Complet list of 2jhr hssp fileClick here to see the 3D structure Complete list of 2jhr.hssp file
THRESHOLD  according to: t(L)=(290.15 * L ** -0.562) + 5
REFERENCE  Sander C., Schneider R. : Database of homology-derived protein structures. Proteins, 9:56-68 (1991).
CONTACT    Maintained at by Maarten L. Hekkelman 
DATE       file generated on 2014-05-21
HEADER     CONTRACTILE PROTEIN                     25-MAR-08   2JHR
DBREF      2JHR A    2   761  UNP    P08799   MYS2_DICDI       2    761
NCHAIN        1 chain(s) in 2JHR data set
NALIGN       98
NOTATION : ID: EMBL/SWISSPROT identifier of the aligned (homologous) protein
NOTATION : STRID: if the 3-D structure of the aligned protein is known, then STRID is the Protein Data Bank identifier as taken
NOTATION : from the database reference or DR-line of the EMBL/SWISSPROT entry
NOTATION : %IDE: percentage of residue identity of the alignment
NOTATION : %SIM (%WSIM):  (weighted) similarity of the alignment
NOTATION : IFIR/ILAS: first and last residue of the alignment in the test sequence
NOTATION : JFIR/JLAS: first and last residue of the alignment in the alignend protein
NOTATION : LALI: length of the alignment excluding insertions and deletions
NOTATION : NGAP: number of insertions and deletions in the alignment
NOTATION : LGAP: total length of all insertions and deletions
NOTATION : LSEQ2: length of the entire sequence of the aligned protein
NOTATION : ACCNUM: SwissProt accession number
NOTATION : PROTEIN: one-line description of aligned protein
NOTATION : SeqNo,PDBNo,AA,STRUCTURE,BP1,BP2,ACC: sequential and PDB residue numbers, amino acid (lower case = Cys), secondary
NOTATION : structure, bridge partners, solvent exposure as in DSSP (Kabsch and Sander, Biopolymers 22, 2577-2637(1983)
NOTATION : VAR: sequence variability on a scale of 0-100 as derived from the NALIGN alignments
NOTATION : pair of lower case characters (AvaK) in the alignend sequence bracket a point of insertion in this sequence
NOTATION : dots (....) in the alignend sequence indicate points of deletion in this sequence
NOTATION : SEQUENCE PROFILE: relative frequency of an amino acid type at each position. Asx and Glx are in their
NOTATION : acid/amide form in proportion to their database frequencies
NOTATION : NOCC: number of aligned sequences spanning this position (including the test sequence)
NOTATION : NDEL: number of sequences with a deletion in the test protein at this position
NOTATION : NINS: number of sequences with an insertion in the test protein at this position
NOTATION : ENTROPY: entropy measure of sequence variability at this position
NOTATION : RELENT: relative entropy, i.e.  entropy normalized to the range 0-100
NOTATION : WEIGHT: conservation weight

## PROTEINS : identifier and alignment statistics
    1 : B3RQ46_TRIAD        0.50  0.73   56  761   44  756  717    9   15  850  B3RQ46     Putative uncharacterized protein OS=Trichoplax adhaerens GN=TRIADDRAFT_20764 PE=4 SV=1
    2 : Q8BWI3_MOUSE        0.50  0.74   74  753   74  778  706    8   27  778  Q8BWI3     Putative uncharacterized protein (Fragment) OS=Mus musculus GN=Myh10 PE=2 SV=1
    3 : C7TZG8_SCHJA        0.49  0.74   66  763   60  769  712    9   16  831  C7TZG8     Myosin heavy chain (Fragment) OS=Schistosoma japonicum GN=Mhc PE=2 SV=1
    4 : F9X681_MYCGM        0.49  0.69   66  747    9  713  706    9   25  733  F9X681     Uncharacterized protein OS=Mycosphaerella graminicola (strain CBS 115943 / IPO323) GN=MYCGRDRAFT_99481 PE=4 SV=1
    5 : L5KRY3_PTEAL        0.49  0.71   44  661   43  685  646   11   31  720  L5KRY3     Myosin-11 OS=Pteropus alecto GN=PAL_GLEAN10009740 PE=4 SV=1
    6 : Q5RCE7_PONAB        0.49  0.72   43  763   42  788  750   13   32  947  Q5RCE7     Putative uncharacterized protein DKFZp468I092 (Fragment) OS=Pongo abelii GN=DKFZp468I092 PE=2 SV=1
    7 : Q6IP20_XENLA        0.49  0.71   66  761   64  783  722   10   28  808  Q6IP20     LOC432231 protein (Fragment) OS=Xenopus laevis GN=LOC432231 PE=2 SV=1
    8 : Q8BLI3_MOUSE        0.49  0.72   54  763   53  788  739   12   32  885  Q8BLI3     Putative uncharacterized protein (Fragment) OS=Mus musculus GN=Myh10 PE=2 SV=1
    9 : T1FXU2_HELRO        0.49  0.73   57  762   55  778  726   11   22  912  T1FXU2     Uncharacterized protein OS=Helobdella robusta GN=HELRODRAFT_64397 PE=4 SV=1
   10 : H2RW11_TAKRU        0.48  0.71   42  763   41  787  750   12   31  946  H2RW11     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=MYH9 (1 of 2) PE=4 SV=1
   11 : H3D3D9_TETNG        0.48  0.69   46  662   44  684  644   10   30  684  H3D3D9     Uncharacterized protein OS=Tetraodon nigroviridis PE=4 SV=1
   12 : I3N4Y8_SPETR        0.48  0.71   56  762   56  786  733    9   28  848  I3N4Y8     Uncharacterized protein OS=Spermophilus tridecemlineatus GN=MYH6 PE=4 SV=1
   13 : Q9I8N2_LITPI        0.48  0.70   44  762   45  791  749   11   32  847  Q9I8N2     Type tonic myosin heavy chain (Fragment) OS=Lithobates pipiens PE=2 SV=1
   14 : R0KJ42_ANAPL        0.48  0.70   53  703   55  722  671    8   23  722  R0KJ42     Myosin heavy chain, skeletal muscle, adult (Fragment) OS=Anas platyrhynchos GN=Anapl_18801 PE=4 SV=1
   15 : S4R727_PETMA        0.48  0.70    9  763   17  794  784   13   35 1046  S4R727     Uncharacterized protein OS=Petromyzon marinus PE=4 SV=1
   16 : A4IGA2_DANRE        0.47  0.71   56  762   56  784  731   10   26  950  A4IGA2     Smyhc1 protein (Fragment) OS=Danio rerio GN=smyhc1 PE=2 SV=1
   17 : B0FYX7_CTEID        0.47  0.72   60  762   60  781  724   10   23  834  B0FYX7     Fast skeletal myosin intermediate-type S1 (Fragment) OS=Ctenopharyngodon idella PE=2 SV=1
   18 : B1WB81_DANRE        0.47  0.71   56  762   56  784  731   10   26  942  B1WB81     Smyhc1 protein (Fragment) OS=Danio rerio GN=smyhc1 PE=2 SV=1
   19 : B2RYD3_RAT          0.47  0.70    9  763   11  795  791   14   42 1027  B2RYD3     Myh11 protein (Fragment) OS=Rattus norvegicus GN=Myh11 PE=2 SV=1
   20 : B4DRV3_HUMAN        0.47  0.72   85  762   37  739  706   11   31  839  B4DRV3     cDNA FLJ51537, highly similar to Myosin heavy chain, skeletal muscle, adult 2 (Fragment) OS=Homo sapiens PE=2 SV=1
   21 : B4E3S1_HUMAN        0.47  0.70    3  763    1  781  788   12   34  964  B4E3S1     cDNA FLJ57040, highly similar to Myosin-9 OS=Homo sapiens PE=2 SV=1
   22 : D0IQ99_DROME        0.47  0.69   42  680   87  755  675   11   42  755  D0IQ99     LD21871p (Fragment) OS=Drosophila melanogaster GN=zip-RB PE=2 SV=1
   23 : F1Q738_DANRE        0.47  0.71   56  762   56  784  731   10   26  939  F1Q738     Uncharacterized protein OS=Danio rerio GN=smyhc1 PE=4 SV=1
   24 : G1MUC5_MELGA        0.47  0.71   71  762   68  778  714   10   25  819  G1MUC5     Uncharacterized protein (Fragment) OS=Meleagris gallopavo GN=LOC100543889 PE=4 SV=2
   25 : G1TVQ7_RABIT        0.47  0.72   60  763   61  787  729    9   27  811  G1TVQ7     Uncharacterized protein OS=Oryctolagus cuniculus GN=MYH13 PE=4 SV=1
   26 : H2MD77_ORYLA        0.47  0.72   55  762   55  787  735   10   29  980  H2MD77     Uncharacterized protein OS=Oryzias latipes GN=LOC101164097 PE=4 SV=1
   27 : Q3UQQ3_MOUSE        0.47  0.71   56  769   56  791  738    9   26  995  Q3UQQ3     Putative uncharacterized protein (Fragment) OS=Mus musculus GN=Myh6 PE=2 SV=1
   28 : Q4AE63_CYPCA        0.47  0.70   61  692   61  711  653    8   23  711  Q4AE63     Myosin heavy chain (Fragment) OS=Cyprinus carpio GN=MYH PE=4 SV=1
   29 : Q4AE64_CYPCA        0.47  0.71   69  692   69  709  643    7   21  709  Q4AE64     Myosin heavy chain (Fragment) OS=Cyprinus carpio GN=MYH PE=4 SV=1
   30 : Q4S7R9_TETNG        0.47  0.68   46  662   44  691  651   11   37  691  Q4S7R9     Chromosome 18 SCAF14712, whole genome shotgun sequence. (Fragment) OS=Tetraodon nigroviridis GN=GSTENG00022662001 PE=4 SV=1
   31 : Q503C6_DANRE        0.47  0.71   75  720   75  742  670    9   26  749  Q503C6     Smyhc1 protein (Fragment) OS=Danio rerio GN=smyhc1 PE=2 SV=1
   32 : Q6PF49_XENLA        0.47  0.70    3  763    1  781  789   13   36  941  Q6PF49     LOC398719 protein (Fragment) OS=Xenopus laevis GN=LOC398719 PE=2 SV=1
   33 : Q8BLI1_MOUSE        0.47  0.70    9  763   11  788  784   13   35  998  Q8BLI1     Putative uncharacterized protein (Fragment) OS=Mus musculus GN=Myh10 PE=2 SV=1
   34 : Q8T9Z9_SCHMD        0.47  0.73   45  763   25  757  736   10   20  842  Q8T9Z9     Myosin heavy chain A (Fragment) OS=Schmidtea mediterranea PE=2 SV=1
   35 : Q9I8N3_LITPI        0.47  0.71   60  761   61  783  725    9   25  840  Q9I8N3     Type 3 myosin heavy chain (Fragment) OS=Lithobates pipiens PE=2 SV=1
   36 : R0JAT9_ANAPL        0.47  0.70   67  703    1  658  660    7   25  658  R0JAT9     Myosin-3 (Fragment) OS=Anas platyrhynchos GN=Anapl_18456 PE=4 SV=1
   37 : R0L4X0_ANAPL        0.47  0.70   53  743    2  715  716    9   27  715  R0L4X0     Myosin-3 (Fragment) OS=Anas platyrhynchos GN=Anapl_19101 PE=4 SV=1
   38 : U3IVM5_ANAPL        0.47  0.70   55  762   58  785  730    9   24  820  U3IVM5     Uncharacterized protein (Fragment) OS=Anas platyrhynchos PE=4 SV=1
   39 : U3J6C4_ANAPL        0.47  0.70   68  703    1  657  659    7   25  657  U3J6C4     Uncharacterized protein (Fragment) OS=Anas platyrhynchos GN=MYH13 PE=4 SV=1
   40 : U3J875_ANAPL        0.47  0.70   68  763   70  789  722    9   28  904  U3J875     Uncharacterized protein OS=Anas platyrhynchos PE=4 SV=1
   41 : V4B1B7_LOTGI        0.47  0.72   72  763   72  781  713    8   24  841  V4B1B7     Uncharacterized protein (Fragment) OS=Lottia gigantea GN=LOTGIDRAFT_135551 PE=4 SV=1
   42 : A1L219_DANRE        0.46  0.69    6  769    2  791  797   15   40 1046  A1L219     Myh9 protein (Fragment) OS=Danio rerio GN=myh9a PE=2 SV=1
   43 : A7Y224_DANRE        0.46  0.71   80  763   82  785  706    9   24  790  A7Y224     Fast myosin heavy chain x (Fragment) OS=Danio rerio GN=myhz1.3 PE=2 SV=1
   44 : B0FYX8_CTEID        0.46  0.71   62  763   62  783  724   10   24  835  B0FYX8     Fast skeletal myosin 30C-type S1 (Fragment) OS=Ctenopharyngodon idella PE=2 SV=1
   45 : B4E0I9_HUMAN        0.46  0.70   66  763   69  786  720    9   24  884  B4E0I9     cDNA FLJ61014, highly similar to Myosin-8 OS=Homo sapiens PE=2 SV=1
   46 : B6ICZ7_DANRE        0.46  0.69    7  763    3  785  789   13   38  950  B6ICZ7     Myh9 protein OS=Danio rerio GN=myh9a PE=2 SV=1
   47 : C3XTM8_BRAFL        0.46  0.69   51  762   22  756  743   11   39  887  C3XTM8     Putative uncharacterized protein (Fragment) OS=Branchiostoma floridae GN=BRAFLDRAFT_219666 PE=4 SV=1
   48 : C9QPB4_DROME        0.46  0.69   11  763   61  833  783   16   40  992  C9QPB4     IP15404p (Fragment) OS=Drosophila melanogaster GN=zip-RC PE=2 SV=1
   49 : D0ETJ3_HYPMO        0.46  0.71   60  762   60  780  724   11   24  833  D0ETJ3     Myosin high-temperature type S1 heavy chain (Fragment) OS=Hypophthalmichthys molitrix PE=2 SV=1
   50 : F1Q9D7_DANRE        0.46  0.69    6  769    2  791  797   15   40 1046  F1Q9D7     Uncharacterized protein OS=Danio rerio GN=myh9a PE=4 SV=1
   51 : F1Q9G9_DANRE        0.46  0.72   71  763   72  787  718    9   27  792  F1Q9G9     Uncharacterized protein (Fragment) OS=Danio rerio PE=4 SV=1
   52 : F1R174_DANRE        0.46  0.71   80  763   82  785  706    9   24  790  F1R174     Uncharacterized protein OS=Danio rerio GN=myhz1.3 PE=4 SV=1
   53 : F1R3Y6_DANRE        0.46  0.71   56  762   56  785  732   11   27  943  F1R3Y6     Uncharacterized protein OS=Danio rerio GN=smyhc1 PE=4 SV=1
   54 : F6KPD9_SINCH        0.46  0.71   60  763   61  786  728    9   26  930  F6KPD9     Fast skeletal muscle myosin heavy chain (Fragment) OS=Siniperca chuatsi PE=2 SV=1
   55 : F7DDS4_XENTR        0.46  0.72   84  762    2  701  702    9   25  720  F7DDS4     Uncharacterized protein (Fragment) OS=Xenopus tropicalis GN=myh1 PE=4 SV=1
   56 : F7I8N1_CALJA        0.46  0.71   55  762   58  785  730    9   24  868  F7I8N1     Uncharacterized protein OS=Callithrix jacchus GN=MYH4 PE=4 SV=1
