2G2     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
   12 : G1TM23_RABIT        0.56  0.65    1  345   87  586  500    1  156  586  G1TM23     Uncharacterized protein (Fragment) OS=Oryctolagus cuniculus PE=4 SV=1
   13 : H0WM66_OTOGA        0.56  0.65    1  345   48  547  500    1  156  547  H0WM66     Uncharacterized protein (Fragment) OS=Otolemur garnettii GN=SRPK3 PE=4 SV=1
   14 : H9F5V1_MACMU        0.56  0.66    1  345   43  541  499    1  155  541  H9F5V1     SRSF protein kinase 3 isoform 2 (Fragment) OS=Macaca mulatta GN=SRPK3 PE=2 SV=1
   15 : I3MBA2_SPETR        0.56  0.66    1  345   68  566  499    1  155  566  I3MBA2     Uncharacterized protein OS=Spermophilus tridecemlineatus GN=SRPK3 PE=4 SV=1
   16 : M3YBL8_MUSPF        0.56  0.66    1  345   26  524  499    1  155  524  M3YBL8     Uncharacterized protein OS=Mustela putorius furo GN=SRPK3 PE=4 SV=1
   17 : SRPK3_HUMAN         0.56  0.65    1  345   68  567  500    1  156  567  Q9UPE1     SRSF protein kinase 3 OS=Homo sapiens GN=SRPK3 PE=1 SV=2
   18 : F7GFY2_MACMU        0.55  0.55    1  345   69  687  619    1  275  687  F7GFY2     Serine/threonine-protein kinase SRPK2 isoform b OS=Macaca mulatta GN=SRPK2 PE=2 SV=1
   19 : F7I592_CALJA        0.55  0.55    1  345   69  687  619    1  275  687  F7I592     Uncharacterized protein OS=Callithrix jacchus GN=SRPK2 PE=4 SV=1
   20 : G1RCP0_NOMLE        0.55  0.55    1  345   69  687  619    1  275  687  G1RCP0     Uncharacterized protein OS=Nomascus leucogenys GN=SRPK2 PE=4 SV=1
   21 : G3SU62_LOXAF        0.55  0.55    1  345   56  674  619    1  275  674  G3SU62     Uncharacterized protein (Fragment) OS=Loxodonta africana GN=SRPK2 PE=4 SV=1
   22 : G5BI41_HETGA        0.55  0.55    1  345   60  677  618    1  274  677  G5BI41     Serine/threonine-protein kinase SRPK2 (Fragment) OS=Heterocephalus glaber GN=GW7_03886 PE=4 SV=1
   23 : H0WLK3_OTOGA        0.55  0.55    1  345   59  677  619    1  275  677  H0WLK3     Uncharacterized protein (Fragment) OS=Otolemur garnettii PE=4 SV=1
   24 : M3Z3I4_MUSPF        0.55  0.55    1  345   68  686  619    1  275  686  M3Z3I4     Uncharacterized protein OS=Mustela putorius furo GN=SRPK2 PE=4 SV=1
   25 : Q4R9A2_MACFA        0.55  0.55    1  345   69  687  619    1  275  687  Q4R9A2     Testis cDNA clone: QtsA-10433, similar to human SFRS protein kinase 2 (SRPK2), transcript variant 1,mRNA, RefSeq: NM_182692.1 OS=Macaca fascicularis GN=EGM_12841 PE=2 SV=1
   26 : SRPK2_HUMAN 2X7G    0.55  0.55    1  345   70  688  619    1  275  688  P78362     SRSF protein kinase 2 OS=Homo sapiens GN=SRPK2 PE=1 SV=3
   27 : G1KG81_ANOCA        0.54  0.55    1  345   92  711  620    2  276  711  G1KG81     Uncharacterized protein OS=Anolis carolinensis GN=SRPK2 PE=4 SV=2
   28 : G1NYH5_MYOLU        0.54  0.55    1  345   71  691  621    2  277  691  G1NYH5     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
   29 : H2UZ30_TAKRU        0.54  0.58    1  345   69  634  566    1  222  634  H2UZ30     Uncharacterized protein (Fragment) OS=Takifugu rubripes PE=4 SV=1
   30 : R0L747_ANAPL        0.54  0.55    1  345    8  628  621    1  277  628  R0L747     Serine/threonine-protein kinase SRPK2 (Fragment) OS=Anas platyrhynchos GN=Anapl_16384 PE=4 SV=1
   31 : A4IHA0_XENTR        0.53  0.61    1  345   96  637  542    1  198  637  A4IHA0     LOC100124819 protein OS=Xenopus tropicalis GN=srpk2 PE=2 SV=1
   32 : F7D504_XENTR        0.53  0.61    1  345   96  639  544    1  200  639  F7D504     Uncharacterized protein (Fragment) OS=Xenopus tropicalis GN=srpk2 PE=4 SV=1
   33 : H9FYW4_MACMU        0.53  0.54    1  345   69  687  619    1  275  687  H9FYW4     Serine/threonine-protein kinase SRPK2 isoform b OS=Macaca mulatta GN=SRPK2 PE=2 SV=1
   34 : F6Q5I1_ORNAN        0.52  0.61    1  345   60  559  500    4  156  559  F6Q5I1     Uncharacterized protein OS=Ornithorhynchus anatinus GN=SRPK3 PE=4 SV=2
   35 : H2UZ27_TAKRU        0.52  0.56    1  345   69  654  586    1  242  654  H2UZ27     Uncharacterized protein (Fragment) OS=Takifugu rubripes PE=4 SV=1
   36 : H0XIR6_OTOGA        0.51  0.55    1  330   68  578  528    7  216  578  H0XIR6     Uncharacterized protein (Fragment) OS=Otolemur garnettii PE=4 SV=1
   37 : H2T731_TAKRU        0.51  0.58    2  345   70  611  542    1  199  611  H2T731     Uncharacterized protein OS=Takifugu rubripes GN=SRPK1 (1 of 2) PE=4 SV=1
   38 : M3XB20_FELCA        0.51  0.59    1  345   13  558  546    2  202  558  M3XB20     Uncharacterized protein (Fragment) OS=Felis catus GN=SRPK3 PE=4 SV=1
   39 : H2UXG5_TAKRU        0.50  0.57    2  344   69  637  569    1  227  638  H2UXG5     Uncharacterized protein OS=Takifugu rubripes GN=SRPK1 (2 of 2) PE=4 SV=1
   40 : H2T729_TAKRU        0.49  0.56    2  345   79  649  571    1  228  649  H2T729     Uncharacterized protein OS=Takifugu rubripes GN=SRPK1 (1 of 2) PE=4 SV=1
   41 : M4A787_XIPMA        0.49  0.56    2  344   71  643  573    1  231  644  M4A787     Uncharacterized protein OS=Xiphophorus maculatus GN=SRPK1 (2 of 2) PE=4 SV=1
   42 : Q28DU4_XENTR        0.49  0.58    2  343   69  609  547    2  212  611  Q28DU4     SFRS protein kinase 1 OS=Xenopus tropicalis GN=srpk1 PE=2 SV=1
   43 : E1C5I9_CHICK        0.48  0.55    2  343  161  746  586    1  245  748  E1C5I9     Uncharacterized protein OS=Gallus gallus GN=SRPK1 PE=4 SV=2
   44 : G3SL39_LOXAF        0.48  0.56    2  345   70  649  580    1  237  649  G3SL39     Uncharacterized protein OS=Loxodonta africana GN=LOC100674002 PE=4 SV=1
   45 : G3U3L3_LOXAF        0.48  0.56    2  345   44  624  581    1  238  624  G3U3L3     Uncharacterized protein (Fragment) OS=Loxodonta africana GN=LOC100674002 PE=4 SV=1
   46 : H2UXG4_TAKRU        0.48  0.55    2  344   69  653  585    1  243  654  H2UXG4     Uncharacterized protein OS=Takifugu rubripes GN=SRPK1 (2 of 2) PE=4 SV=1
   47 : J3S0V8_CROAD        0.48  0.55    2  344   70  651  582    1  240  652  J3S0V8     Serine/threonine-protein kinase SRPK1-like OS=Crotalus adamanteus PE=2 SV=1
   48 : Q8VHL3_CRILO        0.48  0.56    2  345   67  646  580    1  237  646  Q8VHL3     SR protein kinase 1 (Fragment) OS=Cricetulus longicaudatus GN=SRPK1 PE=2 SV=1
   49 : D2GYW2_AILME        0.47  0.56    2  345  107  692  586    1  243  692  D2GYW2     Putative uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=PANDA_002225 PE=4 SV=1
   50 : E6ZFE1_DICLA        0.47  0.55    2  345   64  648  585    1  242  648  E6ZFE1     Serine/arginine-rich protein specific kinase 1b OS=Dicentrarchus labrax GN=SRPK1B PE=4 SV=1
   51 : F6YMJ8_MACMU        0.47  0.56    2  345  246  831  586    1  243  831  F6YMJ8     Uncharacterized protein OS=Macaca mulatta GN=SRPK1 PE=2 SV=1
   52 : F7IEZ5_CALJA        0.47  0.56    2  345   54  639  586    1  243  639  F7IEZ5     Uncharacterized protein OS=Callithrix jacchus GN=SRPK1 PE=4 SV=1
   53 : F7IHE6_CALJA        0.47  0.55    2  345  240  827  588    2  245  827  F7IHE6     Uncharacterized protein OS=Callithrix jacchus GN=SRPK1 PE=4 SV=1
   54 : F7IM43_CALJA        0.47  0.56    2  345   46  631  586    1  243  631  F7IM43     Uncharacterized protein (Fragment) OS=Callithrix jacchus GN=SRPK1 PE=4 SV=1
   55 : G1L120_AILME        0.47  0.56    2  345   66  651  586    1  243  651  G1L120     Uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=SRPK1 PE=4 SV=1
   56 : G1PH88_MYOLU        0.47  0.56    2  345   54  642  589    1  246  642  G1PH88     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
   57 : G1RBZ7_NOMLE        0.47  0.56    2  345   70  655  586    1  243  655  G1RBZ7     Uncharacterized protein OS=Nomascus leucogenys GN=SRPK1 PE=4 SV=1
   58 : G1SVM0_RABIT        0.47  0.56    2  345   66  654  589    1  246  654  G1SVM0     Uncharacterized protein (Fragment) OS=Oryctolagus cuniculus GN=LOC100338911 PE=4 SV=1
   59 : G5BEW3_HETGA        0.47  0.56    2  345  125  710  586    1  243  710  G5BEW3     Serine/threonine-protein kinase SRPK1 OS=Heterocephalus glaber GN=GW7_00637 PE=4 SV=1
   60 : H2T734_TAKRU        0.47  0.53    2  345   31  628  598    1  255  628  H2T734     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=SRPK1 (1 of 2) PE=4 SV=1
   61 : H2T9E1_TAKRU        0.47  0.57    1  345   74  640  567    2  223  640  H2T9E1     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=LOC101062457 PE=4 SV=1
   62 : H3DEW0_TETNG        0.47  0.52    1  344   28  605  579    3  237  606  H3DEW0     Uncharacterized protein (Fragment) OS=Tetraodon nigroviridis GN=SRPK2 PE=4 SV=1
   63 : H9FYW2_MACMU        0.47  0.56    2  345   70  655  586    1  243  655  H9FYW2     Serine/threonine-protein kinase SRPK1 OS=Macaca mulatta GN=SRPK1 PE=2 SV=1