   57 : H3G304_PRIPA        0.46  0.69   56  763   51  788  741   12   36  861  H3G304     Uncharacterized protein OS=Pristionchus pacificus PE=4 SV=1
   58 : Q07G78_XENTR        0.46  0.71   60  762   60  783  726    9   25  802  Q07G78     Novel myosin heavy chain family protein (Fragment) OS=Xenopus tropicalis GN=TTpA006f12.1-001 PE=2 SV=1
   59 : Q3UUB1_MOUSE        0.46  0.70   59  763   60  787  730    9   27  874  Q3UUB1     Putative uncharacterized protein (Fragment) OS=Mus musculus GN=Myh4 PE=2 SV=1
   60 : Q6AX95_XENLA        0.46  0.70    3  763    1  781  788   12   34  946  Q6AX95     Uncharacterized protein (Fragment) OS=Xenopus laevis PE=2 SV=1
   61 : Q6PA34_XENLA        0.46  0.70    3  763    1  781  789   13   36  941  Q6PA34     LOC398083 protein (Fragment) OS=Xenopus laevis GN=LOC398083 PE=2 SV=1
   62 : Q7ZW21_DANRE        0.46  0.69    6  769    2  791  797   15   40 1046  Q7ZW21     Myh9 protein (Fragment) OS=Danio rerio GN=myh9a PE=2 SV=1
   63 : Q8BLW0_MOUSE        0.46  0.70   56  762   57  789  735    9   30  859  Q8BLW0     Putative uncharacterized protein (Fragment) OS=Mus musculus GN=Myh1 PE=2 SV=1
   64 : Q9I8N4_LITPI        0.46  0.71   59  762   59  784  728    9   26  840  Q9I8N4     Type 2 myosin heavy chain (Fragment) OS=Lithobates pipiens PE=2 SV=1
   65 : T1EHS6_HELRO        0.46  0.71   56  762   54  777  728   14   25  842  T1EHS6     Uncharacterized protein OS=Helobdella robusta GN=HELRODRAFT_129847 PE=4 SV=1
   66 : W5LY49_LEPOC        0.46  0.69   67  762    1  688  721   10   58  737  W5LY49     Uncharacterized protein (Fragment) OS=Lepisosteus oculatus PE=4 SV=1
   67 : A5D6S9_DANRE        0.45  0.71   73  763   75  785  713    9   24  886  A5D6S9     Myhz2 protein (Fragment) OS=Danio rerio GN=myhz2 PE=2 SV=1
   68 : A9JT78_DANRE        0.45  0.70   56  763   57  785  732   12   27  941  A9JT78     Myhz1 protein (Fragment) OS=Danio rerio GN=myhz1 PE=2 SV=1
   69 : B0FYX6_CTEID        0.45  0.70   60  763   61  780  722   10   20  832  B0FYX6     Fast skeletal myosin 10C-type S1 (Fragment) OS=Ctenopharyngodon idella PE=2 SV=1
   70 : B1H1V0_XENLA        0.45  0.69    7  769    8  793  794   17   39 1047  B1H1V0     LOC495286 protein (Fragment) OS=Xenopus laevis GN=LOC495286 PE=2 SV=1
   71 : F6KPD8_SINCH        0.45  0.70   51  762   52  784  736   11   27  929  F6KPD8     Slow skeletal muscle myosin heavy chain (Fragment) OS=Siniperca chuatsi PE=2 SV=1
   72 : F7I9F4_CALJA        0.45  0.67    9  763   11  820  816   13   67  979  F7I9F4     Uncharacterized protein OS=Callithrix jacchus GN=MYH10 PE=4 SV=1
   73 : H2MCT1_ORYLA        0.45  0.71   58  763   59  783  727   10   23  893  H2MCT1     Uncharacterized protein OS=Oryzias latipes GN=LOC101170390 PE=4 SV=1
   74 : H2RW10_TAKRU        0.45  0.69    6  769    2  790  796   15   39 1045  H2RW10     Uncharacterized protein OS=Takifugu rubripes GN=MYH9 (1 of 2) PE=4 SV=1
   75 : Q5R9Z2_PONAB        0.45  0.67    9  763   11  819  815   13   66  978  Q5R9Z2     Putative uncharacterized protein DKFZp459G2125 (Fragment) OS=Pongo abelii GN=DKFZp459G2125 PE=2 SV=1
   76 : Q9I8N5_LITPI        0.45  0.71   58  762   58  785  730    9   27  841  Q9I8N5     Type 1 myosin heavy chain (Fragment) OS=Lithobates pipiens PE=2 SV=1
   77 : U6PJW7_HAECO        0.45  0.68   35  761   37  791  761   14   40  940  U6PJW7     Myosin and Myosin head domain containing protein OS=Haemonchus contortus GN=HCOI_01588700 PE=4 SV=1
   78 : V7CUS5_PHAVU        0.45  0.70   90  763   64  734  686   15   27  772  V7CUS5     Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_001G038200g PE=4 SV=1
   79 : D0ETJ2_HYPMO        0.44  0.70   59  763   60  782  725   11   22  834  D0ETJ2     Myosin low-temperature type S1 heavy chain (Fragment) OS=Hypophthalmichthys molitrix PE=2 SV=1
   80 : S8DPH9_9LAMI        0.44  0.69   89  731   65  706  653   14   21  713  S8DPH9     Uncharacterized protein (Fragment) OS=Genlisea aurea GN=M569_13097 PE=4 SV=1
   81 : M8A1A7_TRIUA        0.43  0.70   90  732   83  730  656   13   21  745  M8A1A7     Myosin-J heavy chain OS=Triticum urartu GN=TRIUR3_09297 PE=4 SV=1
   82 : B8AP64_ORYSI        0.42  0.66   96  737   86  723  656   17   32  751  B8AP64     Putative uncharacterized protein OS=Oryza sativa subsp. indica GN=OsI_14436 PE=4 SV=1
   83 : F8WLD7_CITUN        0.42  0.64   90  719   66  717  669   20   56  720  F8WLD7     Myosin XI OS=Citrus unshiu GN=ORF70 PE=4 SV=1
   84 : L5M0R5_MYODS        0.42  0.63   56  762   58  700  735   13  120  794  L5M0R5     Myosin-8 OS=Myotis davidii GN=MDA_GLEAN10018379 PE=4 SV=1
   85 : M7B0L2_CHEMY        0.42  0.64   66  742   66  716  715   13  102  733  M7B0L2     Myosin-7 OS=Chelonia mydas GN=UY3_12290 PE=4 SV=1
   86 : W5CFK2_WHEAT        0.42  0.70   88  756   65  732  679   15   21  761  W5CFK2     Uncharacterized protein OS=Triticum aestivum PE=4 SV=1
   87 : H2N0N1_ORYLA        0.41  0.64   58  763   59  710  729   14  100  883  H2N0N1     Uncharacterized protein OS=Oryzias latipes PE=4 SV=1
   88 : K7V8L8_MAIZE        0.41  0.68   88  743   65  716  669   17   30  734  K7V8L8     Uncharacterized protein OS=Zea mays GN=ZEAMMB73_244974 PE=4 SV=1
   89 : M1BVP8_SOLTU        0.41  0.65   34  769   12  742  750   18   33  849  M1BVP8     Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400020947 PE=4 SV=1
   90 : M5C3Z5_THACB        0.41  0.63   30  761   19  843  829   17  101  924  M5C3Z5     Rhizoctonia solani AG1-IB WGS project CAOJ00000000 data, isolate 7/3/14, contig 17478 OS=Thanatephorus cucumeris (strain AG1-IB / isolate 7/3/14) GN=BN14_07861 PE=4 SV=1
   91 : E1ZW01_CAMFO        0.40  0.60   76  769  126  992  869   16  177 1076  E1ZW01     Myosin heavy chain, muscle OS=Camponotus floridanus GN=EAG_05444 PE=4 SV=1
   92 : S8DTV5_9LAMI        0.40  0.65   34  769   14  749  751   17   30  920  S8DTV5     Uncharacterized protein (Fragment) OS=Genlisea aurea GN=M569_11538 PE=4 SV=1
   93 : H3E5X0_PRIPA        0.39  0.59   46  769   73  932  863   17  142  993  H3E5X0     Uncharacterized protein OS=Pristionchus pacificus GN=WBGene00094651 PE=4 SV=1
   94 : Q94GQ9_ORYSJ        0.39  0.64   35  769   14  742  749   20   34  833  Q94GQ9     Putative myosin heavy chain, 3'-partial (Fragment) OS=Oryza sativa subsp. japonica GN=OJ1124_H03.1 PE=4 SV=1
   95 : H2MC42_ORYLA        0.37  0.59   12  761    6  764  787   20   65  804  H2MC42     Uncharacterized protein OS=Oryzias latipes GN=LOC101168277 PE=4 SV=1
   96 : H9JXG0_BOMMO        0.33  0.50   80  769  130 1114  987   20  299 1175  H9JXG0     Uncharacterized protein OS=Bombyx mori PE=4 SV=1
   97 : L9L3F5_TUPCH        0.32  0.51   32  769   33  981  955   17  223 1637  L9L3F5     Myosin-7B OS=Tupaia chinensis GN=TREES_T100008641 PE=4 SV=1
   98 : N6TY03_DENPD        0.32  0.47   84  742  133 1169 1042   17  388 2474  N6TY03     Uncharacterized protein (Fragment) OS=Dendroctonus ponderosae GN=YQE_12088 PE=4 SV=1
## ALIGNMENTS    1 -   70
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....1....:....2....:....3....:....4....:....5....:....6....:....7
     1    2 A N    >>        0   0  124    1    0                                                                        
     2    3 A P  T 34  +     0   0   57    1    0                                                                        
     3    4 A I  T 34 S+     0   0   13    5   50                      M          M                           MM         
     4    5 A H  T <4 S+     0   0  148    5   90                      A          A                           AA         
     5    6 A D    ><  -     0   0   72    5   45                      Q          Q                           QQ         
     6    7 A R  T 3  S+     0   0  195    9   83                      Q          K         S       S         TTS        
     7    8 A T  T 3  S+     0   0  114   11   58                      A          D         D   D   D         DDD       E
     8    9 A S  S <> S-     0   0   18   11   67                      A          A         A   A   A         VVA       D
     9   10 A D  H  > S+     0   0   97   16   18                D   E D          DE        E   E   E         DDE       E
    10   11 A Y  H  >>S+     0   0    1   16   61                K   K K          KR        K   K   K         KKK       K
    11   12 A H  H  >5S+     0   0   42   17   30                Y   F Y          YY        F   F Y F         YYF       F
    12   13 A K  H  <5S+     0   0  144   18   27                L   L L          LL        L   L L L         LLL       L
    13   14 A Y  H  <5S+     0   0   67   18   19                Y   F Y          YF        Y   Y S Y         YYY       F
    14   15 A L  H  <5S+     0   0    8   18   58                V   V V          VV        A   A V A         VVA       L
    15   16 A K  S  <  -     0   0   85   18   67                S   N N          NY        N   N N N         NNN       N
    21   22 A S  H  > S+     0   0   83   18   71                I   S N          NN        D   D D D         NND       N
    22   23 A D  H  > S+     0   0  107   18   21                P   P P          PP        P   P P P         PPP       P
    23   24 A L  H  > S+     0   0   72   18   69                A   M L          LA        L   L A L         LLL       L
    24   25 A F  H  X S+     0   0  124   18   53                A   A A          AT        A   A T A         AAA       A
    25   26 A K  H  < S+     0   0  150   18   30                Q   Q Q          QQ        Q   Q Q Q         QQQ       Q
    26   27 A L  H >< S+     0   0  107   18   45                A   A A          AA        A   A A A         AAA       A
    27   28 A T  H 3< S+     0   0   55   18   31                D   D D          DD        D   D E D         DDD       D
    28   29 A V  T 3< S+     0   0   84   18   35                W   W W          WW        W   W W W         WWW       W
    29   30 A S    <   -     0   0   55   18   69                S   V A          AT        A   A T A         AAA       T
    30   31 A D        +     0   0  162   19   68                A   A A          AA        T   T Q T         AAT       A
    31   32 A K        -     0   0  105   19   27                R   K K          KK        K   K K K         KKK       K
    32   33 A R        -     0   0  100   20   30                R   K K          KK        K   K R K         KKK       K
    33   34 A Y  E     -A   50   0A  70   20   44                L   L L          LL        L   L L L         LLL       L
    34   35 A I  E     -AB  49  78A   5   22    3                V   V V          VV        V   V V V         VVV       V
    35   36 A W  E     +A   48   0A  10   24   12                W   W W          WW        W   W W W         WWW       W
    36   37 A Y  E     -A   47   0A  11   23   51                V   V V          .I        V   V V V         VVV       I
    37   38 A N        -     0   0   35   23   61                P   P P          .P        P   P P P         PPP       P
    38   39 A P  S    S+     0   0   50   23   67                S   S S          .S        S   S H S         SSS       S
    39   40 A D    >   -     0   0   83   24   55                E   E D          VE        E   E E E         EEE       E
    40   41 A P  T 3  S+     0   0  106   24   69                K   K K          PR        K   K N K         KKK       K
    41   42 A K  T 3  S+     0   0  177   24   86                H   Q S          SH        L   L Q L         NNL       N
    42   43 A E    X   +     0   0  116   26   42           E    G   G GE         EG        G   G G G         GGG       G
    43   44 A R  T 3  S+     0   0  102   10   64       K   R    .   . FN         K.        .   F . .         F..       .
    44   45 A D  T 3  S+     0   0    3   12   71      QQ   L  E .   . EQ         N.        .   E . .         E..       .
    45   46 A S    <   -     0   0   61   15   84      GG   G  A .   . PG         G.G       .   A . .         A..       .
    46   47 A Y        -     0   0   29   31   55      FF   FF Y F   F AF       F FFY       F   . F F         AFF       F
    47   48 A E  E     -A   36   0A  80   31   59      EE   EE I E   E SV       E EEI       E   . V E         SEE       E
    48   49 A C  E     -A   35   0A  34   32   51      AA   AA E A   A LA       A AAA       A   . A A         IAA       A
    49   50 A G  E     -A   34   0A   2   33   66      AA   GA V A   A KA       A AAI       G   G A G         KAG       A
    50   51 A E  E     -AC  33  62A  61   33   70      SS   SS E S   S ES       S SST       S   S S S         ESS       S
    51   52 A I  E     + C   0  61A  15   35   44      II   VI I I   I EI       I IIV       I   III I         EII       I
    52   53 A V  E     -     0   0A  74   35   65      KK   KK K K   K VK       K KKE       K   KRK K         VKK       K
    53   54 A S  E     - C   0  60A  62   37   66      EE   EE DSE   E GR       E EEE  S    E   EAR E         GEE       E
    54   55 A E  E     - C   0  59A  99   38   68      EE E EE SRE   E EE       E EET  R    E   ETE E         DEE       E
    55   56 A T  E >   - C   0  58A  66   41   77      KK R RH SER   K EH   D   H VRN  EE   T   TKH T     E   EVT       K
    56   57 A S  T 3  S+     0   0  112   52   23  G   GG G GGGGSGG GG AGG  GG  G GGG  SS   G   GGG G  G  GG  AGGG G  G G
    57   58 A D  T 3  S+     0   0   85   53   36  E   DD DDDDGGGDD DD IDD  DG  D DDD  GG   D   DDD D  D  GD  IDDG E  G D
    58   59 A S  E <   -CD  55  72A   7   56   68  T   EE EDEEKQKEK KE VEK  KK  E EEK  KK   E   EME E  K  KV  VEEK E  K E
    59   60 A F  E     -CD  54  71A   8   60   42  L   VV VVCVVVVVV VV EVV  VV  V AVV  VV   C   CVV C  V  VL VEACVVV  V V
    60   61 A T  E     +CD  53  70A  18   67   70  S   IV MTVLTTTLTTTV LET TTT  L IMTT TT   L   LTETL  TT TTTTLILTTT  TTL
    61   62 A F  E     -CD  51  69A   7   68   24  V   VV VVVVAVVVVVVV VVV VAAV V VVVV VV   V   VVVVV  VV VVVAAVVAVV  VVV
    62   63 A K  E     -CD  50  68A  91   69   63  E   EE ELEEEEQEDKDE EED KEEK E EEKK KQ   E K EEEKE  DE KVKKEEEKKT  IVE
    63   64 A T        -     0   0    9   69   70  V   LL LTLLTTTLTTTL NLT TTTT L LLTT ST   L T LTLTL  TT TTTTNLLTKT  TLL
    64   65 A V  S    S+     0   0   93   69   79  N   VV AETAEKEAEHEV GAE LEEH A AADE EE   A H AVAHA  ED ETDEGAAEAE  LLQ
    65   66 A D  S    S-     0   0  124   69   71  T   EE EKDDNDAEYSYE KEY DFNS D EEKG AA   D S DTESD  YT GKDGKEDGDS  DDE
    66   67 A G  S    S+     0   0   30   74   59  G GGnnGnKsnGKGnGGGn KtG DGGG n nnGG GG   s GGsKtGs  GG GGGGKnsGNM  ttn
    67   68 A Q        -     0   0  131   70   50  Q SSkkKkEkkKREkKKKk .kK RKKK k kkEQQEE   k KAkKkKk  KK A.NA.kkTT.Q eek
   201  202 A R        -     0   0   97   99   81  TSASSsIsassILSsvmvsTssvSTaImAsVssAVSSSSSMsQmTslsmsMQvILTsLTsssTIAVQQSs
   202  203 A N  S    S-     0   0  164   99   39  gHtdhgggdtggggggggggspggggggggssgsgggggggtgggtgggtsgggggsggsstggsggggg
   203  204 A Q  S    S+     0   0  119   93   57  sKkskkkkkrkkkkkkakqekikkkkkpakkkkdkkkkkkedkakdkpadqkkakkkkekkdekekkkkk
   204  205 A A    >>> -     0   0   68   99   47  EgesddndqdDdseddedgeDsdeedeeeDdDddeeeeeeeqeedqAheqeedeedaeeDDqededeeed
   205  206 A N  T 345S+     0   0  130   81   77  .nsrssknglSatkgekefk.tekkeakkSe.nkkkkkkkelkkkl.vklkkekskksk..lkkaakkkt
   299  300 A G    >>  -     0   0   20   62   66  GGTk..T.E..NTT.NTN.T..NTTNNTT.N..ATTTTTTP.TTT.N.T.TTNTTTRTT...TTMNTTT.
   363  364 A G  S    S-     0   0   43   95   69  rnrdnnrnrhqrrrnrrrnrnnrrrrrrrqrnnrrrrrrr.srrrs.nrsrrrrrrrrrnnsrrrrrrrn
   364  365 A E  S    S+     0   0  146   98   45  edeaddededEeeedeeededDeeeeeeeEeddeeeeeeeEDeeeDEDeDeeeeeeeeeddDeeeeeeed
   442  443 A Q        +     0   0  142   99   70  trtrkktrtkktttrtttktkrtttttttktkrttttttttktttkTrtkttttttAttkkktttttttk
   443  444 A E  S    S-     0   0  136   94   67  frvshhlrhrrqlqrqqqhqrrqqqqqqnrqrrvqqqqqqarqqqr.rqrqqqqqqQqqrrrqqtqqqqr
   519  520 A R  T   5 +     0   0  180   99   21  KpPPppPpPppPPPpPPPpPpPPPPPPPPpPppPPPPPPPPpPPPpPPPpPPPPPPPPPpppPPPPPPPp
   520  521 A Q  T   5S+     0   0  168   29   48
   521  522 A P  T   5S-     0   0   97   33   58  .P.PPP.P.PP...P...P.P........P.PP........P...P.G.P.........PPP.......P
   549  550 A H  H  < S+     0   0   59   99   66  nEnLeenenetnnqenqneqeanqqnnqqtneenqqqqqqneqqqenAqeqqnqqqqqqeeeqqnnqqqe
   550  551 A F  H >X S+     0   0   20   99   81  sQsWhhshshhssshncnhshhnsssscchnhhssssssssnccsnshcnccntcshcshhnssssccsh
   552  553 A K  T 34 S+     0   0  206   82   82  .hf..Kl.fK.NfNKTATKNK.TNNNNAA.TKKfNNNNNNNKAANKIKAKAATANNNNNKKKNNf.A.A.
   562  563 A F  S    S+     0   0  146   74   63  KKHLK.KKR.KKRK.RKR.K.RRKKKKKKKR..QKKKKKKK.KKK.k.K.KKRKKKqKK...KKK.EKK.
   563  564 A S        -     0   0   23   74   80  NDSLD.YDF.DQYA.PAP.A.GPAAPQAADP..HAAAAAVG.AAA.Y.A.AAPAAAAAA...VAY.AAA.
   616  617 A I  H <4 S+     0   0   14   99   81  Prgerrsrdhrasgrgagrtriggggsaergrrdagggggpreasrgiaraegaastaarrraadgeeer
   617  618 A A  H  < S+     0   0   15   90   73  Esptssessgskkksgggskgfgkkgkkksggsskkkkkkpgkgkgkfggkkgkgkggkgggkgggkkks
   710  711 A N  S    S+     0   0  148   90   64  gnnN nsnnn an nsssnsn ssssa   snnns ss snnsssnqnsnssssssDssnnnssnsssgg
   711  712 A V        -     0   0   22   86   26  iiiM iiiii ii ininiii niiii   niiii ii iiiiiiiviiiiiniiiEiiiiiiiiiiiii
   712  713 A P        -     0   0   66   88   41  pPPP PpPPP pp PpppPpP ppppp   pPPPp pp pPPpppPAPpPppppppAppPPPppPppppP
   713  714 A R  S    S+     0   0  120   84   71  gKDK KdKPK gd KgggKgK ggggg   gKKQg gg gDKgggKGKgKggggggKggKKKggAggggK
   760  761 A R    <>  +     0   0   43   78   47  K K  KRKRK RR KRKRKKK RKKRR    KKKR  K KRKKKKKIKKKKKRKKKAKKKKKKKTRKKKK
   761  762 A L  T  4  +     0   0  128   78   26  L L  ILILI LL ILLLILI LLLLL    IILL  L LLILLLILILILLLLLLLLLIIILLLLLLLI
   762  763 A E  T  4 S-     0   0  155   72   61    N  T TST SA TAAATAT AAVAS    TTS   A ASTAAATSSATAAAAAATAATTTAASSAAAT
   763  764 A S  T  4 S+     0   0   48   48   67    G  D D D    D   D D   T R    DDS     QSDSEQD D DTS A  E QDDD    TSTD
   764  765 A N  S  < S-     0   0   72   14   63                            I              V       V           V       I
   765  766 A E  S    S+     0   0  152   14   72                            I              I       I           I       I
   766  767 A P        +     0   0   59   14   90                            T              I       I           I       I
   767  768 A P        +     0   0   72   14   98                            R              N       N           N       S
   768  769 A M  S    S+     0   0  137   14   39                            I              F       F           F       F
   769  770 A D  S    S+     0   0   87   14    8                            Q              Q       Q           Q       Q
   770  771 A F  S    S+     0   0  173    1    0                                                                        
   771  772 A D  S    S+     0   0  134    1    0                                                                        
   772  773 A D  S    S-     0   0   53    1    0                                                                        
   773  774 A D  S    S+     0   0  142    1    0                                                                        
   774  775 A I        +     0   0  121    1    0                                                                        
   775  776 A P              0   0   60    1    0                                                                        
   776  777 A F              0   0  243    1    0                                                                        
## ALIGNMENTS   71 -   98
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....8....:....9....:....0....:....1....:....2....:....3....:....4
     1    2 A N    >>        0   0  124    1    0                              
     2    3 A P  T 34  +     0   0   57    1    0                              
     3    4 A I  T 34 S+     0   0   13    5   50                              
     4    5 A H  T <4 S+     0   0  148    5   90                              
     5    6 A D    ><  -     0   0   72    5   45                              
     6    7 A R  T 3  S+     0   0  195    9   83     S                        
     7    8 A T  T 3  S+     0   0  114   11   58     T                        
     8    9 A S  S <> S-     0   0   18   11   67     A                        
     9   10 A D  H  > S+     0   0   97   16   18   E EE                       
    10   11 A Y  H  >>S+     0   0    1   16   61   R RR                       
    11   12 A H  H  >5S+     0   0   42   17   30   Y FY                       
    12   13 A K  H  <5S+     0   0  144   18   27   L LL                   L   
    13   14 A Y  H  <5S+     0   0   67   18   19   F YF                   Y   
    14   15 A L  H  <5S+     0   0    8   18   58   V VV                   T   
    15   16 A K  S  <  -     0   0   85   18   67   Y NY                   W   
    21   22 A S  H  > S+     0   0   83   18   71   N NN                   I   
    22   23 A D  H  > S+     0   0  107   18   21   P PP                   P   
    23   24 A L  H  > S+     0   0   72   18   69   A LA                   D   
    24   25 A F  H  X S+     0   0  124   18   53   T AT                   A   
    25   26 A K  H  < S+     0   0  150   18   30   Q QQ                   E   
    26   27 A L  H >< S+     0   0  107   18   45   A AA                   E   
    27   28 A T  H 3< S+     0   0   55   18   31   D DD                   E   
    28   29 A V  T 3< S+     0   0   84   18   35   W WW                   W   
    29   30 A S    <   -     0   0   55   18   69   T AT                   K   
    30   31 A D        +     0   0  162   19   68   A TA              E    S   
    31   32 A K        -     0   0  105   19   27   K KK              K    A   
    32   33 A R        -     0   0  100   20   30   K KK              K    E K 
    33   34 A Y  E     -A   50   0A  70   20   44   L LL              W    L R 
    34   35 A I  E     -AB  49  78A   5   22    3   V VV             VV V  V V 
    35   36 A W  E     +A   48   0A  10   24   12   W WW W           WW W WK W 
    36   37 A Y  E     -A   47   0A  11   23   51   I VI V           VV T AD V 
    37   38 A N        -     0   0   35   23   61   P PP P           EP E EY P 
    38   39 A P  S    S+     0   0   50   23   67   S SS D           DD D DK D 
    39   40 A D    >   -     0   0   83   24   55   E EE A           PE P PN E 
    40   41 A P  T 3  S+     0   0  106   24   69   R RR E           KD E DG Q 
    41   42 A K  T 3  S+     0   0  177   24   86   H LH D           LE V DE D 
    42   43 A E    X   +     0   0  116   26   42   G GG G           Ag S AA A 
    43   44 A R  T 3  S+     0   0  102   10   64   . .. .           Ww . .. . 
    44   45 A D  T 3  S+     0   0    3   12   71   . .. .           KV . .. . 