   64 : I3KTA7_ORENI        0.47  0.54    2  345   71  653  583    1  240  653  I3KTA7     Uncharacterized protein OS=Oreochromis niloticus GN=SRPK1 (1 of 2) PE=4 SV=1
   65 : M3XXI8_MUSPF        0.47  0.56    2  345   70  655  586    1  243  655  M3XXI8     Uncharacterized protein OS=Mustela putorius furo GN=SRPK1 PE=4 SV=1
   66 : Q4KLN3_RAT          0.47  0.56    2  345   70  655  586    1  243  655  Q4KLN3     SFRS protein kinase 1 OS=Rattus norvegicus GN=Srpk1 PE=2 SV=1
   67 : F6X887_MONDO        0.46  0.55    2  345   70  660  591    1  248  660  F6X887     Uncharacterized protein OS=Monodelphis domestica GN=SRPK1 PE=4 SV=2
   68 : G3N646_GASAC        0.46  0.54    1  343   47  641  595    1  253  643  G3N646     Uncharacterized protein (Fragment) OS=Gasterosteus aculeatus GN=SRPK3 PE=4 SV=1
   69 : L5M569_MYODS        0.46  0.53    2  345   90  708  619    2  276  708  L5M569     Serine/threonine-protein kinase SRPK1 OS=Myotis davidii GN=MDA_GLEAN10010691 PE=4 SV=1
   70 : F6XBC5_CIOIN        0.45  0.52    1  343   56  654  599    2  257  656  F6XBC5     Uncharacterized protein OS=Ciona intestinalis PE=4 SV=2
   71 : H2YVF3_CIOSA        0.45  0.52    1  345   63  638  577    3  234  638  H2YVF3     Uncharacterized protein (Fragment) OS=Ciona savignyi PE=4 SV=1
   72 : H2YVG2_CIOSA        0.45  0.52    1  344    4  586  584    3  242  586  H2YVG2     Uncharacterized protein (Fragment) OS=Ciona savignyi PE=4 SV=1
   73 : G1MPY2_MELGA        0.44  0.51    2  343    6  592  587    3  246  594  G1MPY2     Uncharacterized protein (Fragment) OS=Meleagris gallopavo PE=4 SV=2
   74 : H2MN71_ORYLA        0.44  0.52    2  345   71  678  608    1  265  678  H2MN71     Uncharacterized protein OS=Oryzias latipes GN=SRPK1 (2 of 2) PE=4 SV=1
   75 : H2N0L1_ORYLA        0.44  0.53    1  345   54  662  609    1  265  662  H2N0L1     Uncharacterized protein (Fragment) OS=Oryzias latipes PE=4 SV=1
   76 : H2UBK2_TAKRU        0.44  0.57    2  345   18  557  540    1  197  557  H2UBK2     Uncharacterized protein (Fragment) OS=Takifugu rubripes PE=4 SV=1
   77 : H2YVF8_CIOSA        0.44  0.51    1  345   66  654  590    3  247  654  H2YVF8     Uncharacterized protein (Fragment) OS=Ciona savignyi PE=4 SV=1
   78 : H2YVF9_CIOSA        0.44  0.51    1  345   32  621  591    4  248  621  H2YVF9     Uncharacterized protein (Fragment) OS=Ciona savignyi PE=4 SV=1
   79 : Q5R363_HUMAN        0.44  0.53   40  345    1  547  548    2  244  547  Q5R363     SRSF protein kinase 1 OS=Homo sapiens GN=SRPK1 PE=2 SV=1
   80 : H2UBK0_TAKRU        0.43  0.56    2  345   18  568  551    1  208  568  H2UBK0     Uncharacterized protein (Fragment) OS=Takifugu rubripes PE=4 SV=1
   81 : E0VYW6_PEDHC        0.41  0.51    1  341   85  659  575    2  235  692  E0VYW6     Serine/threonine-protein kinase SRPK2, putative OS=Pediculus humanus subsp. corporis GN=Phum_PHUM521080 PE=4 SV=1
   82 : H2MGT5_ORYLA        0.40  0.51    1  345   65  651  587    2  243  651  H2MGT5     Uncharacterized protein (Fragment) OS=Oryzias latipes PE=4 SV=1
   83 : Q0E965_DROME        0.39  0.48    1  343  159  763  605    2  263  764  Q0E965     SRPK, isoform A OS=Drosophila melanogaster GN=SRPK PE=4 SV=1
   84 : B4HS35_DROSE        0.38  0.48    1  343  159  765  607    1  265  766  B4HS35     GM21607 OS=Drosophila sechellia GN=Dsec\GM21607 PE=4 SV=1
   85 : B4J5Q2_DROGR        0.38  0.47    1  343  171  787  617    2  275  788  B4J5Q2     GH20233 OS=Drosophila grimshawi GN=Dgri\GH20233 PE=4 SV=1
   86 : G2J5W6_DROME        0.38  0.48    1  343  159  763  605    2  263  764  G2J5W6     RE75274p1 OS=Drosophila melanogaster GN=SRPK-RA PE=2 SV=1
   87 : G4VJQ1_SCHMA        0.36  0.44    1  345   94  764  673    3  331 1089  G4VJQ1     Serine/threonine kinase OS=Schistosoma mansoni GN=Smp_041770 PE=4 SV=1
   88 : M9NDZ1_DROME        0.34  0.44    1  344  269  893  625    2  282  898  M9NDZ1     Serine-arginine protein kinase at 79D, isoform I OS=Drosophila melanogaster GN=srpk79D PE=4 SV=1
   89 : E5SJ47_TRISP        0.33  0.45    2  344  118  760  643    5  301  761  E5SJ47     Serine/threonine-protein kinase SRPK1 OS=Trichinella spiralis GN=Tsp_08274 PE=4 SV=1
   90 : H3HLW6_STRPU        0.32  0.41    1  343  272  910  641    3  301  912  H3HLW6     Uncharacterized protein OS=Strongylocentrotus purpuratus PE=4 SV=1
   91 : J8TYN1_TRIAS        0.32  0.45    1  345   37  633  597    3  253  688  J8TYN1     Serine/threonine-protein kinase OS=Trichosporon asahii var. asahii (strain ATCC 90039 / CBS 2479 / JCM 2466 / KCTC 7840 / NCYC 2677 / UAMH 7654) GN=A1Q1_08074 PE=4 SV=1
   92 : M9PIK8_DROME        0.31  0.41    1  344  269  945  677    3  334  950  M9PIK8     Serine-arginine protein kinase at 79D, isoform M OS=Drosophila melanogaster GN=srpk79D PE=4 SV=1
   93 : H0GZK1_9SACH        0.30  0.43    5  344  152  730  582    5  246  765  H0GZK1     Sky1p OS=Saccharomyces cerevisiae x Saccharomyces kudriavzevii VIN7 GN=VIN7_9268 PE=4 SV=1
## ALIGNMENTS    1 -   70
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....1....:....2....:....3....:....4....:....5....:....6....:....7
     1   81 A P              0   0  139   54    4  P   PP PPPPPPPPPPPPPPPPPPPPPPPPPPPPP P                      PP     P P
   161  241 A R  H >X S+     0   0  153   94   44  errrrrkrrrrrrrrrrrrrrrrrrrrrrrrrrrrrkprkrrrrrrrrrkrrrrrrrrrkrrrkrrrrrr
   162  242 A R  H 3< S+     0   0   76   93   87  fpttfttfffffffffftttttttttttatfftsatnfptl.ssspafsgsssssssystfrsgsfstsc
   167      ! !              0   0    0    0    0  
   345  699 A S              0   0  107   69   37  P   PSSTPPPPPPPPPSSSSSSSSSSSSSSSSSS SP S   SS  SSSSSSSSSSSSST SSSSS S 
## ALIGNMENTS   71 -   93
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....8....:....9....:....0....:....1....:....2....:....3....:....4
     1   81 A P              0   0  139   54    4  PP  P PP  PPPPPPPP PSP 
     2   82 A V        -     0   0   13   89    0  VVVVVVVV VVVVVVVVVVVIV 
     3   83 A K    >   -     0   0   68   89   28  KKKKKEKK EKENNNSKVNKNV 
     4   84 A I  T 3  S+     0   0  123   89    4  IIIIIIII IIIIIIIIILIII 
     5   85 A G  T 3  S+     0   0   40   90    4  GGGGGGGG GGGGGGGGGGFGGG
     6   86 A D    <   -     0   0   68   90    5  DDDDDEDD EDEDDDDQDDDDDE
     7   87 A L  E     -A   13   0A  92   90   19  LLLLLILL IVVLLLLVIVLEIP
     8   88 A F  E >>  -A   12   0A  26   90    1  FFFFFFFF FFFFFFFYFLFFFY
     9   89 A N  T 34 S-     0   0   85   90   23  NNNNNVNN VQAHHNHNDNNNDK
    10   90 A G  T 34 S+     0   0   66   92   27  nnGGGDnn DNNDDGDSNGGnNd
    11   91 A R  T <4 S+     0   0   42   93   18  vvRRRRvv RRRRRRRRRHKrRr
    12   92 A Y  E  <  -AB   8  31A   0   93   12  TTYYYYTT YYYYYYYYFYYYFY
    13   93 A H  E     -AB   7  30A  68   93   19  HHHHHQHH QRQHHHHHRYHLRI
    14   94 A V  E     + B   0  29A   2   93    2  VVVVVVVV VVVVVVVVVVVIVL
    15   95 A I  E     -     0   0A  48   92   20  VVIIVVVV VTQIIIIVVIVVVV
    16   96 A R  E     - B   0  28A  88   93    2  RRRRRRRR RRQRRRRRRRRRRR
    17   97 A K  E     - B   0  27A  82   93    0  KKKKKKKK KKKKKKKKKKKKKK
    18   98 A L  E     -     0   0A  71   93    2  LLLLLLLL LLLLLVLLLILLLL
    19   99 A G  E     - B   0  26A  17   93    4  GGGGGGGG GGGGGGGGGGGGGG
    20  100 A W  E     - B   0  25A 185   93    3  WWWWWWWW WWWWWWWWWWWWWW
    21  101 A G        -     0   0   38   93    0  GGGGGGGG GGGGGGGGGGGGGG
    22  102 A H  S    S+     0   0  142   93    4  HHHHHHHH HHHHHHHHHHHHHH
    23  103 A F  S    S+     0   0  118   93    0  FFFFFFFF FFFFFFFFFFFFFF
    24  104 A S  E     - C   0  43A  12   93    0  SSSSSSSS SSSSSSSSSSSSSS
    25  105 A T  E     -BC  20  42A  31   93    0  TTTTTTTT TTTTTTTTTTTTTT
    26  106 A V  E     -BC  19  41A  38   93    0  VVVVVVVV VVVVVVVVVVVVVV
    27  107 A W  E     -BC  17  40A  17   93    0  WWWWWWWW WWWWWWWWWWWWWW
    28  108 A L  E     +BC  16  39A   0   93    0  LLLLLLLL LLLLLLLLLLLLLL
    29  109 A C  E     -BC  14  38A   0   93   40  CCAACCCC CCCCCCCCCGAACA
    30  110 A W  E     -BC  13  37A  79   93    0  WWWWWWWW WWWWWWWWRWWRRR
    31  111 A D  E  >> -BC  12  36A   3   93    0  DDDDDDDD DDDDDDDDDDDDDD
    32  112 A M  T  45S+     0   0   93   93   36  MMIILMMM MFVLLLLLLVLNLT
    33  113 A Q  T  45S+     0   0  145   93   37  RRQQQMRR MLMQQQQCKnTMKI
    34  114 A G  T  45S-     0   0   41   93   73  NNGEKKNN KDTAAEASDsGTDN
    35  115 A K  T  <5 +     0   0  115   93   25  KKKKKRKK RRKMMKMKEKRKEN
    36  116 A R  E    S-     0   0   54   94    4  AAAAAAAAAAAAAAAAAAAADAD
    47  127 A Q  H  > S+     0   0  160   94   62  PPEEPQPPEQSPPPQPPPEEGPK