    45   46 A S    <   -     0   0   61   15   84   . .. .           DV W .. Y 
    46   47 A Y        -     0   0   29   31   55   F FF F           GK TFW. V 
    47   48 A E  E     -A   36   0A  80   31   59   E EE V           EE DVI. E 
    48   49 A C  E     -A   35   0A  34   32   51   A AA A           VN GADS A 
    49   50 A G  E     -A   34   0A   2   33   66   A GA A           IT VAGL E 
    50   51 A E  E     -AC  33  62A  61   33   70   S SS E           KN VEEQ V 
    51   52 A I  E     + C   0  61A  15   35   44  LI VI I           ID QIVL K 
    52   53 A V  E     -     0   0A  74   35   65  TK KK Q           HR KTVM S 
    53   54 A S  E     - C   0  60A  62   37   66  KE EE S           GG IAEL E 
    54   55 A E  E     - C   0  59A  99   38   68  RE EE V           QV KTIE A 
    55   56 A T  E >   - C   0  58A  66   41   77  ER RR Q           DE GKRD T 
    56   57 A S  T 3  S+     0   0  112   52   23  GG GG G      S    .E RGGG G 
    57   58 A D  T 3  S+     0   0   85   53   36  GD DD D      G    .G DDGK G 
    58   59 A S  E <   -CD  55  72A   7   56   68  KEKEEKQ      K  K .E EQDV R 
    59   60 A F  E     -CD  54  71A   8   60   42  VVVCVVV V    V  A LI VVAI V 
    60   61 A T  E     +CD  53  70A  18   67   70  TMTVMTT T    T  T HV KTTE T 
    61   62 A F  E     -CD  51  69A   7   68   24  VVVVVVV V    V  V VM VVIH V 
    62   63 A K  E     -CD  50  68A  91   69   63  EEKEEKV V    K  E KA QVVK E 
    63   64 A T        -     0   0    9   69   70  TLLLLKT L    T  T TA TTSL T 
    64   65 A V  S    S+     0   0   93   69   79  LALTAEA L    E  E SG SSTD K 
    65   66 A D  S    S-     0   0  124   69   71  CEDDEDK D    A  G DG DRDP D 
    66   67 A G  S    S+     0   0   30   74   59  GnssnNG t    GG G GE GGGK Q 
    67   68 A Q        -     0   0  131   70   50  KkekkTN e    AQ K K. KNK. K 
    68   69 A D  E     +D   62   0A  57   75   70  TKEKKSS E    TT T EI KET. V 
    69   70 A R  E     -D   61   0A  87   78   63  LARVAAV R    LV V VR VII. L 
    70   71 A Q  E     -D   60   0A 141   78   58  TMTRMTT V    TT T VT TTV. T 
    71   72 A V  E     -D   59   0A  34   80   27  VVVVVVV A    VV V AM VVA. V 
    72   73 A K  E >   -D   58   0A 137   82   58  KNKNNKK K    KK K KP SKST R 
    73   74 A K  G >  S+     0   0   63   83   66  EKEKKEK E    DE E IL TKLK E 
    74   75 A D  G 3  S+     0   0  141   84   35  DDDDDDD E    DD D AY SDAN A 
    75   76 A D  G <  S+     0   0  121   85   47  EDEDDEE D    QQ D KS KESL E 
    76   77 A A    <   -     0   0   17   86   34  IIVIIIA V    VI I VLLLAIP L 
    77   78 A N        -     0   0   47   86   87  FQSQQFQ Y    YM H FSQYQYY Q 
    78   79 A Q  B     -B   34   0A  29   86   71  PKPKKPE P    PQ P PKQPEPL P 
    79   80 A R        -     0   0   45   86   41  MMMMMMM M    MQ R KMVKMKR M 
    80   81 A N        -     0   0    6   89    5  NNNNNNN N    NN N DNNDNDNNN 
    81   82 A P    >   -     0   0   57   89    9  PPPPPPP P    PP P TPPEPTPPP 
    82   83 A I  T 3  S+     0   0   42   89   20  PPPPPPP P    PP P EPPDPEDPP 
    83   84 A K  T 3  S+     0   0  157   89   15  KKKKKKK K    KK K TKKVKAIKR 
    84   85 A F  S X  S+     0   0   31   91   19  YFFFFYF Y    YF F PFYPYPLYFY
    85   86 A D  T 3  S+     0   0   42   92   62  DSDSSDD D    DD D PDEADPVEDE
    86   87 A G  T 3  S+     0   0    5   92   32  KKKKKKK K    KK K gRKdKaGKLK
    87   88 A V    <   -     0   0   21   92   39  IVIVVIT I    II M vVAvTvECLA
    88   89 A E  S    S+     0   0   44   94    9  EEEEEEE E    EEDEDDEEDEDNEEE
    89   90 A D  B >   -e  117   0B  25   95    0  DDDDDDD DD   DDDDDDDDDDDDDDD
    90   91 A M  G >  S+     0   0    0   98    1  MMMMMMMMMMM MMMMMMMIMMMMLMMM
    91   92 A S  G 3  S+     0   0   25   98   32  AAAAAAATATT TAATATTASTATTSSS
    92   93 A E  G <  S+     0   0  125   98   84  MEMEEMNRMKR KMMRMRKDNKNKANMN
    93   94 A L    <   -     0   0    2   98   10  MLMLLMLLMLL LMLLMLLLLLLLLLML
    94   95 A S  S    S+     0   0   56   98   25  TTTTTTTATSS TTTSTSSTTSTASTTT
    95   96 A Y  S    S-     0   0   68   98   67  HCHCCHFYHYY YHFYHYYFYYFYYYHY
    96   97 A L        +     0   0   18   99    0  LLLLLLLLLLLLLLLLLLLLLLLLLLLL
    97   98 A N     >  -     0   0   19   99   34  SNNNNNNNNHHHNHHHNHHNNHNHHNNN
    98   99 A E  H  > S+     0   0   42   99    4  EEEEEEEEEEEEEEEEEEEEDEEEEDED
    99  100 A P  H  > S+     0   0    2   99   38  PAAAAPAPAPPPPPPPPPPAAPAPPAAA
   100  101 A A  H  > S+     0   0    5   99   43  SSSSSSSGSGGGGAAGSGGSSGSGASAS
   101  102 A V  H  X S+     0   0    0   99    0  VVVVVVVVVVVVVVVVVVVVVVVVVVVV
   102  103 A F  H  X S+     0   0    8   99    3  LLLLLLLLLLLLLLLLLLLVLLLLLLLL
   103  104 A H  H  X S+     0   0   20   99   71  YHYHHFAFYEDQYYYDFDQHHHAHHYHH
   104  105 A N  H  X S+     0   0    2   99    0  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
   105  106 A L  H  X S+     0   0    7   99    2  LLLLLLLLLLLLLLLLLLLLLLLLLLLL
   106  107 A R  H  X S+     0   0   78   99   37  KKKKKKKRKKAKEKKAKAARKAKAKKRK
   107  108 A V  H  X S+     0   0   34   99   55  EDEEDEDRETVSREEVEVTLQTECVQQQ
   108  109 A R  H ><>S+     0   0    4   99    0  RRRRRRRRRRRRRRRRRRRRRRRRRRRR
   109  110 A Y  H ><5S+     0   0   11   99    0  YYYYYYYYYYYYYYYYYYYYYYYYFYYY
   110  111 A N  H 3<5S+     0   0  112   99   83  AYAYYAKEAEAAAAAAAAEGYQSGIYAY
   111  112 A Q  T <<5S-     0   0   69   99   73  ASASSADLALKLLAAKSKLSALAIDHRA
   112  113 A D  T < 5S+     0   0   63   99  107  WGWGGWMNWNNNNWWNWNNGQNMNsKWK
   113  114 A L      < +     0   0    8   99   35  MLMLLMMDMEIEDMMIMIEALLMElLML
   114  115 A I        +     0   0   11   99    0  IIIIIIIIIIIIIIIIIIIIIIIIIIII
   115  116 A Y  E     + F   0 124B   5   99    0  YYYYYYYYYYYYYYYYYYYYYYYYYYYY
   116  117 A T  E     - F   0 123B   1   99    0  TTTTTTTTTTTTTTTTTTTTTTTTTTTT
   117  118 A Y  E     -eF  89 122B   7   99    0  YYYYYYYYYYYYYYYYYYYYYYYYYYYY
   118  119 A S        -     0   0    0   99   24  SSSSSSSTPTTTTSSTSTTSSTSTCSSS
   119  120 A G  S    S-     0   0    3   98    0  GGGGGGGGGGGGGGGGGGGGGGGGGGGG
   120  121 A L  S    S+     0   0  104   99   36  LLLLLLLSLNNNSLLNLNNLLSLNILLL
   121  122 A F  S    S-     0   0    3   99   18  FFFFFFFIFIIIIFFIFIIFFIFIVFFF
   122  123 A L  E     -Fg 117 652B   0   99   54  CCCCCCCLCLLLLCCLCLLLCLCLLCCC
   123  124 A V  E     -Fg 116 653B   1   99   23  VVAVVAVIAIIIIVVIVIIVVIVIVVVV
   124  125 A A  E     -Fg 115 654B   4   99   63  TVTVVTVATAAAATTAVAAAASVAAATA
   125  126 A V  E     - g   0 655B   4   99   14  VIVIIVIVVIIVVVVIVIVIIIIVIIII
   126  127 A N        -     0   0   26   99    3  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
   127  128 A P        -     0   0   29   99    0  PPPPPPPPPPPPPPPPPPPPPPPPPPPP
   128  129 A F  S    S+     0   0   47   99    1  YYYYYYYFYFFFFYYFYFFYYFYFYYYY
   129  130 A K  S    S-     0   0   89   99   31  KKKKKKKTKQQQTKKQKQQTKRKREKKK
   130  131 A R        -     0   0  236   99   63  WNWNNWRKMKRRKWWRWRRNRRRRNRWR
   131  132 A I        -     0   0   20   99    4  LLLLLLLLLLLLLLLLLLLLFLLLLFLY
   132  133 A P  S    S+     0   0   63   99    1  PPPPPPPpPppppPPpPppSPpPpPPPP
   133  134 A I        +     0   0    5   99   24  VIVIIVIlVilllVVlVllLVlIlIVVV
   134  135 A Y        +     0   0   55   99    9  YYYYYYYYYYVYYYYVYVYYYYYYYYYY
   135  136 A T  S  > S-     0   0   48   99   65  DSDSSNTDDDDNNNNDDDDTTDSDGTTT
   136  137 A Q  H  > S+     0   0   77   99   76  SESEEPESAHVNVAAVAATDHAEVTTAN
   137  138 A E  H  > S+     0   0  124   99   71  VNEENESHEHQHHEEQQLHARHSHDRPR
   138  139 A M  H  > S+     0   0    7   99   39  VIVIIVVMVMTMMVVTCTMICIVMICVC
   139  140 A V  H  X S+     0   0    0   99   33  VIVVIVIMVMMMMVVMVMMVAMIMIAVA
   140  141 A D  H  < S+     0   0   95   99   74  SESEEAKDTQEGEAGESEEQKEKENKAK
   141  142 A I  H  < S+     0   0   23   99   83  AMAMMGFEAQKIQAAKGKQQLQHQALAL
   142  143 A F  H >< S+     0   0    1   99    0  YYYYYYYYYYYYYYYYYYYYYYYYYYYY
   143  144 A K  T 3< S-     0   0  119   99   34  RRRKRRMKRKKKKRRKRKKRRKMKSRKR
   144  145 A G  T 3  S+     0   0   42   99    1  GGGGGGGGGGGGGGGGGGGGGGGGGGGG
   145  146 A R    <   -     0   0   65   99   38  KKKKKKKIKAAAAKKAKAAKKAKAQKKK
   146  147 A R     >  -     0   0   83   99   41  KKKKKKRPKSNEPKKNKNARRARANRRR
   147  148 A R  T  4 S+     0   0   59   99   39  RRRRRRRLRFLFFRRLRLFRRFRFMRRR
   148  149 A N  T  4 S+     0   0   94   99   87  VHMHHQNGMGGGGQSGIGGDNGNGGSSN
   149  150 A E  T  4 S+     0   0   75   99    8  EEEEEEEEEEDEEEEDEDEDEKEEDEEE
   150  151 A V  S  < S-     0   0    4   99   69  AMAMMAMLALLLLAALALLNVLMLMVAV
   151  152 A A        -     0   0    0   99   29  PPPPPPPSPSDGSPPDPDSAPSPSDPPP
   152  153 A P        +     0   0    2   99    0  PPPPPPPPPPPPPPPPPPPPPPPPPPPP
   153  154 A H    >>  -     0   0    0   99    0  HHHHHHHHHHHHHHHHHHHHHHHHHHHH
   154  155 A I  H 3> S+     0   0    0   99   17  IIIIIILVIVVPVIIVIVVIIVLLIIII
   155  156 A F  H 3> S+     0   0    0   99    4  FYFYYFFFFFFFFFFFFFFFFFFFFFYF
   156  157 A A  H <> S+     0   0    4   99   44  SASAASAASAAAASSASAAAAAAAAAAA
   157  158 A I  H  X S+     0   0    5   99   14  IIVIIITVVVIIVIIIIIVIIITIVIVI
   158  159 A S  H  X S+     0   0    0   99   51  SSSTSTSASAAAASSASAAASASAASAS
   159  160 A D  H  X S+     0   0    1   99    5  DEDDEDDDDDDDDDDDDDDEDDDDEDDD
   160  161 A V  H  X S+     0   0   40   99   69  NSNTSNEANVVRANNVNAVRGAEAEGNG
   161  162 A A  H  X S+     0   0    0   99   16  AAASAAASAASSSAASAAAAAAACAAAA
   162  163 A Y  H >X S+     0   0   11   99    1  YYFYYYYYYYYYYYYYYYYWYFYYYYYY
   163  164 A R  H 3X S+     0   0   60   99   57  QRQRRQRRQRRRRQQRQRRVVRRRKVNV
   164  165 A S  H 3X S+     0   0   28   99   96  FCFSCANAFAQLAFNQFQANNANAQNDN
   165  166 A M  H   S-l  457   0C  40   99    1  EEEEEEEEEEEEEEEEEEEEEEEEEEGE
   180  181 A S  T 3  S+     0   0    5   99    1  SSSSSSSSSSSSSSSSSSSSSSSSSSAS
   181  182 A G  T 3  S+     0   0    7   99    1  GGGGGGGGGGGGGGGGGGGGGGGGGGSG
   182  183 A A  S <  S-     0   0    2   99    1  AAAAAAAAAAAAAAAAAAAAAAAAAAVA
   183  184 A G  S >> S+     0   0   13   99    3  GGGGGGGGGGGGGGGGGGGGGGGGGGYG
   184  185 A K  H 3> S+     0   0   12   99    2  KKKKKKKKKKKKKKKKKKKKKKKKKKGK
   185  186 A T  H 3> S+     0   0   20   99    1  TTTTTTTTTTTTTTTTTTTTTTTTTTAT
   186  187 A E  H <> S+     0   0   98   99   69  VEVEEVEEVEEEEVVEVEEEEEEEVEGE
   187  188 A N  H  X S+     0   0   10   99   27  NNNNNNNTNTTSTNNTNTTNNTNTSNSN
   188  189 A T  H  X S+     0   0    0   99    4  TTTTTTTTTTTTTTTTTTTTTTTTATNT
   189  190 A K  H  X S+     0   0   58   99    3  KKKKKKKKKKKKKKKKKKKKKKKKKKCK
   190  191 A K  H  X S+     0   0   32   99   54  RKRKKRKLRMLMLRRLRLMKKMKMYKEK
   191  192 A V  H  X S+     0   0    0   99   17  VVVVVVVIVLLLIVVLVLLVVLVLAVAV
   192  193 A I  H  X S+     0   0    3   99   18  IIIIIIIMIMMMMIIMIMMIIMIMMILI
   193  194 A Q  H  X S+     0   0   52   99   38  QQQQQQSQQRRQQQQRQRRQAQSRRAGA
   194  195 A Y  H  X S+     0   0    0   99    2  YYYYYYYYYYYYYYYYYYYYYYYYYYIY
   195  196 A L  H  X S+     0   0    2   99   16  FLFLLFFLFLLLLFFLFLLLFLFLFFPF
   196  197 A A  H  < S+     0   0    7   99    5  AAAAAAATAAAATAAAAAAAAAAAAASA
   197  198 A S  H  < S+     0   0   52   99   88  THTHHTIFTFFFFTVFTFHATFIFTTPT
   198  199 A V  H  < S+     0   0   28   99   23  IVIVVIVVVLLMVIILILLIVLVMVVCV
   199  200 A A  S  < S+     0   0    3   99   25  AASAAAGGAGGGGAAGAGGAGGGGSGPG
   200  201 A G  S    S-     0   0   21   99   61  VSTSSAAGVGGGGVAGAGGNAGAGGAFA
   201  202 A R        -     0   0   97   99   81  SsGssItrsRrkrTirLrreShtrSSis
   202  203 A N  S    S-     0   0  164   99   39  ggatggaggagaggdgggggsgggAqgp
   203  204 A Q  S    S+     0   0  119   93   57  skqdkek.kt...ek.e.VtkAtTSkek
   204  205 A A    >>> -     0   0   68   99   47  epqqppeDeETEDeeTqTEaeEeEEdpK
   205  206 A N  T 345S+     0   0  130   81   77
   206  207 A G  T 345S+     0   0   41   82   85  MHMPHIK.I....MS.I..KK.K..KP.
   207  208 A S  T <45S+     0   0    9   90   76  KQQHQQGDK.G..QKGQG.LK.G..KQ.
   208  209 A G  T  <5S+     0   0    1   98   17  GGGGGGGRGgggdGGgGegGGgGgAGGG
   209  210 A V  S  > S+     0   0   15   99   14  LLLLLLLVLVVVVLLVLVVLLVLVVLLL
   211  212 A E  H  > S+     0   0   10   99    3  EEEEEEEEEEEQEEEEEEEEEEEEEEEE
   212  213 A Q  H  > S+     0   0   83   99   53  DRDKRDEQDQQQQDDQDQQRDQEQEDDD
   213  214 A Q  H  X S+     0   0   35   99    2  QQQQQQQQQQQQQQQQQQQQQQQQKQQQ
   214  215 A I  H >X S+     0   0    8   99   27  ILILLIIVIVVIVIIVIVVIVVIVVVIV
   215  216 A L  H 3< S+     0   0   69   99   32  ILILLIVLILLLLIILVLLLVLVLLVIV
   216  217 A Q  H 3X S+     0   0   52   99   53  AQAQQQQEAEEEESQEAEEQQEQEAQEQ
   217  218 A A  H XX S+     0   0    1   99   35  AAAAAATSASSSSAASASSATSTSSTAT
   218  219 A N  H 3X S+     0   0   13   99    0  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
   219  220 A P  H 3> S+     0   0   35   99    0  PPPPPPPPPPPPPPPPPPPPPPPPPPPP
   220  221 A I  H XX S+     0   0    0   99   46  LILIILVLLVVVLLAVLVVIVVVVIVAV
   221  222 A L  H 3X S+     0   0    2   99    1  LLLLLLLLLLLLLLLLLLLLLLLLMLML
   222  223 A E  H 3X S+     0   0   24   99    0  EEEEEEEEEEEEEEEEEEEEEEEEEEEE
   223  224 A A  H << S+     0   0    4   99    7  ASAASAAAAAAAAAAAAAAAAAAAAAAA
   224  225 A F  H  < S+     0   0    2   99    4  YFYFFFFFYFFFFFFFYFFFFFFFIFFF
   225  226 A G  H  < S+     0   0    0   99    0  GGGGGGGGGGGGGGGGGGGGGGgGGGGG
   226  227 A N  E  <  +M  236   0D   1   99    0  NNNNNNNNNNNNNNNNNNNNNNnNNNNN
   227  228 A A  E     -MN 235 277D   0   99    0  AAAAAAAAAAAAAAAAAAAAAAAAAAAA
   228  229 A K  E     +     0   0D  40   99    7  KKKKKKKRKKKKRKKKKKKQKKKKKKKK
   229  230 A T  E >   -M  232   0D   1   99    0  TTTTTTTTTTTTTTTTTTTTTTTTTTTT
   230  231 A T  T 3  S+     0   0   73   99   24  VVVVVVVVVVVVSVVVVVVAVVVVTVLV
   231  232 A R  T 3  S+     0   0   67   99   25  RKRKKRRRRRRRYRRRRRRRRRRKRRRR
   232  233 A N  E X   -M  229   0D  37   99    2  NNNNNNNNNNNNANNNNNNNNNNNNNNN
   233  234 A N  E 3  S+     0   0D  45   99   24  DDDDDDNDDNNNSDDNDNNNDNNNDDDD
   234  235 A N  E 3  S+     0   0D  45   99    0  NNNNNNNNNNNNnNNNNNNNNNNNNNNN
   235  236 A S  E <   -M  227   0D   4   99    3  SSSSSSSSSSSSkSSSSSSSSSSSSSSS
   236  237 A S  E     -M  226   0D  12   99    3  SSSSSSSSSSSSHSSSSSSSSSSSSSSS
   237  238 A R  S    S+     0   0    3   99    0  RRRRRRRRRRRRRRRRRRRRRRRRRRRR
   238  239 A F  S    S-     0   0    3   99    0  FFFFFFFFFFFFFFFFFFFFFFFFFFFF
   239  240 A G  E     -J  260   0B   3   99    0  GGGGGGGGGGGGGSGGGGGGGGGGGGGG
   240  241 A K  E     -JK 259 453B   5   98    0  KKKKKKKKKKKKK.KKKKKKKKKKKKKK
   241  242 A F  E     -JK 258 452B  10   98    0  FFFFFFFFFFFFF.FFFFFFFFFFYFFF
   242  243 A I  E     -JK 257 451B   5   98    8  IIIIIIIVIVVVV.IVIVVVIVIVIIII
   243  244 A E  E     -JK 256 450B  33   98   32  RRRRRRREREEEE.REREERREREERRR
   244  245 A I  E     -JK 255 449B   4   98    7  IIIIIITIIILII.ILIIIIIITIIIII
   245  246 A Q  E     -JK 254 448B   5   98   48  HNHNNHHQHQQQQ.HQHQQAHQHQGHHH
   246  247 A F  E     -JK 252 447B   0   98    0  FFFFFFFFFFFFF.FFFFFFFFFFFFFF
   247  248 A N        -     0   0   40   98   38  GDGDDGSDGDDDD.GDGDDGGDSDDGGG
   248  249 A S  S    S+     0   0  100   98   79  SVAVVTASTKKDT.AKSKKGPKSKNPPP
   249  250 A A  S    S-     0   0   57   98   66  TTTNTTQNSHSNN.TSSSSDSHAYRSST
   250  251 A G  S    S+     0   0    1   98    4  GGGGGGGGGGGGG.GGGGGGGGGGYGGG
   251  252 A F  S    S-     0   0   92   98   74  KYKYYKKRKRKKR.KKKKRSKKKKRKKK
   252  253 A I  E     +J  246   0B   1   98   28  LILIILLILIIII.LILIIILILIILLL
   253  254 A S  E     -     0   0B  19   98   60  AVAVVSASASSSS.ASASSAASASIAAA
   254  255 A G  E     -J  245   0B   0   98   37  SGSGGSGGSGGGG.SGSGGGGGGGGGSG
   255  256 A A  E     -J  244   0B   3   98    3  AAAAAAGAAAAAA.AAAAAAAAGAAAAA
   256  257 A S  E     -J  243   0B  27   98   49  DNDNNDDADAAAA.DADAASDADANDDD
   257  258 A I  E     -J  242   0B  15   98    3  IIIIIIIIIIIII.IIIIIIIIIVMIII
   258  259 A Q  E     -J  241   0B  98   98   33  EEEEEEERERRRR.ERERRDERERREDE
   259  260 A S  E     -J  240   0B  18   98   30  TTTTTTHTTTTTT.TTTTTWTTHTTTsT
   260  261 A Y  E     -J  239   0B  22   98    3  YYYYYYYYYYYYY.YYYYYYYYYYYYdY
   261  262 A L        -     0   0   43   98    2  LLLLLRLLLLLLL.LLLLLLLLLLLLLL
   262  263 A L        -     0   0   32   98    0  LLLLLLLLLLLLL.LLLLLLLLLLLLLL
   263  264 A E    >   +     0   0   14   98    1  EEEEEEEEEEEEE.EEEEEEEEEEEEEE
   264  265 A K  G >   +     0   0   49   98   14  KKKKKKKRKRRRR.KRKRRKKRKRKKKK
   265  266 A S  G >> S+     0   0   22   98    4  SSSSSSSSSSSSS.SSSSSSASSSSASA
   266  267 A R  G <4 S+     0   0   10   98    0  RRRRRRRRRRRRR.RRRRRRRRRRRRRR
   267  268 A V  G <4 S+     0   0    0   98   41  VAVAAVVVVVVVV.VVGVVVVVVVVVVV
   268  269 A V  T <4 S+     0   0   28   98   63  TVTIVTVVSCCCV.ICTCCIICVCVIII
   269  270 A F     <  +     0   0  135   98   99  FRFRRFRQFQQQQ.FQEQQTSQRQFSFS
   270  271 A Q        -     0   0    9   98   40  QQQQQQQIQITII.QTGIIRQIQVQQQQ
   271  272 A S    >   -     0   0   50   98   86  LALAALATLSSST.LSNNSSQSASAQLQ
   272  273 A E  T 3  S+     0   0  152   98   65  SKEKKSPDPDSDD.KSCSNDSDPDDAPS
   273  274 A T  T 3  S+     0   0   63   99   70  ADLDDAGPDPPPPASPQPPILPGPELGL
   274  275 A E    <   -     0   0    5   97    0  EEEEEEEEEEEEE.EE.EEEEEEEEEEE
   275  276 A R        -     0   0    0   97    0  RRRRRRRRRRRRR.RR.RRRRRRRRRRR
   276  277 A N  S    S-     0   0    0   97   68  STGTTSSNGNNNN.SN.NNNSNCNNSGS
   277  278 A Y  B >>  -N  227   0D   0   97    3  YFYFFYYYYYYYY.YY.YYFYYYYYYYY
   278  279 A H  H >> S+     0   0   13   97    0  HHHHHHHHHHHHH.HH.HHHHHHHHHHH
   279  280 A I  H 3> S+     0   0    0   97   27  IIIIIIICICCCC.IC.CCVICICVIVI
   280  281 A F  H <> S+     0   0    0   97    0  FFFFFFFFFFFFF.YF.FFFFFFFFFYF
   281  282 A Y  H X S+     0   0    2   97   25  LLMLLIILMLLLL.IL.LLIMLILLMII
   284  285 A L  H 3< S+     0   0    4   97   61  MLMLLMMCMCCCC.LC.CCLMCMCCMLM
   285  286 A A  T 3< S+     0   0   59   97   51  TSTTSSSSTASAA.SS.AAESASSASSS
   286  287 A G  T <4 S+     0   0   23   97   56  GGNGGNGFNAAAS.NA.AAGGAGASGGG
   287  288 A A  S  < S-     0   0   15   97   80  HAHAAKHEHPPPG.KP.PPGSPFPASKA
   288  289 A T    >>  -     0   0   53   97   76  KGKGGRNRKKSSR.KS.SAGVKDPHVKV
   289  290 A A  H 3> S+     0   0   77   97   66  PEPDEPPDPEEED.PE.EEAKEPELNPS
   290  291 A E  H 34 S+     0   0  104   97   61  EHEKHEKAEEDDA.ED.DELGESDPGEG
   291  292 A E  H X> S+     0   0   32   97   44  LLLMLLLELIICE.LI.LVRLVLVELLL
   292  293 A K  H 3<>S+     0   0   83   97   89  IKIRKIRKIEKKK.LK.KEDKERKFKQK
   293  294 A K  T 3<5S+     0   0  142   97   63  ESENSDEYEKKKY.DK.KRTEKGKKEDE
   294  295 A A  T <45S+     0   0   44   97   91  ADMEDMSKMYYYK.MY.YYLMYKFNMMM
   295  296 A L  T  <5S-     0   0    3   97   51  LLSLLLLLTYKKL.MK.KKLCRLKLCLC
   296  297 A H  T   5 +     0   0   93   97   35  LLLLLLKGLLLLD.LL.LLLLLKVRMLL
   297  298 A L      < +     0   0   14   97   58  ILLLLILHIDGGH.VG.GQQLGLGLLLL
   298  299 A A        -     0   0   39   97   69  SETEETTPTHDEP.TD.DNGTNDDSSSS
   299  300 A G    >>  -     0   0   20   62   66  K.T..TH.T.....N.....N.N..NMN
   300  301 A P  G >4 S+     0   0   26   87   56  NGNNGND.N.....N....GN.D.SDNN
   301  302 A E  G 34 S+     0   0  121   96   83  PFPYFPLSPPPA..PP.PPTIPVPAIPV
   302  303 A S  G <4 S+     0   0   55   97   93  YNYNNYKHYKSKS.YS.SKQHKSRNYYS
   303  304 A F  S XX S-     0   0    4   97   71  DNDNNDYFDSSTH.DS.SSEDTYSDDDD
   304  305 A N  T 34 S+     0   0   72   97   11  YYFYYFYHFFFFF.YF.FFYYFYFFYYY
   305  306 A Y  T 34 S+     0   0    6   97   84  PRPRRHHYPHHHH.AH.HHEHHHHLYHN
   306  307 A L  T <4 S+     0   0    0   97   28  MFMFFFFLMYYYY.FY.YYYFYFYYIFF
   307  308 A N  S  < S+     0   0   54   97   59  ILCLLVCNCLLLL.IL.LLLVLCLTVCV
   308  309 A Q  S    S+     0   0  120   96   39  SSSSSSSQSNNNN.SN.NNNSNSNRSSA
   309  310 A S  S    S-     0   0    4   97   44  HNMNNQQSQQQQQ.QQ.QQKQQQQQQQQ
   310  311 A G  S    S+     0   0   77   97   23  GGGGGGAKGSSSS.GS.SSSgSATGggg
   311  312 A C        +     0   0    9   97   83  EYQSYEEVQksnk.Es.akRgnEnraek
   312  313 A V        +     0   0   46   96   50  IIIIIILYIfiiy.Ti.iyTiyLypI.V
   313  314 A D        -     0   0  114   96   65  TPTTPTTETEREE.TR.QEETETEVC.Q
   314  315 A I    >   -     0   0    9   96   21  VIVIIVILVLVLL.VV.VLVILIVIL.I
   315  316 A K  T 3  S+     0   0  190   96   70  KPAPPADDAVDDD.TD.DDDPVEAEL.N
   316  317 A G  T 3  S+     0   0   72   97   45  SGSGGSGGSGGGG.SG.GGGNGGNGSPG
   317  318 A V    <   -     0   0   58   97   63  IQIQQVVVIVILV.II.IVVVVVVVNEV
   318  319 A S     >  -     0   0   50   97   51  DQDQQDDRDSNDS.DN.NNDDCNDDDGD
   319  320 A D  H  > S+     0   0   22   97    9  DDDDDDDNDDDDS.DD.DDDDDDDDVAD
   320  321 A S  H  > S+     0   0   39   97   80  VKKKKQKSKAASA.AA.AARGAKASMQG
   321  322 A E  H  > S+     0   0  107   97   29  EDVDDEEEEHEKE.EE.EEEEHERKDRE
   322  323 A E  H  X S+     0   0   62   97   51  ENELNEEEEDEEE.EE.EEDEDEEEYHE
   323  324 A F  H  X S+     0   0    2   97   36  FFLFFLMYLYYYY.LY.YYWCYMYLNLM
   324  325 A K  H  X S+     0   0   85   97   80  IQEMQMGLDLLTM.LL.LLRLLGLCIHG
   325  326 A I  H  X S+     0   0   77   97   69  AEAEEALKAAADK.AA.AALLALETVCL
   326  327 A T  H >X S+     0   0    5   97   14  TTTTTTTTTTTTT.TT.TTLTTTTTSET
   327  328 A R  H 3X S+     0   0   61   97   84  DMDLMDQRDRRRK.DR.RRKDRQRRQDD
   328  329 A Q  H 3X S+     0   0  106   97   72  TENEESERSRNRR.SN.NRTQKENHGHQ
   329  330 A A  H S+     0   0    0   99   47  IMIMMIFMIMMMMIFMTMMLFMFMFTMF
   331  332 A D  H  <5S+     0   0   72   99   49  DRDKHDDDDDDSDDDDTDDDDDDDTVDD
   332  333 A I  H  <5S+     0   0   61   99   17  IIIIIIIIIVMIIIIMVTIVVVIVLIII
   333  334 A V  H  <5S-     0   0    5   99   23  LMLMMLMVLVVVVLLVLVVVLVMVLPLL
   334  335 A G  T  <5 +     0   0   53   99   12  GGGSGGGGGGGGGGGGIGGGGGGGGGGG