    48  128 A H  H  > S+     0   0  132   94   15  HHHHHMHHHMHTHHHHHHHHHHV
    49  129 A Y  H  > S+     0   0   79   94    4  YYYYYFYYYFFFFFFFYYYYYYY
    50  130 A T  H  X S+     0   0   26   94   18  TTTTTTTTTTTTAAAATIATTIT
    51  131 A E  H  X S+     0   0   95   94    5  EEEEEEEEEEDEEEDEEEEEEEE
    52  132 A T  H  X S+     0   0   45   94    2  TTTTTTTTTTTTTTTTTTTTTTA
    53  133 A A  H  X S+     0   0    2   94    5  AAAAAAAAAAAAAAAAAAAAAAA
    54  134 A L  H  X S+     0   0   55   93   41  LLLLLLLLLLLLRRKRLAQLLAE
    55  135 A D  H  X S+     0   0   42   93    0  DDDDDDDDDDDDDDDDDDDDDDD
    56  136 A E  H  X S+     0   0   11   94    0  EEEEEEEEEEEEEEEEEEEEEEE
    57  137 A I  H  X S+     0   0    7   94    0  IIIIIIIIIIIIIIIIIIIIIII
    58  138 A K  H  X S+     0   0  123   94   21  KKKRRRKKRRKKKKKKKRKKQRK
    59  139 A L  H  X S+     0   0    1   94    8  LLLLLLLLLLLLIIIILLLLLLL
    60  140 A L  H  X S+     0   0    3   94    0  LLLLLLLLLLLLLLLLLLLLLLL
    61  141 A K  H  X S+     0   0   77   94   22  KKKKRKKKKKRKKKRKSEnKQEq
    62  142 A C  H  X S+     0   0   40   94   49  SSSSCCSSSCTCTTATCAkCRAd
    63  143 A V  H  < S+     0   0    0   93    4  VVVVVVVVVVVVVVVVVIVVVIA
    64  144 A R  H  < S+     0   0   80   93    6  RRRRRRRRRRRRRRRRRRRRTRD
    65  145 A E  H  < S+     0   0  119   93   37  DDNNDDDDNDEDEEDEEDNNNDN
    66  146 A S  S  < S-     0   0   46   93   32  SSSTSSSSSSASTTTTSASSSAT
    67  147 A D    >   -     0   0   50   93    7  DDDDDDDDDDDDDDDDADDDSDK
    68  148 A P  T 3  S+     0   0   74   93    9  PPPPPAPPPAPPPPPPPPPPEPD
    69  149 A S  T 3  S+     0   0  107   93   60  KKNTSKKKNKSKSSLSDMDNSMD
    70  150 A D    X   -     0   0   22   93   13  DDDDDDDDDDDDNNNNDDDDHDS
    71  151 A P  G >  S+     0   0   85   93   31  QQPPPLQQPLPSPPPPPVPIPVM
    72  152 A N  G >  S+     0   0   33   93   56  NNNSHKNNNKKNRRGRFKKQGKG
    73  153 A K  G X  S+     0   0   53   93   26  RRKRRRRRRRKRRRRRRRRRRRA
    74  154 A D  G <  S+     0   0   82   93   31  EEEEEDEEEDNDHREHKEDESEN
    75  155 A M  G <  S+     0   0   34   94   68  KKRKTRKKMRKRKKKKKRRRHRH
    76  156 A V  B <  S-f  185   0B   0   94   35  CCVVIVCCVVTVTTTTTIVVVII
    77  157 A V        -     0   0    9   94    2  VVVVVVVVVVIVVVVVVVIVVVL
    78  158 A Q        -     0   0   35   94   15  QQQQQHQQQHQRQQQQQRNQGRK
    79  159 A L        -     0   0    3   94    2  LLLLLLLLLLMLMMMMLLMLLLL
    80  160 A I        -     0   0   56   94   27  LLLLIILLLILVLLFLLMLVVML
    81  161 A D  E     -E   96   0A  34   94    5  DDDDDDDDDDNDDDDDDNDDDND
    82  162 A D  E     +E   95   0A  36   94    8  DDDDDDDDDDDDDDDDDHHDDHH
    83  163 A F  E     -E   94   0A  16   94    0  FFFFFFFFFFFFFFFFFFFFFFF
    84  164 A K  E     -E   93   0A 106   94   23  KKKKKRKKKRKRKKKKRTTKRTN
    85  165 A I  E     -E   92   0A  30   94   10  IIIIVIIIIIIIIIIIVVIVHVH
    86  166 A S  E     +E   91   0A 105   94   47  HHSASTHHSTTNTTTTSRLTMRK
    87  167 A G  E >   -E   90   0A  27   94    0  GGGGGGGGGGGGGGGGGGGGGGG
    88  168 A M  T 3  S+     0   0  199   94   41  MMVMVEMMVEISVVVVVVDVPVP
    89  169 A N  T 3  S-     0   0  127   94    6  NNNNSNNNNNNTNNNNNNHNNNN
    90  170 A G  E <  S+ E   0  87A  32   94    0  GGGGGGGGGGGGGGGGGGGGGGG
    91  171 A I  E     - E   0  86A  88   94   64  TTSTVETTTETETTTTNMISSMV
    92  172 A H  E     - E   0  85A  14   94    9  HHHHHHHHHHHHHHHHHHHLHHH
    93  173 A V  E     - E   0  84A   1   94   20  VVIVVVVVIVVVIIIIVTVSVTV
    94  174 A C  E     -DE  42  83A   0   94    5  CCCCCCCCCCCCCCCCCCCTCCV
    95  175 A M  E     -DE  41  82A   0   94    7  MMMMMMMMMMMMMMMMMLMAMLM
    96  176 A V  E     +DE  40  81A   0   94    3  VVVVVVVVVVVVVVVVIVVPVVV
    97  177 A F  E     -D   39   0A  24   94    9  FFFFLLFFFLFLFFFFFFFLFFF
    98  178 A E        -     0   0   59   94    0  EEEEEEEEEEEEEEEEEEEEEEE
    99  179 A V        -     0   0   16   94   12  VVVVVVVVVVVVVVMVVAVRVAV
   100  180 A L        -     0   0   27   94    3  LLLLLLLLLLLLLLLLLLLKLLL
   101  181 A G        -     0   0   16   94    2  GGGGGGGGGGGGGGGGGGGPGGG
   102  182 A H        -     0   0   93   94   36  HHHYHHHHHHYDDDDDHCHQECE
   103  183 A H  B  >  -G  152   0B  35   94   41  HHHHQQHHHQNQNNNNNSNENSN
   104  184 A L  H  > S+     0   0    0   94    3  LLLLLLLLLLLLLLLLLLLKLLL
   105  185 A L  H  > S+     0   0   44   94    7  LLLLLLLLLLLLLLLLLYLMLYL
   106  186 A K  H  > S+     0   0  115   94   15  KKKKKRKKKRKRKKKKKKRSGKA
   107  187 A W  H  X S+     0   0   32   94   27  WWWWWWWWWWLWLLLLLLMKLLL
   108  188 A I  H  <>S+     0   0    0   94    3  IIIIIIIIIIIIIIIIIIINIII
   109  189 A I  H ><5S+     0   0   72   94   33  IIIIIVIIIVIIRRRRIVIKKVK
   110  190 A K  H 3<5S+     0   0  151   94   11  KKKKKTKKKTRKKKKKRKQKRKK
   111  191 A S  T ><5S-     0   0   16   94   18  SSSSSSSSSSSSSSSSSNTRYNY
   112  192 A N  T < 5 -     0   0  125   94   14  NNNNNNNNNNSNNNNNQNNKQNE
   113  193 A Y  T 3 >  -     0   0   35   94   11  PPPPPPPPPPPPPPPPPAPQPAP
   118  198 A V  H 3> S+     0   0   40   94   41  IILLLLIILLILLLLLLIIKTIL
   119  199 A R  H 3> S+     0   0   91   94   55  PPPPVPPPPPSAAAEAEAPKHAI
   120  200 A C  H <> S+     0   0    0   94   42  CCCCCCCCCCNCNNNNNQQQIQY
   121  201 A V  H  X S+     0   0    0   94    1  VVVVVVVVVVVVVVVVVVVLVVV
   122  202 A K  H  X S+     0   0   35   94    8  KKKKKKKKKKKKKKKKRRKARRK
   123  203 A S  H  X S+     0   0    5   94   56  SSKSTSSSKSSSTASTSNKLQNQ
   124  204 A I  H  X S+     0   0    0   94    1  IIIIIIIIIIIIIIIIIIILIII
   125  205 A I  H  X S+     0   0    0   94   34  IIIIILIIILILTTTTIIMEAIS
   126  206 A R  H  X S+     0   0   70   94   36  KKKRRRKKQRRRRRRRKRRKKRK
   127  207 A Q  H  X S+     0   0   12   94    0  QQQQQQQQQQQQQQQQQQQQQQQ
   128  208 A V  H  X S+     0   0    1   94   12  VVPVVVVVVVVVVVIVTVIQIVL
   129  209 A L  H  X S+     0   0    0   94    5  LLLLLLLLLLLLLLLLLLLQLLL
   130  210 A Q  H  X S+     0   0   44   94   32  QQLQQQQQQQEQEEEEQEEQLEL
   131  211 A G  H  X S+     0   0    0   94   20  RRTGGGRRGGGGGGGGGGGLGGG
   132  212 A L  H  X S+     0   0    0   93    6  LLLLLLLLLLLLLLLLLLVQLLL
   133  213 A D  H  X S+     0   0   38   94    7  DDTDDDDDDDDDDDDDHDEEDDD
   134  214 A Y  H  X>S+     0   0    1   94    7  YYIYYYYYYYYYYYYYYYYIYYY
   135  215 A L  I  <>S+     0   0    0   94    9  LLPLLLLLLLLLLLLLLLLDLLM
   136  216 A H  I  <5S+     0   0   18   94    2  HHHHHHHHHHHHHHHHHHHQHHH
   137  217 A S  I  <5S+     0   0   58   94   45  TTkTTTTTTTTTTTSTTSNETSR
   138  218 A K  I  <5S+     0   0   81   91   27  .KkKKK..KKKKCCCCKKKKEKR
   139  219 A C  I     S-     0   0   31   94    4  KKSKKKKKKKKKKKKKKKKQKKK
   148  228 A P  G >  S+     0   0    2   94    1  PPPPPPPPPPPPPPPPPPPPPPP
   149  229 A E  G 3  S+     0   0   61   94    4  EEQEEEEEEEEEEEEEEEEDEEE
   150  230 A N  G <  S+     0   0    8   94    5  NNDNNNNNNNNNNNNNNNNANNN
   151  231 A I  E <   - H   0 185B   0   94   11  IIIIIIIIIIVIVVVVIIVDVII
   152  232 A L  E     -GH 103 184B  38   94    9  LLTLLLLLLLLLLLLLLLLRLLL
   153  233 A M  E     - H   0 183B   9   94   23  LLDLWLLLLLVLLLVLVLVDILM
   154  234 A C        -     0   0   31   94   58  CCFTVKCCSKCRCCCCCVCGCVE
   155  235 A V        -     0   0   30   94   14  VVTVVVVVVVVAVVVVIILEIII
   156  236 A D     >  -     0   0   94   94   42  DDRNDDDDNDSDDDDDSDSDEDG
   157  237 A D  H  > S+     0   0  126   94   28  EEEEDEEEEEEDEEEEDNYNDnD
   158  238 A A  H  > S+     0   0   47   94   66  PPNPVAPPQAEAPPPPSAEVVaV
   159  239 A Y  H  4 S+     0   0   62   94   49  IIFYYYIIYYYFHHHHQAEAEAE
   160  240 A V  H  X S+     0   0   11   94   27  IVCIIIIIIIIIVVVVIAITSMG
   161  241 A R  H >X S+     0   0  153   94   44  aftkrqaarqrerrrrrmfdvni
   162  242 A R  H 3< S+     0   0   76   93   87  ccsdmlccsmlcppppssksgnd
   163  243 A M  H 34 S+     0   0   23   93   80  SSTSNLSSTSKTPPPPLQSNDQS
   164  244 A A  H << S+     0   0   28   93   44  AAAASLAAADKIPQPPLSKKPSN
   165  245 A A     <        0   0   96   93   66  NNGGSWNNGPGEQAPQFSEDTQS
   166  246 A E              0   0   93   93   60  DDNSDIDDNSLNAKLAEQAGTSN
   167      ! !              0   0    0    0    0  
   168  522 A L              0   0  145   93   52  LLFLLFLLFRMAKHSKTNKELSI
   169  523 A L        -     0   0   87   94   50  LLLLILLLLPKIHKKHVNISPQS
   170  524 A V        -     0   0   49   93   49  VVLVIHVVVLDDKAHKITIVPNS
   171  525 A N    >   -     0   0   70   94   42  NNNNSPNNNDFPAKRAHYPEpNN
   172  526 A P  T 3  S+     0   0    0   91   40  IIPPPPIIPLDDKQAK.TA.pT.
   173  527 A L  T 3  S+     0   0   45   91   36  LLLLLILLLLTVKDLK.IS.YY.
   174  528 A D  S X  S-     0   0   34   93   40  EEEKDEEEERGDDPRDEQKGDT.