   335  336 A F      < -     0   0   12   99   25  LFFIFFFIFIIIIFFIVIIFFIFIIVFF
   336  337 A S     >  -     0   0   44   99   59  TSTPSNESSSTSsSTTSTSTTSDGNdST
   337  338 A Q  H  > S+     0   0  133   96   69  AHNEHPDHGKESeAQE.DEPQQDQ.gVQ
   338  339 A E  H  > S+     0   0  150   97   30  DEEDEDDAEAEDDDEE.QEDENAE.EDE
   339  340 A E  H  > S+     0   0   44   98    3  EEEEEEEDEEEEQEEE.EEEEEEEEEEE
   340  341 A Q  H  X S+     0   0    3   99   61  KIKQIKVQKQQQsRKQkQQQKQVQsmKK
   341  342 A M  H >X S+     0   0   46   99   84  ALMILVMEMEEDeVNEkEDLDDMDmtCN
   342  343 A S  H 3X S+     0   0    8   99   52  CSSGSGDSGSAAASSACAADNSDAGDAD
   343  344 A I  H 3X S+     0   0    0   99   33  IMIMMILIIIIIIILIFIILIILILVCI
   344  345 A F  H X S+     0   0    0   99   51  GSGASGAAGAAAAGGATAAAAAAAANGA
   349  350 A G  H 3X S+     0   0    0   99   34  ASASSAAAAAAAAAAAHAAAAAGAARAS
   350  351 A I  H 3X S+     0   0    0   99   14  VVVVVVIIVIVIIVIVLVIIVIIIIILV
   351  352 A L  H << S+     0   0    0   99   17  MLLLLMMLLLLLLMMLFLLLMLMLLSLM
   352  353 A H  H >X S+     0   0   12   99   31  HQHQQHHHHHHHHHHHLHHHHHHHHDHH
   353  354 A L  H >< S+     0   0    0   99   56  HFHLFYMVHILLLYFLFLLIMLMLLYFM
   354  355 A G  T 3< S+     0   0    0   99    2  GGGGGGGGGGGGGGGGSGGGGGGGGPGG
   355  356 A N  T <4 S+     0   0   52   99   23  NNNNNNENNNNNNNNNSNNNGNENNINT
   356  357 A I    <<  -     0   0    4   99   34  MIMLIMMIMIIVIMMIVIVIMVMIVVMM
   357  358 A K        -     0   0  131   98   62  KSKNSKKEKDSEEKKS.NEDKEKNESKK
   358  359 A F        -     0   0    9   98    8  FFFFFFFFFFFFFFFF.FFIFFFFIQFF
   359  360 A E  E     -O  367   0E  66   98   36  KKKKKKKSKGAASKKA.AASKDKSKGKK
   360  361 A K  E     -O  366   0E 117   98   49  QKQKKQQPQKKEPQQK.KKSQKQKDKQQ
   361  362 A G        -     0   0   16   98   69  KEKEEKRGKGGGGKKG.GGDRGRGRTKR
   362  363 A A  S    S+     0   0  113   99   66  QRQRRQPkQktskQQtPrerGepqdrQG
   363  364 A G  S    S-     0   0   43   95   69
   364  365 A E  S    S+     0   0  146   98   45  ededdeeaevvmveev.ivdeaekSdee
   365  366 A G  S    S-     0   0    8   98   38  QQQQQQQVQPIPIQQI.IIQQLQLLAQQ
   366  367 A A  E     -O  360   0E   0   98   35  AAAAAAAKAKKKKAAK.KKAALDRIAAA
   367  368 A V  E     -O  359   0E  42   98   56  ESEsSEENEDDDDEED.DDQENgDAqEE
   368  369 A L        +     0   0    6   98   79  PMPpMPPDPDAEQPPA.DEIADvEPaAA
   369  370 A K        +     0   0  145   98   57  DPDDPDDKDNKKKDDK.KQKDETKNDDD
   370  371 A D        +     0   0   88   99   48  GEGNEGGSGASSSGGSDSSSGSiSNGGG
   371  372 A K     >  +     0   0   76   92   71  NNN.NTDRNRRQSTTR.RRNTKfV.TTT
   372  373 A T  H  > S+     0   0   90   98   83  ETETTEEFEFFFFEEF.FFVEFLYREEE
   373  374 A A  H  > S+     0   0   13   98   79  EVDAVEDHEHHHHVEH.HHAEHDHHDSD
   374  375 A L  H  > S+     0   0    2   98   43  AAAAAAALALLLLAAL.LLLGLALLGAG
   375  376 A N  H  X S+     0   0   62   98   47  DQDQQDQQDKNRQDDN.KNEDQAKTDDE
   376  377 A A  H  X S+     0   0   11   99   37  KKKKKKNMKTTTMKKTKTMKRTNIAKKR
   377  378 A A  H  X S+     0   0    0   99   59  ILVVLIVAITAAAASAIATAVAAVFVAV
   378  379 A S  H  X>S+     0   0    1   99   48  ACACCAAAAAGAAAAGAGASAACACAAA
   379  380 A T  H ><5S+     0   0   88   99   78  YHYHHYHDYEEEDYYEYEEHKDHEEKYK
   380  381 A V  H 3<5S+     0   0   11   99    7  LLLLLLCLLLLLLLLLLLLLLLNLLLLL
   381  382 A F  H 3<5S-     0   0    0   99   32  MLLMLMLFLLLFFQMLMLLLLLFLVLML
   382  383 A G  T <<5 +     0   0   20   99   40  GGGGGGGMGMMMMGGMGMKGGMGMGGGG
   383  384 A V  S   >  -     0   0   88   99   32  NNNNNNNDNDDDDNNDNDDSDDNDTDND
   385  386 A P  H 3> S+     0   0   45   99   77  SVSVVSHVSPCEVSSCSCAPCPHEYCST
   386  387 A S  H 3> S+     0   0   66   99   72  AMAMMAEDAVEKNASEAEKQANEKQAGT
   387  388 A V  H <> S+     0   0   69   99   37  DEDDEDELEAKGLDDKDKSEDADADDDQ
   388  389 A L  H  X S+     0   0    0   99   18  LFMFFLLLMLLLLLLLMLLFLLFLMLLL
   389  390 A E  H >X S+     0   0   34   99   80  LTLTTLLLLEEELLLELEESYELQSYLY
   390  391 A K  H 3X S+     0   0  107   99   49  KRKRRKKAKDNEAKKNKNDKKNKDQKKT
   391  392 A A  H 3< S+     0   0    3   99   41  AAAAAASTGAASTAGAAAAANAASWNGA
   392  393 A L  H << S+     0   0    0   99   22  LILIILLLMLLLLLLLLLLVLLLLLLLL
   393  394 A M  H  < S+     0   0    4   99   89  CLCLLCTCCCICCCVICIILLLTCCLLV
   394  395 A E  S  < S+     0   0   66   99   95  YTYSTYKTYKKKTYHKYKTRKKKEHKHK
   395  396 A P        -     0   0    0   99   24  PPPPPPPRPRRRRPPRPRRPPRPRRPPP
   396  397 A R  E     +P  405   0F 113   99   35  RRRRRRRSRVEVTRREREVRRVRVKRRR
   397  398 A I  E     -P  404   0F  62   99   22  VIVIIVVIVMIMIVVIVIMVIMVILIVI
   398  399 A L  E     -P  403   0F 121   99   35  KKKKKKRQKINAQKKNKNILKVRVKKRK
   399  400 A A  E >  S-P  402   0F  55   99   31  VVVVVVVTVTTTTVVTVTTAVTVTTVVV
   400  401 A G  T 3  S-     0   0   79   99   27  GGGGGGGRGPPRRGGPGPPGGPGPAGGG
   401  402 A R  T 3  S+     0   0  237   99   67  NRNRRNTENEEGENNENEERNETDNNNN
   402  403 A D  E <   -P  399   0F 106   99   24  EDEDDEEGEEGEGEEGEGEEEEEGEEEE
   403  404 A L  E     +P  398   0F 103   99   55  YYYYYFWSYVVSSYYVMVVWFVWNTFYF
   404  405 A V  E     -P  397   0F  56   99   10  VVVVVVVIVIIIIVVIVIIVVIVIYVVV
   405  406 A A  E     -P  396   0F  61   99   62  TQTQQTNITKTTITTTTTTTTENTVTTT
   406  407 A Q        -     0   0   67   99   21  KKKKKKKKKRTKKKKTKTRQQRKKKQKQ
   407  408 A H        -     0   0   91   99   46  GAGAAGGVGSTNAGGTGTTAGSGPPGGG
   408  409 A L        -     0   0   21   99   43  QQQQQQQLQLVLLQQVQVLRRLQLLRQR
   409  410 A N     >  -     0   0   45   99   50  TTTTTTNDTDGDDTTGTGDTNDNDPNSN
   410  411 A V  H  > S+     0   0   53   99   83  VKVQKVLCVPPPCVVPVPPKKPLPRKVV
   411  412 A E  H  > S+     0   0  146   99   61  PEPEEQENALNRNEQNPNEQDNEDLDEN
   412  413 A K  H  > S+     0   0  131   99   28  QQQQQQQAQSSAAQQSQSAQQGQSQQQQ
   413  414 A S  H  X S+     0   0    0   99   54  VAVAAVVAVaAaAvgaVaAAvSVaaVVv
   414  415 A S  H  X S+     0   0   39   98   94  NDLEDYHVYvTlVnfvNiLIyINlnIV.
   415  416 A S  H  X S+     0   0   75   90   82  NFNFFNWAN.V.A.y.N.GD.VW..NFy
   416  417 A S  H  X S+     0   0   13   99   43  SASAANAGSSSSSAASSSSESSASASAS
   417  418 A R  H  X S+     0   0   14   99   46  VVVVVVVRVRRRRVVRVRRLVRVRRVVV
   418  419 A D  H  X S+     0   0   38   99   55  METEEGADSDDDDGGDSDDGGDADDGGG
   419  420 A A  H  X S+     0   0   19   99    9  AAAAAAGAAGGAAAAGAGAAAGGAAAAA
   420  421 A L  H  X S+     0   0    0   99    3  LLLLLLLLLLFLLLLFLLLLMLLLLLLM
   421  422 A V  H >X S+     0   0    0   99   35  CAAAAAGAAAASAAAACAACSAAASCAS
   422  423 A K  H 3X S+     0   0   39   99    1  KKKKKKKKKKKRKKKKKKKKKKKKKKKK
   423  424 A A  H 3X S+     0   0   13   99   55  SASAASATSTQITASQSQTTATATHGAA
   424  425 A L  H X S+     0   0   62   99   14  RRRRRRRKRKRKKRRRRRKRKKRKHKRK
   436  437 A I  H >X S+     0   0    0   99   21  IIIIIICIIIIIIIIIIIIICICIVCIC
   437  438 A N  H 3X S+     0   0   24   99    0  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
   438  439 A N  H << S+     0   0   99   99   68  EKQKKQKMQNASRQNAEAIREFKNKEQE
   439  440 A V  H << S+     0   0   28   99   80  MAMAAQTSMSSSSQTSMSSATSTSATTT
   440  441 A L  H  < S+     0   0    3   99   12  LLLLLLLVLIIIVLLILIILLILILLLL
   441  442 A C     <  +     0   0   51   99   25  DDDDDDDGDGGGGDEGDGGDDGDGVDDD
   442  443 A Q        +     0   0  142   99   70  trtkrtaQtqQQQttQtQQRtQaQTttt
   443  444 A E  S    S-     0   0  136   94   67  qrqrrqq.qhDD.qqDqDD.qDiD.qlq
   444  445 A R        -     0   0  232   99   64  PQQQQAidQTppdPPpPpppKpqpnKPK
   445  446 A K        -     0   0   84   99   75  RGRGGRrsRSsssRRsRsskRscaqRRR
   446  447 A A  S    S-     0   0   39   99   67  SANAAQRKNKDKQQQDQNKSQKSTHQQQ
   447  448 A Y  E     - K   0 246B  41   99   85  FSHSSHYIFSKIMYYKFKSSHSHNSHFH
   448  449 A F  E     - K   0 245B  11   99   17  FFFFFYFQYLLLQFFLFLIFFIFIFFFF
   449  450 A I  E     -hK 172 244B   1   99    5  IIIIIIIIIIIIIIIIIIIIIIIIIIII
   450  451 A G  E     -hK 173 243B   0   99    0  GGGGGGGGGGGGGGGGGGGGGGGGGGGG
   451  452 A V  E     -hK 174 242B   0   99   12  VIVIIVVVVVVVVVVVVVVVVIVVVVVV
   452  453 A L  E     +hK 175 241B   6   99    0  LLLLLLLLLLLLLLLLLLLLLLLLLLLL
   453  454 A D  E     + K   0 240B   2   99    0  DDDDDDDDDDDDDDDDDDDDDDDDDDDD
   454  455 A I        -     0   0   12   99    2  IIIIIIIIIIIIIIIIIIIIIIIIIIII
   455  456 A S        -     0   0   14   99   37  AAAAAAAYAYYYYAAYAYYAAYAYYAAA
   456  457 A G        -     0   0    6   99    0  GGGGGGGGGGGGGGGGGGGGGGGGGGGG
   457  458 A F  B     -l  179   0C   7   99    0  FFFFFFFFFFFFFFFFFFFFFFFFFFFF
   458  459 A E        -     0   0    1   99    0  EEEEEEEEEEEEEEEEEEEEEEEEEEEE
   459  460 A I        +     0   0   57   99   31  IIIIIIICISSSSIISISSIISISTIII
   460  461 A F        -     0   0   26   99    0  FFFFFFFFFFFFFFFFFFFFFFFFFFFF
   461  462 A K  S    S+     0   0  200   99   39  DEDEEDDKDKKKKDDKDKKEDKDKEDED
   462  463 A V  S    S-     0   0   97   99   64  YLFLLYFDYNTTHFFTYTTTYTFIIYFY
   463  464 A N  B     +q  578   0G   6   99    0  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
   464  465 A S     >  -     0   0   13   99   24  SSTSSSSSSSSSSSSSSSSGGSSSSgSg
   465  466 A F  H  > S+     0   0    8   99   13  LFLFFLFFMFFFFLFFLFFFFFFFFfFf
   466  467 A E  H  > S+     0   0   22   99    0  EEEEEEEEEEEEEEEEEEEEEEEEEEEE
   467  468 A Q  H  > S+     0   0   12   99    0  QQQQQQQQQQQQQQQQQQQQQQQQQQQQ
   468  469 A L  H  X S+     0   0    1   99    5  LLLLLLLFLFLFFLLLLLFLLLLLFLLL
   469  470 A C  H  X S+     0   0    3   99   13  CCCCCCWCCCCCCCCCCCCCCCWCCCCC
   470  471 A I  H  X S+     0   0    7   99    0  IIIIIIIIIIIIIIIIIIIIIIIIIIII
   471  472 A N  H  X S+     0   0    0   99    0  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
   472  473 A Y  H  X S+     0   0    3   99    8  FYFYYFFFFFFLFFFFYFFYFYFLYFFF
   473  474 A T  H >X S+     0   0   11   99   12  TTTTTTVATTTTATTTTTTTTTVTATTT
   474  475 A N  H 3X S+     0   0    5   99    0  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
   475  476 A E  H 3X S+     0   0    0   99    0  EEEEEEEEEEEEEEEEEEEEEEEEEEEE
   476  477 A K  H S+     0   0    9   99    0  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
   483  484 A H  I  X>S+     0   0   46   99   21  HHHHHHHEHQQQEHHQHQQRHQHQMHQH
   484  485 A H  I  <>S+     0   0   36   99   56  HTHTTPHHHHNHHHHNTNHHHYHHHHHH
   485  486 A M  I  <5S+     0   0   20   99   18  MMMMMMMVMVVVVMMVMVVMMVMVVMMM
   486  487 A F  I  X5S+     0   0   11   99    0  FFFFFFFFFFFFFFFFFFFFFFFFFFFF
   487  488 A K  I  X>S+     0   0    0   99    0  YYYYYYYYYYYYYYYYYYYYYYYYYYYY
   494  495 A L  T 3<5S+     0   0   49   99   63  KQKQQKKGKTTTRKKTKTEAKVKTMKKK
   495  496 A K  T <45S+     0   0  139   99   29  KRKRRKRKKKRKRKKRKRKRKKKRRRRI
   496  497 A E  T  <5S-     0   0   17   99    0  EEEEEEEEEEEEEEEEEEEEEEEEEEEE
   497  498 A K  T   5 +     0   0  125   99   29  GGGGGGGEGEQEEGGQGQEGgGGEQggg
   498  499 A I      < -     0   0    3   99    1  IIIIIIIIIIIIIIIIIIIIiIIIIili
   499  500 A N        +     0   0  139   99   44  EEIEEEQNVDNDNEENENNEEDQDPEPE
   500  501 A W        -     0   0   27   99    0  WWWWWWWWWWWWWWWWWWWWWWWWWWRW
   501  502 A T        -     0   0  118   98   67  ENESNETSESSSST.SESSEASTSTTQA
   502  503 A F        -     0   0  131   98    2  FFFFFFFYFYYYYF.YFYYFFYFYLFFF
   503  504 A I        -     0   0   41   98    2  IIIIIIIIIIIIII.IIIIVIIIVIIFI
   504  505 A D        -     0   0  128   98   12  DDDDDDDEDEEQED.EDEEDDEDEDDID
   505  506 A F        -     0   0   24   98    3  FFFFFFFFFFFFFF.FFFFFFFFFFFGF
   506  507 A G  S    S+     0   0   57   97   28  GGGGGGG.GVVVIG.VGVVGGVGVYGVG
   507  508 A L        +     0   0   39   98   46  MLMLLMLVMDDDDM.DMDDMMDLDDMLM
   508  509 A D        -     0   0  109   98   14  DDDDDDDDDNNNND.NDNNDDNDNNDDD
   509  510 A S     >  +     0   0   10   98   36  LLLLLLLNLQQQQL.QLQQLLQLQQLIL
   510  511 A Q  H  > S+     0   0   78   98   55  AQAQQAQQADDEDA.DADDQLDQDPQAA
   511  512 A A  H  > S+     0   0   46   98   60  APAPPAADSVVIVA.VAVVPAVAVCNGA
   512  513 A T  H  > S+     0   0    2   98   53  CCCCCCCVCLLLLC.LCLLTCLCLICFC
   513  514 A I  H >X S+     0   0    4   98   36  IIIIIIILIDDDDI.DIDDIIDIDNIEI
   514  515 A D  H 3X S+     0   0   75   98   49  EDEDDEEEELLLLE.LELLEDLELLDIE
   515  516 A L  H 3< S+     0   0    4   98   13  LLLLLLLLLIIIIL.ILIILLILIILFL
   516  517 A I  H << S+     0   0    0   98   33  IIIIIIIIIEEEEI.EIEEIIEIEEIEI
   517  518 A D  H  < S+     0   0   18   98   27  EEEEEEEEEKKKKE.KEKKEEKEKAEFE
   518  519 A G     <> -     0   0   17   98   21  KRKKRKKKKKKKKK.KKKKSKKKKKKNK
   519  520 A R  T   5 +     0   0  180   99   21  PpPppPPKPPPPPPPPPPPtfPPPMmsy
   520  521 A Q  T   5S+     0   0  168   29   48
   521  522 A P  T   5S-     0   0   97   33   58  .P.PP..P...........niG.G.iiv
   522  523 A P  T   5 -     0   0   33   95   76  MPMPPMLIMGGGIMMGMGGim.L..mlm
   523  524 A G     >< -     0   0    2   99    1  GGGGGGGGGGGGGGGGGGGGGGGGGGGG
   524  525 A I  H  > S+     0   0    0   99    6  IVIIVILIIIIIIIIIIIIIIILIIIII
   525  526 A L  H  > S+     0   0   11   99   28  FLFLLFIIFIIIIFMIFIILLIIILLLL
   526  527 A A  H  > S+     0   0   24   99   45  SASAASSASAAAASSASAASSASADSSS
   527  528 A L  H  X S+     0   0    1   99   34  ILILLIMLILLLLIILILLCILMLLIII
   528  529 A L  H  X S+     0   0    1   99    0  LLLLLLLLLLLLLLLLLLLLLLLLLLLL
   529  530 A D  H  < S+     0   0   27   99   20  EDEDDEDDEDDDDEEDEDDDEDDDDEEE
   530  531 A E  H >X S+     0   0  105   99    1  EEEEEEEEEEEEEEEEEEEEEEEEEEEE
   531  532 A Q  H >< S+     0   0   13   99   24  EEEEEEEAEAATAEEAEAAEEAEAEEEE
   532  533 A S  T 3< S+     0   0   11   99    7  CCCCCCCCCCCCCCCCCCCCSCCCCSCS
   533  534 A V  T <4 S+     0   0   73   99   65  MWMWWMIMMMMMMMMMMMMIMMIMKMMM
   534  535 A F    X<  -     0   0   95   99   13  FFFFFFVFFFFLFFFFFFFMFFVFMFFF
   535  536 A P  T 3  S+     0   0  109   99    2  PPPPPPPPPPPRPPPPPPPPPPPPPPPP
   536  537 A N  T 3  S+     0   0  119   99    3  KKKKKKKKKKKNKKKKKKKKKKKKKKKK
   537  538 A A    <   +     0   0   14   99   21  AAAAAAASASSSSAASASSAASASGAAA
   538  539 A T     >  -     0   0   65   99   28  TTTTTTTTSTTTTTTTSTTTTTTTSTST
   539  540 A D  H  > S+     0   0   50   99   20  DDDDDDDPDHHHHDDHDHHDDHDHDDDD
   540  541 A N  H  > S+     0   0  107   99   78  IKTKKQMETEEEATMETEEAKEMEDQAQ
   541  542 A T  H  > S+     0   0   40   99   42  TTSSTSTTSTTTTSTTTTTTTTTTSTST
   542  543 A L  H  X S+     0   0    0   99    3  FFFFFFYFFFLFFFFLFLFFFFYFWFFF
   543  544 A I  H  X S+     0   0    2   99   84  KVKVVTVSKSSASKKSKSATECVAAVRV
   544  545 A T  H  X S+     0   0   69   99   62  NENEENQTNNQETNAQNQQAEEQQQEAE
   545  546 A K  H  X S+     0   0   66   99    0  KKKKKKKKKKKKKKKKKKKKKKKKKKKK
   546  547 A L  H  X S+     0   0    0   99   10  LLLVLLLLLLLLLLLLLLLLLLLMLLLL
   547  548 A H  H  X S+     0   0   18   99   66  YVYLVYNFYYYYFYYYYYYHNYNYYNYN
   548  549 A S  H  < S+     0   0   77   99   49  DQDQQDDQDQEQQEDEDEQANQDQNNDT
   549  550 A H  H  < S+     0   0   59   99   66  qeqeeqqhqIKkNqnKqktinsqTtnnn
   550  551 A F  H >X S+     0   0   20   99   81  shshhshhnFFnFssFnhngshhycsss
   551  552 A S  T 3< S-     0   0   18   99   69  pSKPSNPPNKKPRNGKKKKpPKPkSpPP
   552  553 A K  T 34 S+     0   0  206   82   82  .KAKKNN.A..H.NN.ARRhNRNRL.NN
   553  554 A K  T <4 S+     0   0  159   91   42  FFFFFFF.FNNF.FFNFFFLFFFFFYFY
   554  555 A N    ><  -     0   0   43   96   61  QQEFQQQ.QNHSAQGHETIGLIQSELQQ
   555  556 A A  T 3  S+     0   0   96   97   37  KKKKKKK.KKKKHKKKKKKQKKKKKKQK
   556  557 A K  T 3  S+     0   0   65   98   36  PPPPPPPRPRRPPPPRPPPTPPPPPPPP
   557  558 A Y  E <   -R  569   0G  12   98   48  KRKKRKRLKFFKRKRFKKKKKKKKRKRK
   558  559 A E  E     -R  568   0G  88   98   83  PQPKQPPGPVAFLVNAPLLYPLPLMPPP
   559  560 A E        -     0   0   86   98   88  TLALLGPKAKKSEVIKGSSAPSPASPDP
   560  561 A P        -     0   0    4   98   42  KKKKKKKEKPPRKKKPKRRPKRKRNKKK
   561  562 A R  S    S+     0   0  251   98   72  GDGDDGgKGKKSaGGKGTTApTgTRpkp
   562  563 A F  S    S+     0   0  146   74   63  K.K..KqFKLL.fKKLK..Rq.q..ckq
   563  564 A S        -     0   0   23   74   80  A.A..ASSASS.SVPSA..FV.A..QYQ
   564  565 A K  S    S+     0   0  166   91   56  EKEEKDEQERR.EEERE..AA.E..AQA
   565  566 A T  S    S+     0   0   51   92   32  AAAAAAATATT.TAATA..QA.A..AAA
   566  567 A E  E     - S   0 579G  50   98   58  HDHDDHHDHDADDHHAHASGHDHAAHHH
   567  568 A F  E     - S   0 578G   0   98    0  FFFFFFFFFFFFFFFFFFFFFFFFFFFF
   568  569 A G  E     -RS 558 577G   0   98   65  ACSCCSATSTTTTSSTATTIATATIAET
   569  570 A V  E     -RS 557 576G   0   98   31  LILVILVVLIIIILLIMIIIIIIIIIVL
   570  571 A T  E     - S   0 575G  47   97   67  MIVIIVVSVSQHSVMQVQSQGAVNQGVG
   571  572 A H  E >   - S   0 574G   7   98    0  HHHHHHHHHHHHHHHHHHHHHHHHHHHH
   572  573 A Y  T 3  S+     0   0   49   98    0  YYYYYYYYYYYYYYYYYYYYYYYYFYYY
   573  574 A A  T 3  S-     0   0   35   98    0  AAAAAAAAAAAAAAAAAAAAAAAAAAAA
   574  575 A G  E <   - S   0 571G  27   98    4  GGGGGGGGGGGGgGGGGGGGGGGGDGGG
   575  576 A Q  E     - S   0 570G  93   98   72  TKTKKTTKTEDNiTTDTDERNETDKNVN
   576  577 A V  E     - S   0 569G   1   98    0  VVVVVVVVVVVVVVVVVVVVVVVVVVVV
   577  578 A M  E     - S   0 568G  32   98   51  DDDDDDRTDQITTDDIDTTEPIRTEGPP
   578  579 A Y  E     -qS 463 567G   0   98    0  YYYYYYYYYYYYYYYYYYYYYYYYYYYY
   579  580 A E  E     - S   0 566G  28   98   55  NKNKKNNHNQQQQNNQNQQRNQNQQNSN
   580  581 A I    >   +     0   0    3   98   68  VAIAAIATISSTTIISISATIAAACIII
   581  582 A Q  T 3  S+     0   0  113   98   73  TDTDDSTDTDDDNTLDTDDDTDTDETVT
   582  583 A D  T 3> S+     0   0   75   98   61  GEGEEGNTGQHLTGGHGQLGGQSQGGGG
   583  584 A W  H <>  +     0   0    0   99    6  WWWWWWFFWFFFFWWFWFFWWFFFFWWW
   584  585 A L  H  > S+     0   0    7   99    0  LLLLLLLLLLLLLLLLLLLLLLLLLLLL
   585  586 A E  H  > S+     0   0  103   98   67  DMDMMDEDDDDDDDQDDDDEEEEDEEEE
   586  587 A K  H  < S+     0   0   46   99    0  KKKKKKKKKKKKKKKKKKKKKKKKKKKK
   587  588 A N  H  < S+     0   0    0   99    0  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
   588  589 A K  H  < S-     0   0   75   99   43  KMKMMKKRKKKIRKKKKKKKKKKKKKKK
   589  590 A D     <  -     0   0   50   99    0  DDDDDDDDDDDDDDDDDDDDDDDDDDDD
   590  591 A P        +     0   0   62   99   44  PPPPPPPYPYYYYPPYPYYPPFPYTPPP
   591  592 A L        -     0   0   38   99   18  LLLLLLLVLVVAVLLVLVVLLVLVVLLL
   592  593 A Q    >>  -     0   0   52   99   37  NNNNNNNVNVVVVNNVNVVNNVNVNNNN
   593  594 A Q  H 3> S+     0   0  143   99   40  DDEDDEDVEPANVEEADAADDPDAADED
   594  595 A D  H 34 S+     0   0   17   99   70  SNSNNSTESEEEETTESEENTETEETTT
   595  596 A L  H X> S+     0   0    0   99   44  VVVVVVAHVHHHHVVHVHHIVHAHQVVV
   596  597 A E  H 3X S+     0   0   47   99   67  VAVAAIVCLKQQCVVQVQQGVQVQIVVV
   597  598 A L  H 3< S+     0   0   86   99   74  QTQTTQANQDEINGGEQEVRDDAANDPD
   598  599 A C  H <4 S+     0   0    3   99   15  LLLLLLLLLLLLLLLLLLLVQLILVQIL
   599  600 A F  H >< S+     0   0    0   99   44  YLYLLYLLYLLLLYYLYLLMFLLLLFFF
   600  601 A K  T 3< S+     0   0   91   99   64  QHQNHQKSQSNNSQQNQNTAKTKNKKQK
   601  602 A D  T 3  S+     0   0  136   99   70  KQKQQKTSKAAASKKAKGASKAHSAKKK
   602  603 A S    <   -     0   0   10   99    9  SSSSSSHSSSSSSSSSSSSSSSASSGSG
   603  604 A S  S    S+     0   0   87   99   66  SSSTSSSKSERKKSARSKKNTNERKQQT
   604  605 A D  S  > S-     0   0   15   99   97  VDCDDVtCNCCCCLLCNCCENCgCFNNN
   605  606 A N  H  > S+     0   0  149   99   54  KRKKRKkPKPSSPKKSKSTPKPqPDKKK
   606  607 A V  H  > S+     0   0    8   99   42  LFLFFLLFLFFFFTLFLFFFLFLFLLLL
   607  608 A V  H >> S+     0   0    1   99   30  LVLIVLMVLVVVVLLVLVVILVIVLLLL