   175  529 A P  G >  S+     0   0   64   94   23  PPPAPPPPPPPLPARPPSPAPIT
   176  530 A R  G 3  S+     0   0  203   94   82  DDKLQQDDKQDLALDADLVTVQG
   177  531 A N  G X>  +     0   0   28   94   37  NNNNNNNNNNPKLEPLAISSSSS
   178  532 A A  T <4 S+     0   0   11   94   41  HHAAAAHHAAAADEADSDSPLLP
   179  533 A D  T 34 S+     0   0  128   94   46  DDDDDDDDEDLKECLEKNNEEIE
   180  534 A K  T <4 S+     0   0  151   94   42  KKKKRKKKKKvscNecesdrRdn
   181  535 A I     <  -     0   0    0   94   27  IILLIIIILIvivVvvivvlIvi
   182  536 A R        +     0   0  133   94   59  KKKQRAKKKAELHNQHERLPTRQ
   183  537 A V  E     - H   0 153B   2   94   10  VVVVVIVVVIVIVVVVVVVIVVI
   184  538 A K  E     - H   0 152B  25   94    4  KKKKKKKKKKKKKKKKKKKKKKK
   185  539 A I  E     +fH  76 151B   0   94    3  IIIIIIIIIIIIIIIIIIILIII
   186  540 A A        +     0   0    8   94    2  AAAAAAAAAAAAAAAAAAAAAAA
   187  541 A D    >   +     0   0   73   94    1  DDDDDDDDDDDDDDDDDDDDDDD
   188  542 A L  G >   +     0   0    3   94    0  LLLLLLLLLLLLLLLLLLLLLLL
   189  543 A G  G 3  S+     0   0   23   94    3  GGGGGGGGGGGGGGGGGGGGGGG
   190  544 A N  G <  S+     0   0  106   94    7  NNNNNNNNNNNNNNNNNNNNNNN
   191  545 A A    <   +     0   0    1   94    8  AAAAAAAAAAAAAAAAAAGAAAA
   192  546 A C  E     -I  142   0C   2   94    5  CCCCCCCCCCCCCCCCCCCCCCC
   193  547 A W  E >   -IJ 141 196C  44   94    6  WWWWWWWWWWWWWWWWWYWWWYW
   194  548 A V  T 3  S+     0   0   36   93   20  VVVVVVVV.VTVVVVVTDVTVDY
   195  549 A H  T 3  S+     0   0  186   94   37  NNHHHHNNHHHHDDDDYYDHDYD
   196  550 A K  B <   -J  193   0C 106   94   33  KKKKKQKKKQCKRHRRRHNHHHE
   197  551 A H        -     0   0   51   94    4  HHHHHHHHHHHHHHHHHHHHHHH
   198  552 A F  S    S-     0   0   79   94    1  FFFFFFFFFFFFFFFFFFFFFFY
   199  553 A T        -     0   0   76   94    0  TTTTTTTTTTTTTTTTTTTTTTT
   200  554 A E  S    S+     0   0   75   94   11  EEEDEEEEEEEEEEEEEEEENEN
   201  555 A D        +     0   0  124   94    8  DDDDDDDDDDDDDDDDDDDDDDS
   202  556 A I        +     0   0    9   94    0  IIIIIIIIIIIIIIIIIIIIIII
   203  557 A Q  S    S-     0   0   14   94    5  QQQQQQQQQQQQQQQQQQQQQQQ
   204  558 A T    >   -     0   0   36   94    4  TTTTTTTTTTTTTTTTTTTTTTT
   205  559 A R  G >  S+     0   0   37   94   13  RRRRRCRRRCRCRRRRRRRRRRR
   206  560 A Q  G 3  S+     0   0   38   94    4  QQQQQQQQQQQQQQQQQQQQQQE
   207  561 A Y  G <  S+     0   0   10   94    3  YYYYYYYYYYYYYYYYYYYYYYY
   208  562 A R    <   -     0   0   38   94    4  RRRRRRRRRRRRRRRRRRRRRRR
   209  563 A S    >>  -     0   0    0   94   31  SSSSASSSSSSSSSSSASAAASA
   210  564 A I  H 3> S+     0   0    0   94   36  IILLLVIILVLVLLPLLILLPIP
   211  565 A E  H 3>>S+     0   0    0   94    2  EEEEEEEEEEEEEEEEEEEEEEE
   212  566 A V  H <45S+     0   0   15   94    0  VVVVVVVVVVVVVVVVVVVVIVV
   213  567 A L  H  <5S+     0   0    3   94    8  LLLLLLLLLLLLIIIILLLLILL
   214  568 A I  H  <5S-     0   0    0   94   19  LLIIIILLIILIIILIILIILLL
   215  569 A G  T  <5 +     0   0    7   94    0  GGGGGGGGGGGGGGGGGGGGGGG
   216  570 A A      < -     0   0   38   94   34  AASSAAAASAAAAAAASASATAA
   217  571 A G        -     0   0   28   94   32  GGGGEDGGGDGGGGGGEPGGRPP
   218  572 A Y        +     0   0   21   94    3  YYYYYYYYYYYYYYYYYYYYWYW
   219  573 A S    >   -     0   0   39   94   52  GGSSGGGGNGNDNNDNGNSDGNG
   220  574 A T  T >> S+     0   0   36   94   41  PPTTPTPPTTTTTTTTPYTTPYC
   221  575 A P  H 3> S+     0   0   26   94   23  PPPPPPPPPPSPSSSSPTPASTG
   222  576 A A  H <> S+     0   0    0   94    4  AAAAAAAAAAAAAAAAAAAAVAA
   223  577 A D  H <> S+     0   0    0   94    0  DDDDDDDDDDDDDDDDDDDDDDD
   224  578 A I  H  X S+     0   0    2   94    5  LLIIIILLIIIIIIIIIIIIIII
   225  579 A W  H  X S+     0   0    0   94    0  WWWWWWWWWWWWWWWWWWWWWWW
   226  580 A S  H  X S+     0   0    0   94    0  SSSSSSSSSSSSSSSSSSSSSSS
   227  581 A T  H  X S+     0   0    0   94    4  TTTTTTTTTTTTTTTTTTVTATT
   228  582 A A  H  X S+     0   0    0   94    1  AAAAAAAAAAAAAAAAAAAAAAA
   229  583 A C  H  X S+     0   0    2   94    2  CCCCCCCCCCCCCCCCCCCCCCC
   230  584 A M  H  X S+     0   0    0   94    3  MMMMMMMMMMMMMMMMMLMMLLL
   231  585 A A  H  X S+     0   0    0   94   27  TTAAAATvAAAAVVVVAAAAIAI
   232  586 A F  H  X S+     0   0    4   94    0  FFFFFFFfFFFFFFFFFFFFFFF
   233  587 A E  H  X S+     0   0    6   94    0  EEEEEEEEEEEEEEEEEEEEEEE
   234  588 A L  H  < S+     0   0    0   94    0  LLLLLLLLLLLLLLLLLLLLLLL
   235  589 A A  H  < S+     0   0   10   94   16  VVAAAAVVAAAAAAAAAAAALAI
   236  590 A T  H  < S-     0   0    4   94    2  TTTTTTTTTTTTTTTTTTTCTTT
   237  591 A G  S  < S+     0   0    4   94    0  GGGGGGGGGGGGGGGGGGGGGGG
   238  592 A D  S    S-     0   0   61   94    0  DDDDDDDDDDDDDDDDDDEDDDD
   239  593 A Y        -     0   0   85   94    0  YYYYYYYYYYYFYYYYYYFYYYF
   240  594 A L  S    S+     0   0   27   94    0  LLLLLLLLLLLLLLLLLLLLLLL
   241  595 A F        +     0   0    5   94    0  FFFFFFFFFFFFFFFFFFFFFFF
   242  596 A E        -     0   0  107   94    5  EEEEEDEEEDEDEEEEEDEEDDE
   243  597 A P        -     0   0    5   94    0  PPPPPPPPPPPPPPPPPPPPPPP
   244  598 A H        -     0   0  109   94   10  HHHHHQHHHQHQHHHHHHKHQHD
   245  599 A S        -     0   0   78   94   14  SSSSSASSSASSSSSSSATSPAE
   246  600 A G        -     0   0   23   94    3  GGGGGGGGGGGGGGSGGGSGGGG
   247  601 A E  S    S+     0   0  197   94   16  EEEEEAEEEAEVEEDEEEDESEH
   248  602 A D  S    S+     0   0  115   94   39  DDDDDTDDETDRSSNSDSNNKSS
   249  603 A Y        -     0   0   83   94    0  YYYYYFYYYFYFYYYYYYYYYYY
   250  604 A S     >  -     0   0   45   94   41  SSSSTSSSTSSTTTSTTSSSDST
   251  605 A R  H  > S+     0   0  116   94    2  RRrRRRRRRRRRRRRRRRRRKRK
   252  606 A D  H  > S+     0   0   44   94    7  DDnDDEDDDEDEDDDDDDDDDDD
   253  607 A E  H  > S+     0   0    7   94    7  EEAEEEEEEEEEEEEEEEEEDED
   254  608 A D  H  X S+     0   0   16   94    0  DDDDDDDDDDDDDDDDDDDDDDD
   255  609 A H  H  X S+     0   0    0   94    2  HHHHHHHHHHHHHHHHHHHHHHH
   256  610 A I  H  X S+     0   0    0   94   13  ILIIIIIIIILILLILLLLILLI
   257  611 A A  H  X S+     0   0    3   94    1  AAAAAAAAVAAAAAAAAAAAAAA
   258  612 A H  H  X S+     0   0   75   94   60  LLLLHHLLHHHHHHHHHHHHQHQ
   259  613 A I  H  X S+     0   0    0   94    1  IIIIIIIIIIIIIIIIIIIIIII
   260  614 A I  H  X S+     0   0   27   94   12  IIIIIIIIIIIIIIIIIVIIIVI
   261  615 A E  H  < S+     0   0   44   94    0  EEEEEEEEEEEEEEEEEEEEEEE
   262  616 A L  H  < S+     0   0   23   94    0  LLLLLLLLLLLLLLLLLLLLLLL
   263  617 A L  H  < S-     0   0   38   94    3  LLLLLLLLILLLLLLLLLLVLLL
   264  618 A G     <  -     0   0   32   94    0  GGGGGGGGGGGGGGGGGGGGGGG
   265  619 A S        -     0   0  110   94   73  HYKKPPHHRPEPPPPPPSPHESE
   266  620 A I        -     0   0   20   94   18  IIIVILIIILILIIIIIIIIMIL
   267  621 A P     >  -     0   0   64   94    0  PPPPPPPPPPPPPPPPPPPPPPP
   268  622 A R  H  > S+     0   0  151   94   44  RRRRVSRRRSKSRRRRRQRKKQS
   269  623 A H  H  4 S+     0   0  167   94   72  KSKKPQKKRQRQEEKENSNHSSY
   270  624 A F  H >4 S+     0   0   27   94   28  FVLLFFFFFFIFIIFIIVVVLVL
   271  625 A A  H 3< S+     0   0    4   94   61  ASIIAAAASAAVLLVLAILAAIL
   272  626 A L  T 3< S+     0   0   59   94   44  SLLTLLSSLLLQLLFLLFSLLFR
   273  627 A S  S <  S+     0   0   70   94   55  SAAASSSSSSSSNNRNSRRSSRN
   274  628 A G  S >  S-     0   0   13   94    0  GGGGGGGGGGGGGGGGGGGGGGG
   275  629 A K  T 3  S+     0   0  123   94   41  HEKKRRHHKRKRTTTTKKLKKKK
   276  630 A Y  T >> S+     0   0   92   94   12  YYYYYHYYYHHHYYYYYHYYYHY
   277  631 A S  H X> S+     0   0    3   94   18  SSSSSSSSSSSSAAAASGTSSGT
   278  632 A R  H 34 S+     0   0  209   94   49  KAKKRKKKQKKKAAPARLRRHLR
   279  633 A E  H <4 S+     0   0  113   94   34  ELEEEREEDRQQKKQKEKSDDKT
   280  634 A F  H << S+     0   0    3   94   22  FYFFYYFFFYFYSSMSYYYFMYF
   281  635 A F  B  <  -K  287   0D   6   94    0  FFFFFFFFFFFFFFFFFFFFFFF
   282  636 A N    >   -     0   0   24   94   53  STTTDNSSSNNNTTNTDTtNNTN
   283  637 A R  T 3  S+     0   0  208   94   37  KRKKRRKKHRARRRRRKSfKRSS
   284  638 A R  T 3  S-     0   0  130   94   44  REKKRRRRRRKKSSNSRYQKRYR
   285  639 A G  S <  S+     0   0   24   94   15  GGGGGGGGGGCGCCGCAGGGGGG
   286  640 A E        -     0   0  105   94   34  DDDDEQDDDQQQEEEECSAEESL
   287  641 A L  B     -K  281   0D  20   94    0  LLLLLLLLLLLLLLLLLLLLLLL
   288  642 A R  S    S+     0   0  107   94   21  RRKRRRRRKRRRRRRRRRKRRRR
   289  643 A H  S    S+     0   0   78   94   24  HHHHHRHHHRRHNNNNHNRNHNN
   290  644 A I        +     0   0   26   94    0  IIIIIIIIIIIIIIIIIIIIIII
   291  645 A T        +     0   0  125   94   63  HHTTSAHHTAVSSSTSHTRSQTS
   292  646 A K        +     0   0   82   94   43  KKKKSKKKKKGKGGGGRKNKRKK
   293  647 A L        -     0   0   67   94    0  LLLLLLLLLLLLLLLLLLLLLLL
   294  648 A K        -     0   0  159   94    6  KKKKKQKKKQKKKKKKKKRKRKK
   295  649 A P        +     0   0  109   94   41  MMPPPPMMPPPPPPPPPPPPFPF
   296  650 A W        -     0   0  102   94    3  WWWWWWWWWWWWWWWWWWWWWWW
   297  651 A S     >  -     0   0   49   94   39  PPGGGSPPGSSSGGGGNSGSPSP
   298  652 A L  H  > S+     0   0    2   94    0  LLLLLLLLLLLLLLLLLLLLLLL
   299  653 A F  H  > S+     0   0   64   94   42  RRFFFLRRFLFLMMMMFMKYLMK
   300  654 A D  H  >>S+     0   0   59   94   25  DDEDEEDDEEEEDDDDNNDHSND
   301  655 A V  I  X>S+     0   0   12   94    2  VVVVVIVVVIVIVVVVVVIVVVV
   302  656 A L  I  X5S+     0   0    0   94    0  LLLLLLLLLLLLLLLLLLLLLLL
   303  657 A V  I  X5S+     0   0   27   94   45  HHVVLLHHVLVLLLMLTVITKVS
   304  658 A E  I  <5S+     0   0  130   94    7  EEEDEDEEEDDDEEEEEETEEEE
   305  659 A K  I  <  -     0   0   79   94   49  SSSSSRSSSRERSSSSPDAPEDP
   310  664 A H  H  > S+     0   0  127   94   78  VVQKLQVVQQCRQEKQPPEKAPK
   311  665 A E  H  > S+     0   0  121   94   30  EEDEDEEEEEYEKKRKSVEEEVD
   312  666 A D  H  > S+     0   0   70   94   27  DDEEQEDDEEEEDDDDEEEDEEE
   313  667 A A  H  X S+     0   0    0   94    1  AAAAAAAAAAAGAAAAAAAAAAA
   314  668 A A  H  X S+     0   0   24   94   61  EEAHASEEASRVAAEAAKEEEKK
   315  669 A Q  H  X S+     0   0   88   94   73  HHASAQHHGQEQSSASLKSELKE
   316  670 A F  H  X S+     0   0    0   94    2  FFFFFFFFFFFFFFFFFFFFLFI
   317  671 A T  H  X S+     0   0   18   94   50  AATSSSAATSTAAASATSTASSS
   318  672 A D  H  < S+     0   0  100   94   53  SSDSDSSSDSNSSSSSSDSSSDD
   319  673 A F  H  X S+     0   0    2   94    0  FFFFFFFFFFFFFFFFFFFFFFF
   320  674 A L  H >X S+     0   0    0   94    0  LLLLLLLLLLLLLLLLLLLLLLL
   321  675 A I  H >< S+     0   0   67   94   42  LLLVLLLLLLTLTKRTELLYLLS
   322  676 A P  H >4 S+     0   0   46   94   10  PPPPTTPPPTPPPPPPPPPPPPP
   323  677 A M  H << S+     0   0    1   94    0  MMMMMMMMMMMMMMMMMMMMMMM
   324  678 A L  T << S+     0   0    3   94    3  LLLLLLLLLLLLLLLLLLLLLLL
   325  679 A E    <   -     0   0   74   94   11  EEEDEEEEEEDEEEEEAEEEHEQ
   326  680 A M  S    S+     0   0   12   94   39  VVLLLLVVLLFLFFFFYYYFYYL
   327  681 A V  S >> S-     0   0   26   94   64  MMIVQLMMILDLDDNDDNDDYND
   328  682 A P  G >4 S+     0   0   12   94    1  PPPPPPPPPPPPPPPPPPPPPPP
   329  683 A E  G 34 S+     0   0  161   94   33  DDEEGEDDEENQNNDNNVSTDVR
   330  684 A K  G <4 S+     0   0  156   94   25  RRKRRKRRKKRKKKEKKIKKSIK
   331  685 A R  S << S-     0   0   12   93    0  RRRRRRRRRRRRRRRRRRRRRRR
   332  686 A A        -     0   0    9   93    0  AAAAAAAAAAAAAAAAAAAAAAA
   333  687 A S     >  -     0   0   54   93   41  SSTTTTSSTTTTTTTTSSTTTSD
   334  688 A A  H  > S+     0   0    3   93    0  AAAAAAAAAAAAAAAAAAAAAAA
   335  689 A G  H  > S+     0   0    7   93   35  AAAAAAAAAAESAAAAWATKAAG
   336  690 A E  H >4 S+     0   0  102   93   34  EEEQQQEEEQEQEEEEDEDEEEG
   337  691 A C  H >< S+     0   0    4   93   11  CCCCCCCCCCCCCCCCCCCSLCL
   338  692 A L  H 3< S+     0   0   33   93    2  LLLLLLLLLLLLLLLLLLLLVLV
   339  693 A R  T << S+     0   0  174   93   58  KKRSQKKKRKRKQQEQQQASNQN
   340  694 A H  S X  S-     0   0   43   93    0  HHHHHHHHHHHHHHHHHHHHHHH
   341  695 A P  G >  S+     0   0   92   93   10  PPPPPPPPPPPPPPPPSPPPKPP
   342  696 A W  G 3  S+     0   0    9   92    0  WWWWWWWWWW WWWWWWWWWWWW
   343  697 A L  G <  S+     0   0    4   92    7  LLLLLILLLI LLLLLILLLLLL
   344  698 A N    <         0   0  107   79   45  SS AQTSSNT T    TEN DEK
   345  699 A S              0   0  107   69   37  T  SASTTSS S    G   G  
 SeqNo PDBNo   V   L   I   M   F   W   Y   G   A   P   S   T   C   H   R   K   Q   E   N   D  NOCC NDEL NINS ENTROPY RELENT WEIGHT
    1   81 A   0   0   0   0   0   0   0   0   0  98   2   0   0   0   0   0   0   0   0   0    54    0    0   0.092      3  0.96
    2   82 A  99   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    89    0    0   0.062      2  0.99
    3   83 A   2   0   0   0   0   0   0   0   0   0   1   0   0   0   1  85   0   4   6   0    89    0    0   0.622     20  0.72
    4   84 A   3   1  94   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0    89    0    0   0.270      9  0.95
    5   85 A   0   0   0   0   1   0   0  99   0   0   0   0   0   0   0   0   0   0   0   0    90    0    0   0.061      2  0.95
    6   86 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1   4   0  94    90    0    0   0.242      8  0.95
    7   87 A   6  83   4   0   4   0   0   0   0   1   0   0   0   0   0   0   0   1   0   0    90    0    0   0.689     23  0.80
    8   88 A   0   1   0   0  93   0   6   0   0   0   0   0   0   0   0   0   0   0   0   0    90    0    0   0.275      9  0.98
    9   89 A   2   0   0   0   0   0   0   0   1   0   0   0   1   3   0   1   1   0  88   2    90    0    0   0.597     19  0.76
   10   90 A   0   0   0   0   0   0   0  80   0   0   2   0   0   0   0   0   0   0  11   7    92    0    0   0.678     22  0.73
   11   91 A   4   0   0   0   0   0   0   0   0   0   0   0   0   1  89   4   1   0   0   0    93    0    0   0.470     15  0.81
   12   92 A   0   0   0   0   2   0  94   0   0   0   0   4   0   0   0   0   0   0   0   0    93    0    0   0.280      9  0.88
   13   93 A   0   1   1   0   0   0   1   0   0   0   0   0   0  90   3   0   3   0   0   0    93    0    0   0.460     15  0.81
   14   94 A  98   1   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    93    0    0   0.119      3  0.98
   15   95 A  35   0  62   0   0   0   0   0   0   0   0   1   0   0   0   1   1   0   0   0    92    0    0   0.811     27  0.80
   16   96 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0  99   0   1   0   0   0    93    0    0   0.059      1  0.98
   17   97 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0    93    0    0   0.000      0  1.00
   18   98 A   1  98   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    93    0    0   0.119      3  0.97
   19   99 A   1   0   0   0   0   0   0  97   0   0   2   0   0   0   0   0   0   0   0   0    93    0    0   0.163      5  0.96
   20  100 A   0   0   0   0   0  99   0   0   0   0   0   0   1   0   0   0   0   0   0   0    93    0    0   0.059      1  0.96
   21  101 A   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0    93    0    0   0.000      0  1.00
   22  102 A   0   0   0   0   0   0   0   0   0   0   0   0   0  97   0   0   0   0   1   2    93    0    0   0.163      5  0.96
   23  103 A   0   0   0   0  98   0   2   0   0   0   0   0   0   0   0   0   0   0   0   0    93    0    0   0.104      3  1.00
   24  104 A   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0    93    0    0   0.000      0  1.00
   25  105 A   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0    93    0    0   0.000      0  1.00
   26  106 A 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    93    0    0   0.000      0  1.00
   27  107 A   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0    93    0    0   0.000      0  1.00
   28  108 A   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    93    0    0   0.000      0  1.00
   29  109 A   0   0   0   0   0   0   0   2  16   0  22   0  60   0   0   0   0   0   0   0    93    0    0   1.013     33  0.59
   30  110 A   0   0   0   0   0  95   0   0   0   0   0   0   0   0   5   0   0   0   0   0    93    0    0   0.209      6  0.99
   31  111 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100    93    0    0   0.000      0  1.00
   32  112 A   2  19  51  25   1   0   0   0   0   0   0   1   0   0   0   0   0   0   1   0    93    0    0   1.237     41  0.64
   33  113 A   0   1   1   4   0   0   0   0   0   0   0   1   1   0   5   3  82   0   1   0    93    0    0   0.812     27  0.62
   34  114 A   6   0   0   0   0   0   0  41   8   0   2   2   0   0  17   5   0   9   6   3    93    0    0   1.861     62  0.26
   35  115 A   0   0   0   6   0   0   0   0   0   0   0   0   0   0   6  84   0   2   1   0    93    0    0   0.632     21  0.75
   36  116 A   0   0   0   0   0   0   0   3   0   0   0   1   4   0  65  23   1   0   3   0    93    0    0   1.073     35  0.56
   37  117 A   0   0   0   0  87   0  11   0   0   0   0   0   0   2   0   0   0   0   0   0    93    0    0   0.443     14  0.92
   38  118 A 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    92    0    0   0.000      0  1.00
   39  119 A   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0    93    0    0   0.000      0  1.00
   40  120 A   0  31   7  61   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.908     30  0.83
   41  121 A   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0    94    0    0   0.059      1  0.98
   42  122 A  89   0  10   0   0   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0    94    0    0   0.373     12  0.92
   43  123 A  97   1   0   0   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    93    0    0   0.163      5  0.95
   44  124 A   1   0   0   0   0   0   0   0   0   0   0   0   0   0   3  96   0   0   0   0    94    0    0   0.200      6  0.94
   45  125 A   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   1   0   0   0   0    94    0    0   0.059      1  0.98
   46  126 A   0   0   0   0   0   0   0   0  98   0   0   0   0   0   0   0   0   0   0   2    94    0    0   0.103      3  0.95
   47  127 A   3   0   0   0   0   0   0  14   0  20   1   0   0   0   0   1  23  37   0   0    94    0    0   1.511     50  0.37
   48  128 A   1   0   0   2   0   0   0   0   0   0   0   1   0  94   0   0   0   0   0   2    94    0    0   0.322     10  0.84
   49  129 A   0   2   0   0  10   0  88   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.416     13  0.95
   50  130 A   0   0   2   0   0   0   0   0   9   0   0  89   0   0   0   0   0   0   0   0    94    0    0   0.392     13  0.81
   51  131 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   2   0  96   0   2    94    0    0   0.205      6  0.95
   52  132 A   0   0   0   0   0   0   0   0   1   0   0  99   0   0   0   0   0   0   0   0    94    0    0   0.059      1  0.98
   53  133 A   0   0   2   0   0   0   0   0  97   0   0   0   0   0   0   0   0   0   0   1    94    0    0   0.162      5  0.94
   54  134 A  17  71   1   0   0   0   0   0   2   0   0   0   0   0   5   1   1   1   0   0    93    0    0   0.981     32  0.58
   55  135 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100    93    0    0   0.000      0  1.00
   56  136 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0    94    0    0   0.000      0  1.00
   57  137 A   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
   58  138 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0  27  72   1   0   0   0    94    0    0   0.635     21  0.79
   59  139 A   0  91   7   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.323     10  0.92
   60  140 A   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
   61  141 A   0   0   0   0   0   0   0   0   0   0   1   0   0   0  12  82   2   2   1   0    94    0    0   0.675     22  0.77
   62  142 A   0   0   0   0   0   0   1   0   3   0  40   7  45   0   1   1   0   0   0   1    94    0    0   1.223     40  0.50
   63  143 A  97   0   2   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0    93    0    0   0.163      5  0.96
   64  144 A   0   0   0   0   0   0   0   0   0   0   0   1   0   0  98   0   0   0   0   1    93    0    0   0.119      3  0.93
   65  145 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  28  40  32    93    0    0   1.088     36  0.63
   66  146 A   0   0   0   0   0   0   0   0   3   0  77  19   0   0   0   0   0   0   0   0    93    0    0   0.627     20  0.68
   67  147 A   0   0   0   0   0   0   0   0   1   0   1   0   0   0   0   1   0   0   0  97    93    0    0   0.178      5  0.93
   68  148 A   0   0   0   0   0   0   0   0   2  96   0   0   0   0   0   0   0   1   0   1    93    0    0   0.222      7  0.91
   69  149 A   0   1   0   2   0   0   0   2   0   0  49   4   0   0   0   9   0   0  27   5    93    0    0   1.419     47  0.39
   70  150 A   0   0   0   0   0   0   0   0   0   0   1   0   0   1   0   0   0   0   8  90    93    0    0   0.384     12  0.86
   71  151 A   2   2   1   1   0   0   0   1   0  85   3   0   0   0   0   0   4   0   0   0    93    0    0   0.696     23  0.69
   72  152 A   0   0   0   0   1   0   4   3   0   0   1   0   0   1   6  23   2   0  58   0    93    0    0   1.303     43  0.44
   73  153 A   0   0   0   0   0   0   0   2   1   0   0   0   0   0  68  29   0   0   0   0    93    0    0   0.754     25  0.73
   74  154 A   0   0   0   0   0   0   0   0   0   0   1   0   0   2   4   1   0  65   2  25    93    0    0   1.026     34  0.69
   75  155 A   0   0   0  46   0   0   0   1   0   0   0  17   0   2  11  22   0   0   1   0    94    0    0   1.411     47  0.31
   76  156 A  62   0  23   0   0   0   0   0   0   0   0  10   5   0   0   0   0   0   0   0    94    0    0   1.018     33  0.65
   77  157 A  97   1   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.162      5  0.97
   78  158 A   0   0   0   0   0   0   0   1   0   0   0   0   0   2   3   1  91   0   1   0    94    0    0   0.418     13  0.84
   79  159 A   0  90   0  10   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.316     10  0.97
   80  160 A   3  51  43   2   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.947     31  0.73
   81  161 A   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   3  96    94    0    0   0.200      6  0.94
   82  162 A   0   0   0   0   0   0   0   0   0   0   0   0   0   4   0   0   0   0   0  96    94    0    0   0.176      5  0.91
   83  163 A   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
   84  164 A   0   0   0   0   0   0   0   0   0   0   0   3   0   0  18  78   0   0   1   0    94    0    0   0.664     22  0.76
   85  165 A   5   0  93   0   0   0   0   0   0   0   0   0   0   2   0   0   0   0   0   0    94    0    0   0.310     10  0.89
   86  166 A   0   1   0   1   0   0   0   0   1   0  76  12   0   5   2   1   0   0   1   0    94    0    0   0.943     31  0.52
   87  167 A   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
   88  168 A  63   2   2  26   0   0   0   0   1   2   1   0   0   0   0   0   0   2   0   1    94    0    0   1.114     37  0.58
   89  169 A   0   0   0   0   0   0   0   0   0   0   1   1   0   1   0   0   0   0  97   0    94    0    0   0.176      5  0.94
   90  170 A   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
   91  171 A  16   0  22   2   0   0   0   0   0   3   5  46   0   1   0   0   0   3   1   0    94    0    0   1.540     51  0.36
   92  172 A   0   1   0   0   0   0   0   0   0   0   0   0   0  95   0   0   0   0   1   3    94    0    0   0.258      8  0.91
   93  173 A  64   0  33   0   0   0   0   0   0   0   1   2   0   0   0   0   0   0   0   0    94    0    0   0.783     26  0.80
   94  174 A   1   0   0   0   0   0   0   0   0   0   0   1  98   0   0   0   0   0   0   0    94    0    0   0.118      3  0.95
   95  175 A   0   2   3  94   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.302     10  0.93
   96  176 A  98   0   1   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0    94    0    0   0.118      3  0.96
   97  177 A   0  22   0   2  76   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.629     20  0.91
   98  178 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0    94    0    0   0.000      0  1.00
   99  179 A  94   0   0   3   0   0   0   0   2   0   0   0   0   0   1   0   0   0   0   0    94    0    0   0.302     10  0.87
  100  180 A   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0    94    0    0   0.059      1  0.96
  101  181 A   0   0   0   0   0   0   0  99   0   1   0   0   0   0   0   0   0   0   0   0    94    0    0   0.059      1  0.98
  102  182 A   0   0   0   0   0   0   9   0   0   0   0   0   2  78   0   0   1   2   0   9    94    0    0   0.828     27  0.63
  103  183 A   0   0   0   0   0   0   0   0   0   0   2   0   0  61   0   0  23   1  13   0    94    0    0   1.036     34  0.58
  104  184 A   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0    94    0    0   0.059      1  0.96
  105  185 A   0  96   0   1   0   0   2   0   0   0   0   0   0   0   0   1   0   0   0   0    94    0    0   0.220      7  0.92
  106  186 A   0   0   0   0   0   1   0   1   1   0   1   0   0   0   4  91   0   0   0   0    94    0    0   0.409     13  0.85
  107  187 A   0  14   1   1   0  83   0   0   0   0   0   0   0   0   0   1   0   0   0   0    94    0    0   0.573     19  0.72
  108  188 A   0   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1   0    94    0    0   0.059      1  0.96
  109  189 A   4   0  84   0   0   0   0   0   0   0   0   0   0   0   6   4   1   0   0   0    94    0    0   0.639     21  0.67
  110  190 A   0   0   0   0   0   0   0   0   0   0   1   2   0   0   3  93   1   0   0   0    94    0    0   0.360     12  0.88
  111  191 A   0   0   0   0   0   0   2   0   0   0  93   1   0   0   1   0   0   0   3   0    94    0    0   0.360     12  0.81
  112  192 A   0   0   0   0   0   0   0   0   0   2   1   0   0   0   0   1   2   1  93   0    94    0    0   0.380     12  0.86
  113  193 A   0   2   0   1   1   0  94   0   0   0   0   0   0   2   0   0   0   0   0   0    94    0    0   0.322     10  0.88
  114  194 A   0   0   0   4   0   0   0   0   0   0   0   3   0   0  13   1  76   3   0   0    94    0    0   0.877     29  0.61
  115  195 A   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   1   0   0   0   0    94    0    0   0.059      1  0.97
  116  196 A   4  78  12   5   0   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0    94    0    0   0.786     26  0.80
  117  197 A   0   2   0   0   0   0   0   0   2  95   0   0   0   0   0   0   1   0   0   0    94    0    0   0.264      8  0.89
  118  198 A  27  52  13   0   0   0   0   0   0   0   1   1   0   0   0   1   5   0   0   0    94    0    0   1.256     41  0.59
  119  199 A   4   1   1   0   0   0   0   0  10  62   1   0   0   1  17   1   0   2   0   0    94    0    0   1.282     42  0.45
  120  200 A   0   0   1   0   0   0   1   0   0   0   0   0  84   0   0   0   4   0  10   0    94    0    0   0.602     20  0.58
  121  201 A  99   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.059      1  0.99
  122  202 A   0   0   0   0   0   0   0   0   1   0   0   0   0   0   4  95   0   0   0   0    94    0    0   0.234      7  0.92
  123  203 A   0   1   0   0   0   0   0   0   6   0  60   4   0   0   0  23   3   0   2   0    94    0    0   1.199     40  0.44
  124  204 A   0   1  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.059      1  0.99
  125  205 A  13   6  69   1   0   0   0   0   1   0   1   7   0   0   0   0   0   1   0   0    94    0    0   1.080     36  0.65
  126  206 A   0   0   0   0   0   0   0   0   0   0   0   0   0   1  63  15  21   0   0   0    94    0    0   0.954     31  0.64
  127  207 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0    94    0    0   0.000      0  1.00
  128  208 A  91   1   3   0   0   0   0   0   0   1   0   2   0   0   0   0   1   0   0   0    94    0    0   0.418     13  0.87
  129  209 A   0  98   0   0   0   0   0   1   0   0   0   0   0   0   0   0   1   0   0   0    94    0    0   0.118      3  0.95
  130  210 A   0   3   0   0   0   0   0   0   0   0   0   0   0  12   0   1  72  12   0   0    94    0    0   0.895     29  0.68
  131  211 A   0   2   0   0   0   0   0  91   0   0   0   1   0   0   4   0   0   1   0   0    94    0    0   0.394     13  0.80
  132  212 A   1  97   0   0   0   0   0   0   0   0   1   0   0   0   0   0   1   0   0   0    93    0    0   0.178      5  0.93
  133  213 A   0   0   0   0   0   0   0   0   0   0   0   1   0   1   0   1   0   2   0  95    94    0    0   0.279      9  0.93
  134  214 A   0   0   2   0   0   0  97   0   0   0   0   0   0   0   0   1   0   0   0   0    94    0    0   0.162      5  0.93
  135  215 A   0  96   0   1   0   0   0   0   0   1   0   0   0   0   0   1   0   0   0   1    94    0    0   0.235      7  0.91
  136  216 A   0   0   0   0   0   0   0   0   0   0   0   0   0  98   1   0   1   0   0   0    94    0    0   0.118      3  0.97
  137  217 A   0   0   0   0   0   0   0   1   0   0  33  61   0   0   1   2   0   1   1   0    94    0    0   0.944     31  0.54
  138  218 A   0   0   0   0   0   0   0   0   0   0   0   0   8   0   1  90   0   1   0   0    91    0    0   0.390     13  0.72
  139  219 A   0   0   0   1   0   0   1   0   0   0   0   1  94   0   0   3   0   0   0   0    94    0    0   0.317     10  0.85
  140  220 A   1   0   0   0   0   0   0   1   0   0   2   0   3   1  27  53   9   1   2   0    94    0    0   1.365     45  0.49
  141  221 A   1   0  93   0   0   0   0   1   0   0   0   1   0   0   1   0   0   0   3   0    94    0    0   0.375     12  0.84
  142  222 A   1   0  97   0   0   0   0   0   0   0   0   1   0   0   0   1   0   0   0   0    94    0    0   0.176      5  0.95
  143  223 A   1   0   3   0   0   0   0   0   0   0   1   0   0  94   1   0   0   0   0   0    94    0    0   0.317     10  0.84
  144  224 A   0   0   0   0   1   0   0   0   0   0   1  92   0   3   0   1   0   1   0   0    93    0    0   0.378     12  0.84
  145  225 A   0   0   0   0   0   0   0   0   0   1   0   1   0   0   0   0   1   0   0  97    94    0    0   0.176      5  0.94
  146  226 A   0   1  97   0   0   0   0   0   0   0   1   0   0   0   0   0   1   0   0   0    94    0    0   0.176      5  0.93
  147  227 A   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0  98   1   0   0   0    94    0    0   0.118      3  0.96
  148  228 A   0   0   0   0   0   0   0   0   0  99   0   0   0   0   1   0   0   0   0   0    94    0    0   0.059      1  0.99
  149  229 A   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1  97   0   1    94    0    0   0.176      5  0.96
  150  230 A   0   1   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0  97   1    94    0    0   0.176      5  0.94
  151  231 A  11   0  87   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1   0   1    94    0    0   0.454     15  0.89
  152  232 A   0  95   0   0   2   0   0   0   0   0   0   1   0   0   1   0   0   1   0   0    94    0    0   0.279      9  0.91
  153  233 A   5  63   2  26   0   1   0   0   0   0   0   0   0   0   1   0   0   0   0   2    94    0    0   1.057     35  0.77
  154  234 A   3   1   0   0   2   0   0   1   0   0  24   7  53   0   1   2   0   3   0   1    94    0    0   1.451     48  0.42
  155  235 A  89   1   5   0   0   0   0   0   1   0   0   1   0   0   1   0   0   1   0   0    94    0    0   0.498     16  0.85
  156  236 A   0   0   0   0   0   0   0  13   0   0   4   0   0   0   1   0   0   5  30  47    94    0    0   1.318     43  0.57
  157  237 A   0   1   0   0   0   0   1   0   0   0   0   0   0   1   0   0   2  51   3  40    94    0    0   1.046     34  0.71
  158  238 A   7   0   0   0   0   0   0   2  36  21   2   3   0   1   0   0  22   2   1   0    94    0    0   1.678     56  0.33
  159  239 A   0   0   4   0   6   0  72   0   3   1   0   0   0   7   1   0   1   3   0   0    94    0    0   1.102     36  0.51
  160  240 A  34   2  57   1   0   0   0   1   1   0   1   1   1   0   0   0   0   0   0   0    94    0    0   1.057     35  0.72
  161  241 A   1   0   1   1   2   0   0   0   3   1   0   1   0   0  76   7   2   2   1   1    94    0    0   1.099     36  0.55
  162  242 A   0   3   0   2  19   0   1   3   3   8  24  23   6   0   2   1   0   0   2   2    93    0    0   2.126     70  0.13
  163  243 A   0   3   0   1   0   0   0  17   4   8  15  24   2   1  17   1   3   0   2   1    93    0    0   2.143     71  0.19
  164  244 A   0   2   1   0   0   0   0   0  75   5   5   0   0   0   1   3   4   0   1   1    93    0    0   1.052     35  0.56
  165  245 A   5   0   1   0   1   1   0  31  26   2  19   1   0   0   0   0   3   2   5   1    93    0    0   1.865     62  0.34
  166  246 A   0   2   1   0   0   0   0   1   3   0  12   2   0   1   0   4   1   4  41  27    93    0    0   1.713     57  0.40
  167          0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0     0    0    0   0.000      0  1.00
  168  522 A   0  49   1   3  30   0   0   0   1   1   2   1   0   3   1   3   0   1   1   1    93    0    0   1.514     50  0.47
  169  523 A   3  74   5   0   0   0   0   0   0   3   2   1   0   2   1   5   1   0   1   0    94    0    0   1.109     37  0.49
  170  524 A  66  10   8   0   1   1   0   0   4   1   1   1   0   2   0   2   0   0   1   2    93    0    0   1.373     45  0.50
  171  525 A   0   0   0   0   2   0   1   0   2   4   4   0   0   2   1   4   0   1  77   1    94    0    0   1.046     34  0.57
  172  526 A   0   1   5   0   0   0   0   0   2  80   0   2   0   0   0   2   4   0   0   2    91    0    0   0.859     28  0.59
  173  527 A   1  82   2   0   1   0   2   0   0   0   1   1   0   0   0   2   0   0   0   5    91    0    0   0.769     25  0.63
  174  528 A   0   1   0   0   0   0   0   2   0   4   0   1   0   1   2   2   1  47   0  38    93    0    0   1.300     43  0.60
  175  529 A   0   1   1   0   0   0   0   0   6  87   2   1   0   0   1   0   0   0   0   0    94    0    0   0.570     19  0.77
  176  530 A   2  16   1   0   0   0   0   5   2   1   0   1   0   0  19  22  21   1   0   7    94    0    0   1.980     66  0.17
  177  531 A   0   2   1   0   0   0   0   0   1   2   5   0   0   0   1   1   0   4  81   1    94    0    0   0.868     28  0.62
  178  532 A   0   3   0   0   0   0   0   1  78   3   2   0   0   5   0   0   0   4   0   3    94    0    0   0.947     31  0.58
  179  533 A   0   3   1   0   0   0   0   0   0   0   0   0   4   3   0   2   0  33   2  51    94    0    0   1.275     42  0.54
  180  534 A   1   0   0   0   0   0   0   0   0   1   4   0   2   1   5  74   0   2   6   2    94    0    0   1.076     35  0.58
  181  535 A  13  36  51   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.974     32  0.73
  182  536 A   0   2   0   0   0   0   0   0   2   1   0   2   0   2  23  41  19   2   4   0    94    0    0   1.614     53  0.41
  183  537 A  82   0  17   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1   0   0    94    0    0   0.513     17  0.90
  184  538 A   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0  98   1   0   0   0    94    0    0   0.118      3  0.96
  185  539 A   0   1  98   0   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0   0    94    0    0   0.118      3  0.96
  186  540 A   0   0   0   0   0   0   0   1  98   0   0   0   1   0   0   0   0   0   0   0    94    0    0   0.118      3  0.97
  187  541 A   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0  99    94    0    0   0.059      1  0.98
  188  542 A   0  99   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.059      1  1.00
  189  543 A   0   0   0   0   0   0   0  97   0   0   3   0   0   0   0   0   0   0   0   0    94    0    0   0.141      4  0.96
  190  544 A   0   0   0   0   0   0   1   0   1   0   0   0   0   0   0   2   0   0  96   0    94    0    0   0.220      7  0.93
  191  545 A   1   0   0   0   0   0   0   1  95   0   2   1   0   0   0   0   0   0   0   0    94    0    0   0.279      9  0.92
  192  546 A   0   0   0   0   1   0   0   0   0   0   0   0  98   0   1   0   0   0   0   0    94    0    0   0.118      3  0.95
  193  547 A   0   1   0   0   0  96   2   1   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.220      7  0.93
  194  548 A  91   1   0   0   0   0   1   0   0   0   1   3   0   0   0   0   0   0   0   2    93    0    0   0.422     14  0.80
  195  549 A   0   1   0   0   0   0   5   0   0   0   0   0   0  74   0   0   1   0  10   9    94    0    0   0.907     30  0.62
  196  550 A   0   0   0   0   0   0   0   0   0   0   0   0   1   9   5  81   2   1   1   0    94    0    0   0.765     25  0.66
  197  551 A   0   0   0   0   0   0   0   1   0   0   0   0   0  98   0   0   0   0   1   0    94    0    0   0.118      3  0.96
  198  552 A   0   3   0   0  96   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.200      6  0.99
  199  553 A   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  200  554 A   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   1   0  88   2   7    94    0    0   0.482     16  0.88
  201  555 A   1   0   0   0   0   0   0   1   0   0   1   1   0   0   0   0   0   0   0  96    94    0    0   0.235      7  0.92
  202  556 A   0   1  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.059      1  0.99
  203  557 A   0   0   0   0   0   0   1   0   0   0   1   0   0   0   0   0  98   0   0   0    94    0    0   0.118      3  0.94
  204  558 A   0   0   0   0   0   0   0   0   0   0   0  98   0   0   2   0   0   0   0   0    94    0    0   0.103      3  0.95
  205  559 A   0   0   0   0   0   0   0   0   0   0   0   0   4   1  95   0   0   0   0   0    94    0    0   0.234      7  0.87
  206  560 A   0   0   0   0   0   0   0   0   0   0   0   0   1   0   0   0  98   1   0   0    94    0    0   0.118      3  0.95
  207  561 A   0   0   0   0   0   0  99   0   0   1   0   0   0   0   0   0   0   0   0   0    94    0    0   0.059      1  0.97
  208  562 A   0   0   0   0   0   0   0   1   0   0   1   0   0   0  98   0   0   0   0   0    94    0    0   0.118      3  0.95
  209  563 A   1   0   0   0   0   0   0   0  26   0  73   0   0   0   0   0   0   0   0   0    94    0    0   0.624     20  0.69
  210  564 A  15  54  27   0   0   0   0   0   0   3   0   0   0   0   0   0   0   0   0   1    94    0    0   1.126     37  0.63
  211  565 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1   1  98   0   0    94    0    0   0.118      3  0.97
  212  566 A  99   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.059      1  0.99
  213  567 A   0  91   9   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.291      9  0.91
  214  568 A   0  12  82   4   0   0   0   0   0   0   0   2   0   0   0   0   0   0   0   0    94    0    0   0.631     21  0.81
  215  569 A   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  216  570 A   0   0   0   0   0   0   0   0  69   0  29   2   0   0   0   0   0   0   0   0    94    0    0   0.695     23  0.66
  217  571 A   0   0   0   0   0   0   0  74   0   3   0   0   0   0   1   0   1  18   0   2    94    0    0   0.817     27  0.67
  218  572 A   0   1   0   0   0   2  97   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.162      5  0.97
  219  573 A   0   0   0   0   0   0   0  30   0   0  38   0   0   0   1   0   0   0  28   3    94    0    0   1.242     41  0.47
  220  574 A   0   0   0   0   0   0   2   0   0  26   1  70   1   0   0   0   0   0   0   0    94    0    0   0.775     25  0.58
  221  575 A   0   0   0   0   0   0   0   1   1  86  10   2   0   0   0   0   0   0   0   0    94    0    0   0.531     17  0.76
  222  576 A   1   0   0   0   0   0   0   0  98   1   0   0   0   0   0   0   0   0   0   0    94    0    0   0.118      3  0.96
  223  577 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100    94    0    0   0.000      0  1.00
  224  578 A   2   4  94   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.278      9  0.95
  225  579 A   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  226  580 A   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  227  581 A   1   0   0   0   0   0   0   0   1   0   0  98   0   0   0   0   0   0   0   0    94    0    0   0.118      3  0.95
  228  582 A   0   0   0   0   0   0   0   0  99   0   0   1   0   0   0   0   0   0   0   0    94    0    0   0.059      1  0.98
  229  583 A   0   0   0   0   1   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0    94    0    0   0.059      1  0.98
  230  584 A   0   4   0  95   0   0   0   0   0   0   0   0   0   0   0   0   1   0   0   0    94    0    0   0.234      7  0.96
  231  585 A   7   0   2   0   0   0   0   0  85   0   0   4   0   0   0   0   0   1   0   0    94    0    0   0.595     19  0.72
  232  586 A   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  233  587 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0    94    0    0   0.000      0  1.00
  234  588 A   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  235  589 A   5   1   1   0   0   0   0   0  93   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.324     10  0.84
  236  590 A   0   0   0   0   0   0   0   0   0   0   0  99   1   0   0   0   0   0   0   0    94    0    0   0.059      1  0.97
  237  591 A   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  238  592 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1   0  99    94    0    0   0.059      1  0.99
  239  593 A   0   0   0   0   3   0  97   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.141      4  0.99
  240  594 A   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  241  595 A   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  242  596 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  94   0   6    94    0    0   0.237      7  0.95
  243  597 A   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  244  598 A   0   0   0   0   0   0   0   0   0   0   0   0   0  94   0   1   4   0   0   1    94    0    0   0.293      9  0.89
  245  599 A   0   0   0   0   0   0   0   0   4   1  93   1   0   0   0   0   0   1   0   0    94    0    0   0.351     11  0.85
  246  600 A   0   0   0   0   0   0   0  98   0   0   2   0   0   0   0   0   0   0   0   0    94    0    0   0.103      3  0.97
  247  601 A   1   0   0   0   0   0   0   0   2   0   1   0   0   1   0   0   0  88   0   6    94    0    0   0.512     17  0.84
  248  602 A   0   0   0   0   0   0   0   0   0   0  10   2   0   0   1   1   0  19   4  63    94    0    0   1.146     38  0.60
  249  603 A   0   0   0   0   3   0  97   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.141      4  0.99
  250  604 A   0   0   0   0   0   0   0   0   0   0  63  35   1   0   0   0   0   0   0   1    94    0    0   0.756     25  0.59
  251  605 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0  98   2   0   0   0   0    94    0    0   0.103      3  0.97
  252  606 A   0   0   0   0   0   0   0   2   0   0   0   0   0   0   0   0   0   3   2  93    94    0    0   0.345     11  0.93
  253  607 A   0   0   0   0   0   0   0   0   1   1   0   1   0   0   0   0   0  95   0   2    94    0    0   0.279      9  0.92
  254  608 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100    94    0    0   0.000      0  1.00
  255  609 A   0   0   0   0   0   0   0   0   0   0   0   0   0  98   0   0   2   0   0   0    94    0    0   0.103      3  0.98
  256  610 A   0  14  86   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.402     13  0.86
  257  611 A   1   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.059      1  0.98
  258  612 A   0  44   0   0   0   0   0   0   0   0   0   0   0  54   0   0   2   0   0   0    94    0    0   0.776     25  0.39
  259  613 A   2   0  98   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.103      3  0.99
  260  614 A  16   0  79   5   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.637     21  0.87
  261  615 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0    94    0    0   0.000      0  1.00
  262  616 A   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  263  617 A   1  97   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.162      5  0.97
  264  618 A   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  265  619 A   0   0   0   0   0   0   1   0   1  14  20   1   0   5   3  34   0   3   2  15    94    0    0   1.850     61  0.27
  266  620 A  36   5  57   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.891     29  0.81
  267  621 A   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  268  622 A   1   3   0   0   0   0   0   0   0  16   4   0   0   0  70   3   2   0   0   0    94    0    0   1.026     34  0.55
  269  623 A   0   0   0   0   0   0   3   0  13   4   4   0   0  19   3  44   3   3   3   0    94    0    0   1.760     58  0.27
  270  624 A   9  35   9   0  46   0   2   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   1.227     40  0.71
  271  625 A   5   9  35   0   0   0   0   1  48   0   2   0   0   0   0   0   0   0   0   0    94    0    0   1.216     40  0.39
  272  626 A  20  59   0   6   3   0   0   0   4   0   4   1   0   0   1   0   1   0   0   0    94    0    0   1.336     44  0.55
  273  627 A   0   2   0   0   0   0   0   0  35   0  51   0   0   0   4   0   0   0   7   0    94    0    0   1.120     37  0.45
  274  628 A   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  275  629 A   0   1   0   0   0   0   0   0   0   0   0   7   0   4  23  63   0   1   0   0    94    0    0   1.057     35  0.58
  276  630 A   0   0   0   0   0   0  94   0   0   0   0   0   0   6   0   0   0   0   0   0    94    0    0   0.237      7  0.88
  277  631 A   0   0   0   0   0   0   0   2   6   0  89   2   0   0   0   0   0   0   0   0    94    0    0   0.440     14  0.82
  278  632 A   0   2   0   0   0   0   0   0   7   1   0   0   0   1  41  44   3   0   0   0    94    0    0   1.209     40  0.51
  279  633 A   0   1   0   0   0   0   0   0   0   0   1   1   0   0   2   9   3  76   0   7    94    0    0   0.952     31  0.65
  280  634 A   0   0   1   2  74   1  16   0   0   0   5   0   0   0   0   0   0   0   0   0    94    0    0   0.847     28  0.78
  281  635 A   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  282  636 A   0   0   0   0   0   0   0   0   0   0  10  47   0   0   0   0   0   0  41   2    94    0    0   1.027     34  0.47
  283  637 A   0   0   0   0   1   0   0   0   1   0   3   0   0   1  50  44   0   0   0   0    94    0    0   0.963     32  0.63
  284  638 A   0   0   0   0   0   0   2   0   0   0   6   0   0   0  45  44   1   1   1   0    94    0    0   1.124     37  0.55
  285  639 A   0   0   0   0   0   0   0  91   1   0   0   0   7   0   0   0   0   0   0   0    94    0    0   0.323     10  0.85
  286  640 A   0   1   0   0   0   0   0   0   1   0   2   0   1   0   0   0   6  47   0  41    94    0    0   1.123     37  0.65
  287  641 A   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  288  642 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0  70  29   1   0   0   0    94    0    0   0.655     21  0.79
  289  643 A   0   0   0   0   0   0   0   0   0   0   0   0   0  84   4   0   0   0  12   0    94    0    0   0.532     17  0.76
  290  644 A   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  291  645 A   1   0   0   0   0   0   0   0   2   0  15  57   0  19   1   1   3   0   0   0    94    0    0   1.255     41  0.36
  292  646 A   0   0   0   0   0   0   0   9   0   0   2   0   0   0   2  68   0   0  19   0    94    0    0   0.952     31  0.57
  293  647 A   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  294  648 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   2  96   2   0   0   0    94    0    0   0.205      6  0.94
  295  649 A   0   0   0   5   2   0   0   0   0  77   0   0   0  15   1   0   0   0   0   0    94    0    0   0.774     25  0.58
  296  650 A   0   0   0   0   0  99   0   1   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.059      1  0.97
  297  651 A   0   0   0   0   0   0   0  62   2   7  28   0   0   0   0   0   0   0   1   0    94    0    0   0.977     32  0.61
  298  652 A   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  299  653 A   0  11   0  10  56   0  16   0   0   0   0   0   0   0   5   2   0   0   0   0    94    0    0   1.317     43  0.58
  300  654 A   0   0   0   0   0   0   0   0   0   0   1   0   0   1   0   0   0  49   3  46    94    0    0   0.914     30  0.75
  301  655 A  96   0   4   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.176      5  0.97
  302  656 A   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  303  657 A  59  15   4  13   0   0   0   0   0   0   1   2   0   4   0   2   0   0   0   0    94    0    0   1.341     44  0.54
  304  658 A   0   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0   0  91   0   7    94    0    0   0.323     10  0.92
  305  659 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0    93    0    0   0.000      0  1.00
  306  660 A   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  307  661 A   0   1   0   0   0   0   0  20   0   0   0   0   0   0   0   2   0  73   0   3    94    0    0   0.790     26  0.69
  308  662 A   0   0   0   1   1  98   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.118      3  0.96
  309  663 A   0   0   0   0   0   0   0   0   2  43  48   0   0   0   3   0   0   2   0   2    94    0    0   1.072     35  0.50
  310  664 A   4  20   0   0   0   0   0   0   1   3   0   0   1  19   4  11  32   3   0   1    94    0    0   1.876     62  0.22
  311  665 A   2   0   0   0   0   0   1   0   0   0   1   0   0   0   1   6   0  79   0  10    94    0    0   0.816     27  0.69
  312  666 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  18  46   0  36    94    0    0   1.035     34  0.72
  313  667 A   0   0   0   0   0   0   0   1  99   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.059      1  0.99
  314  668 A   1   0   0   0   0   0   0   3  52   0   2  16   0   7   1   3   0  14   0   0    94    0    0   1.498     50  0.38
  315  669 A   0   2   0   0   0   0   0  21   5   0  10   1   3   7   0   2  37   6   4   0    94    0    0   1.903     63  0.27
  316  670 A   0   1   1   0  98   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.118      3  0.98
  317  671 A   0   0   0   0   0   0   0   0  16   0  33  51   0   0   0   0   0   0   0   0    94    0    0   1.002     33  0.49
  318  672 A   0   0   0   0   0   0   0   0  13   0  28   0   0   3   0   0   0   0   1  55    94    0    0   1.104     36  0.46
  319  673 A   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  320  674 A   1  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.059      1  0.99
  321  675 A   1  67  17   3   0   0   1   0   0   0   1   3   0   0   1   4   0   1   0   0    94    0    0   1.165     38  0.58
  322  676 A   0   0   0   0   0   0   0   0   0  94   0   6   0   0   0   0   0   0   0   0    94    0    0   0.237      7  0.90
  323  677 A   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.000      0  1.00
  324  678 A   0  86   0  14   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   0.402     13  0.97
  325  679 A   0   0   0   0   0   0   0   0   1   0   0   0   0   1   0   0   1  88   0   9    94    0    0   0.465     15  0.89
  326  680 A   5  47   1  19   9   0  19   0   0   0   0   0   0   0   0   0   0   0   0   0    94    0    0   1.402     46  0.61
  327  681 A  32   5  35   5   0   0   1   0   1   0   0   0   0   0   0   0   4   0   4  12    94    0    0   1.661     55  0.36
  328  682 A   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   1   0   0   0    94    0    0   0.059      1  0.98
  329  683 A   2   0   0   0   0   0   0   1   0   0   1   1   0   0   1   0   1  74   9  10    94    0    0   0.977     32  0.66
  330  684 A   0   0   2   0   0   0   0   0   0   0   1   0   0   0  18  78   0   1   0   0    94    0    0   0.684     22  0.74
  331  685 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0    93    0    0   0.000      0  1.00
  332  686 A   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0    93    0    0   0.000      0  1.00
  333  687 A   0   0   0   0   0   0   0   0   0   0  39  60   0   0   0   0   0   0   0   1    93    0    0   0.722     24  0.58
  334  688 A   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0    93    0    0   0.000      0  1.00
  335  689 A   0   0   0   0   0   1   0  17  70   0   9   1   0   0   0   1   0   1   0   0    93    0    0   0.959     32  0.65
  336  690 A   0   4   0   0   0   0   0   1   1   0   0   0   0   0   0   0  15  59   0  19    93    0    0   1.146     38  0.66
  337  691 A   0   2   0   0   0   0   0   0   0   0   1   0  97   0   0   0   0   0   0   0    93    0    0   0.163      5  0.89
  338  692 A   2  98   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    93    0    0   0.104      3  0.97
  339  693 A   0   0   0   0   0   0   0   0   1   0   9   0   0   0  47   9  27   1   6   0    93    0    0   1.404     46  0.42
  340  694 A   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0    93    0    0   0.000      0  1.00
  341  695 A   0   0   0   0   0   0   0   0   4  94   1   0   0   0   0   1   0   0   0   0    93    0    0   0.295      9  0.90
  342  696 A   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0    92    0    0   0.000      0  1.00
  343  697 A   1  92   7   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    92    0    0   0.300     10  0.93
  344  698 A   0   0   0   0   0   0   0   0   5   0   6  11   0   0   0   1   1   3  71   1    79    0    0   1.076     35  0.54
  345  699 A   0   0   0   0   0   0   0   3   1  17  71   7   0   0   0   0   0   0   0   0    69    0    0   0.901     30  0.62
 AliNo  IPOS  JPOS   Len Sequence
     1   162   252    11 eAMEAAVQAEAPf
     2   151   161    25 rSRSVENTSSATNGPHWNPTLPTPSPp
     3   153   163    25 rSRSVENTSSATNGPHSNLTLPTLPPt
     4   152   163    25 rSRSVENTSSATNGPHSNLTLPTLPPt
     8    91   111     8 gVRILHHHLp
     +                   ATSESALSTQSGCSSGRDAf
    28    91   161     1 gIh
     +                   GEGLNGADEENQEEKDKVEEEVRa
     +                   Lf
    34   180   389     3 rLFMv
    34   207   419     2 pVPg
    34   219   433     1 rPp
     +                   t
     +                   n
    38    91   103     1 gAp
     +                   APf
     +                   KISANTLl
    53   250   732     2 rDEg
    61    91   164     8 gVRILHHHLp
     +                   EEDEAPSEPRSPSLSAf
    62   179   439     3 pDNPi
    70   251   561     2 rDEg
    71    11    73     1 nYv
    72    11    14     1 nYv
    73   137   142     1 kCk
    73   250   497     4 rDEEKn
    77    11    76     1 nYv
    78    11    42     1 nYv
     +                   RGISSDSDWRTSc
     +                   CKIQHFVAGm
    81   180   496     3 vPCDv
    82   180   484     3 sAEKi
    83   180   600     1 cNv
    85   180   622     3 eACNv
    86   180   600     1 cNv
    87   178   597     3 ePCDi
    88   180   729     1 sNv
    89    33   150     8 nHLFHSSLSs
    89   179   584     2 dDEv
    89   281   688    11 tRSVYFIAHFFSf
    90   178   745     3 rRDEl
    91    11    47     1 nGr
    91   171   459     1 pFp
    92   158   426     1 nAa
    92   180   779     3 dNSNv
    93     7   158     1 dSr
    93    58   210     3 qRVNd
    93   173   566     1 nLi