   608  609 A T  H >X S+     0   0   37   99   53  AAASASLSAASSAAASCSASIALAMVAC
   609  610 A K  H 3X S+     0   0   83   99   94  HELEEFDGSGVSGFLVYGGTEADNEETE
   610  611 A L  H << S+     0   0    0   99    7  LLLLLLILLLLLLLLLLLLLILILLILI
   611  612 A F  H << S+     0   0    0   99    9  YWYWWYWFYFFFFFFFYFFFFFWFFFYF
   612  613 A N  H  < S+     0   0   71   99   73  AKPRKSAPPPPPPSAPAPPAAPAPRAES
   613  614 A D    >X  -     0   0   16   99   66  SDPDDGDLASPPVGNPAPPDDPDPDDND
   614  615 A P  H 3> S+     0   0   78   99   85  HEAVEHYLVVACLAYAHALFHLYLEHYH
   615  616 A N  H 34 S+     0   0  146   99   74  AIPDINQPVPPESQAPATPVPPTPEPAP
   616  617 A I  H <4 S+     0   0   14   99   81  sqahqatEeEeEEtGEgEEdgetEkggg
   617  618 A A  H  < S+     0   0   15   90   73  kskgskg.k.s..k..k..vgvg.ggkg
   618  619 A S     <  -     0   0   80   92   57  GAGAAGKEG.S.EG..G..KGKG.RGEA
   619  620 A R        -     0   0   78   96   88  GYGFYGKSGEK.SG.EG.EKRPKEDKKK
   620  621 A A        -     0   0   59   98   41  KKKKKKKSKTSSSK.NKESRGSRTSRRR
   621  622 A K  E     -T  626   0H 151   98   65  KTKTTKGRKTSTRK.TKNSVKNGSSAKT
   622  623 A K  E >   -T  625   0H 126   98   23  KKKRKKKSKKSKSK.KKTKKKKKKSKKK
   623  624 A G  T 3  S+     0   0   72   98   69  GKGKKGSSGSISSG.SGKSKGSSQKGAG
   624  625 A A  T 3  S+     0   0   94   98   47  GGGGGSAYGSATYS.SGSSGGSSSESAS
   625  626 A N  E <  S-T  622   0H  72   98   81  SMSMMSSKSKTKKS.KSSKAGKSKHASA
   626  627 A F  E     -T  621   0H 126   98   24  FFMFFFFFMFRFFF.SFKFFFFFFKFFF
   627  628 A I        -     0   0   22   98   70  QRQRRQMSQSFSSQ.SQSSRSSMSKQQQ
   628  629 A T     >  -     0   0   17   98   22  TTTTTTTSTSKSST.STSSTTSTSTTTT
   629  630 A V  H  > S+     0   0   37   98    7  VVVVVVVVVIVIVV.IVIIVVIVIVVVV
   630  631 A A  H  > S+     0   0    3   98   44  SGSGGSSASGFGAS.ASAGASGSGGSSS
   631  632 A A  H  > S+     0   0   25   98   74  AQSQQAMASSLSSA.TATSQSVMTCSQA
   632  633 A Q  H  X S+     0   0   49   98   64  LLQLLLIRQRGSRL.RLRRGSRIRQLLM
   633  634 A Y  H  X S+     0   0   16   98   38  FYFYYFYFFFKFFF.FFFFHYFYFFYHY
   634  635 A K  H  X S+     0   0   46   98   30  RKRKKRRKRKTKKR.KRKKKRKRKRRKR
   635  636 A E  H  X S+     0   0  119   98   27  EEEEEEEQELMQQE.MEMLEELEQNEEE
   636  637 A Q  H  X S+     0   0   65   98   59  NSNQSNSQNQQQQN.QNQQRQQSQSQNQ
   637  638 A L  H  X S+     0   0    5   98    0  LLLLLLLLLLLLLL.LLLLLLLLLLLLL
   638  639 A A  H  X S+     0   0   50   98   70  GTGSTNNQGQHQQN.HAHQANQNQQNNN
   639  640 A S  H  X S+     0   0   75   98   42  KKKKKKNAKQESAK.EKESNNQNAMNKN
   640  641 A L  H  X S+     0   0    7   98    0  LLLLLLLLLLLLLL.LLLLLLLLLLLLL
   641  642 A M  H  X S+     0   0   31   98    0  MMMMMMMMMMMLMM.MMMMMMMMMMMMM
   642  643 A A  H  X S+     0   0   54   98   60  TATAASNETEEEET.ETEETAETEETTS
   643  644 A T  H >< S+     0   0   51   98   59  NTNTTNMTNTTTTN.TNTTTTTMTTTNT
   644  645 A L  H >< S+     0   0    0   98    0  LLLLLLLLLLLLLL.LLLLLLLLLLLLL
   645  646 A E  H 3< S+     0   0   86   98   49  RRRRRRYNRNSSNR.SRSSQRKYSNRRR
   646  647 A T  T << S+     0   0   90   98   56  SNSNNSQSSASASS.SSSSSASQTASAA
   647  648 A T  S <  S-     0   0    8   98    2  TTTTTTTTTTTITT.TTTTTTTTTTTTT
   648  649 A N  E     - i   0 172B  60   98   61  HNHNNHHEHDEEEH.EHEEQQDHETQQQ
   649  650 A P  E     - i   0 173B  22   98    0  PPPPPPPPPPPPPP.PPPPPPPPPPPPP
   650  651 A H  E     - i   0 174B  24   98   40  HNHNNHHHHYHHHH.HHHHHHLHHHHHH
   651  652 A F  E     - i   0 175B  11   98    2  FFFFFFFYFYYYYF.YFYYFFYFYYFFF
   652  653 A V  E     -gi 122 176B   0   98    9  VVVVVVIIVIIIIV.IVIIVVIIIVVVV
   653  654 A R  E     -gi 123 177B   1   98    0  RRRRRRRRRRRRRR.RRRRRRRRRRRRR
   654  655 A C  E     -g  124   0B   0   98    0  CCCCCCCCCCCCCC.CCCCCCCCCCCCC
   655  656 A I  E     -g  125   0B   1   98   24  LILIILIVLIVIVI.VLIVIIVIVIIII
   656  657 A I        -     0   0    6   98   37  IIIIIIIKIKKKKI.KIKKVIKIKKIVI
   657  658 A P        -     0   0    0   98    0  PPPPPPPPPPPPPP.PPPPPPPPPPPPP
   658  659 A N        -     0   0    0   98    0  NNNNNNNNNNNNNN.NNNNNNNNNNNNN
   659  660 A N  S    S+     0   0   99   98   55  EHEHHEESENSNSE.SESNGENEADEEE
   660  661 A K  S    S-     0   0  107   98   89  SESEETKLSFVVLT.VSVAFLLKVFLNL
   661  662 A Q        +     0   0   65   99   34  KKKKKKKNKLLLNKALKLLKKFKLKKKK
   662  663 A L        -     0   0   72   98   74  TRTKRTTRTRKKRTDKTKKKQQQKLQTQ
   663  664 A P  S    S+     0   0   53   96   37  PAPSAPSPPPPPPPSPPPPPPPSPAAPP
   664  665 A A  S    S+     0   0   77   96   24  GGGGGGGQGAAAQGGAGGCGGGGGFGGG
   665  666 A K        +     0   0   75   96   84  LKLKKALILVIIKAVILIIRVIMISLVL
   666  667 A L        -     0   0   33   96   33  MLMLLMIFMFFFFMMFMFFLIFIFFIMI
   667  668 A E     >  -     0   0   45   96   25  EDEDDDDEEEEEEEDEEEEDDEDEDDDD
   668  669 A D  H  > S+     0   0   60   96   68  NPNPPHSNNNNNNHNNNNNVSNSNPSAS
   669  670 A K  H  > S+     0   0   94   96   88  FHFHHYAAFQTSPEPTFTLPHAAFKHFH
   670  671 A V  H  > S+     0   0   18   96   42  LLLLLLLSLNNNSLLNLNNLLNLNRLLL
   671  672 A V  H  X S+     0   0    2   96    5  VVVVVVVVVIVVIVVVVVVVVVVVAVVV
   672  673 A L  H  X S+     0   0    0   96   20  ILILLMLIILLLLLMLILILMLLLVMLM
   673  674 A D  H  X S+     0   0   79   96   45  HDHDDHNHHQQQHHHQHQQDHHNNQHHH
   674  675 A Q  H  X S+     0   0    5   96    0  QQQQQQQQQQQQQQQQQQQQQQQQQQQQ
   675  676 A L  H  <>S+     0   0    2   96    0  LLLLLLLLLLLLLLLLLLLLLLLLLLLL
   676  677 A R  H ><5S+     0   0   60   96   23  RRRRRRTRRRRRRRRRRRRRTRTRRTRT
   677  678 A C  H 3<5S+     0   0   31   96    2  CCCCCCCCCCCCCCCCCCCCCCCCACCC
   678  679 A N  T 3<5S-     0   0   11   96   25  NNNNNNNGNGSGGNNSNSGNNGNGCNNN
   679  680 A G  T <>5 +     0   0    0   96    0  GGGGGGGGGGGGGGGGGGGGGGGGGGGG
   680  681 A V  H  >> S+     0   0    8   95    0  LLLLLLLLLLLLLLLLLLLLLLLLLLLL
   682  683 A E  H 3> S+     0   0   49   95    0  EEEEEEEEEEEEEEEEEEEEEEEEEEEE
   683  684 A G  H 3X S+     0   0    0   95   18  GGGGGGGAGAAAAGGAGAAGGAGATGGG
   684  685 A I  H   S+     0   0   56   93   79  GQGQQGDSGFHFSAGHGHYAPYPDQPAP
   699  700 A D  G >  S+     0   0   79   93   19  DEDEEDDEDEDEDDDDDDEEDEDEEDDD
   700  701 A F  G >> S+     0   0   12   93    0  FFFFFFFFFFFFFFFFFFFFFFFFFFFF
   701  702 A V  G <4 S+     0   0   23   93   59  KRKRRKKVKLLIVKRLKLLRKIRIFKRK
   702  703 A K  G <4 S-     0   0   90   93   34  QQQQQQHDQDHNDQQHQHLQLHHDSLQL
   703  704 A R  T <4 S+     0   0  115   93    0  RRRRRRRRRRRRRRRRRRRRRRRRRRRR
   704  705 A Y  S  < S+     0   0   21   90    1  YYYYYYYFYFFFFYYFYFFYYFYFYYYY
   705  706 A Y  S    S+     0   0   55   90   78  KEKEEKAGKGRGGKRRKCGEKGAGRKRM
   706  707 A L  S    S+     0   0   97   90   20  VIVIIVILVLIILVIIVVVLIIIMVIII
   707  708 A L  S    S+     0   0   26   90    1  LLLLLLLILLLLLLLLLLLLLLLLLLLL
   708  709 A A  S    S-     0   0   26   90   69  NTNTTNAANAAQANNANAATCAAAMCNA
   709  710 A P  S    S+     0   0  107   90   42  APAPPAAPAPPPLAPPAPPPAPAAKPPP
   710  711 A N  S    S+     0   0  148   90   64  snsnnsDEgEEKEsaEsEegnEDEqnsa
   711  712 A V        -     0   0   22   86   26  iiiiii.FiVIV.iiIiIlivV.L.iim
   712  713 A P        -     0   0   66   88   41  pPpPPpAMpLLL.ppLpLAPQLAV.KpA
   713  714 A R  S    S+     0   0  120   84   71  gKgKKgADgEKG.ggKgK.R.KA.d.d.
   714  715 A D        +     0   0  130   89   65  QGQGGQKGQGER.QQEQEGGEDKDVETA
   715  716 A A        -     0   0   44   90   54  FFFFFFASFSKSFFFKFKSYPCDSLPFE
   716  717 A E  S    S+     0   0  187   90   69  IMIMMIEYMYNHMIININYMCNPSAIVK
   717  718 A D        -     0   0   80   90    6  DDDDDDDDDDDDDDDDDDDDEDDDDTDE
   718  719 A S  S    S+     0   0   33   90   62  NGNGGSVDNEDEESSDNEDGPEQEKPSA
   719  720 A Q  S  > S+     0   0  101   90   22  KKKKKKKKKKKVRKRKKKKRQKKKKERK
   720  721 A K  T  4 S+     0   0  102   89   68  KQKQQKAAKLTA KKTKVVKKIKALKKE
   721  722 A A  T  > S+     0   0   19   88   25  AAAAAAAAAATA AGTASAAAAAATAAA
   722  723 A T  H >> S+     0   0    3   88   52  SCSCCSSTSCCT SACSCCCTCSCCTTA
   723  724 A D  H 3< S+     0   0   73   88   63  EEEMEEVEEKQK EEQEQQLQETAREER
   724  725 A A  H 3> S+     0   0   46   88   59  KRKLRKAKKKKM KKKKKMRIKGANKKK
   725  726 A V  H << S+     0   0    6   88   30  LMLMMLIILIVL LLVLIIMIIIIVILC
   726  727 A L  T  <>S+     0   0    5   88   32  LILIILTLLLLL LLLLLLVLLTCLLLL
   727  728 A K  T >45S+     0   0  115   87   72  GRGKRGd.GEDG AGDGDDDDAdDEESE
   728  729 A H  T 3<5S+     0   0  108   82   62  SASSASd.SKK. SSKS..AQ.d.KQSE
   729  730 A L  T 3 5S-     0   0   66   83   44  ILILLIGQIKI. ILII..LI.G.LTLI
   730  731 A N  T < 5 -     0   0  116   88   49  NEDEEDKKDGGK DDGDKKENKHKVGDG
   731  732 A I      < -     0   0   20   88   39  VLVLLVLLILLA IILVMKLLLLMELLL
   732  733 A D    >   -     0   0   81   87   27  DDNDDDKKD EN DDEDGGDEGTGDDDD
   733  734 A P  T 3  S+     0   0   61   85   83  SPHPPHDLH  L HSGHLLDSVDLQSHP
   734  735 A E  T 3  S+     0   0  141   86   65  TNDNNTEED  T TSYSQKSDSEKDESD
   735  736 A Q  S <  S+     0   0   32   86   81  QLELLQENE  G QQQQGGAQEEGKSQS
   736  737 A Y  E     -V  745   0I   2   86    8  YYYYYYFFY  Y YYVYYYYYVFYYFYY
   737  738 A R  E     -V  744   0I  87   86   43  KRKRRKKQR  Q RKNKQQRRQKQQRQR
   738  739 A F        +     0   0   86   85   47  FIFMIFILF    FFDFVMIMIVIFLFV
   739  740 A G        -     0   0    6   85    3  GGGGGGGGG    GGGGKGGGGGGGGGG
   740  741 A I  S    S+     0   0   93   85   63  HQHQQHNRH    HNVHNKTHKNKKKHH
   741  742 A T  S    S-     0   0   76   85   39  TSTSSTTTT    TTNTTTSTTTTTTTT
   742  743 A K  E    S-U  696   0I  20   85   10  KKKKKKKKK    KKCKSKKKKKKKKKK
   743  744 A I  E     -U  695   0I   0   83   11  VIVVIVVVV    V IVLVVVILVIVV 
   744  745 A F  E     -UV 694 737I   0   81    1  FFFFFFFFF    F LF FFFFFFFFF 
   745  746 A F  E     -UV 693 736I   3   81    6  FFFFFFFLF    F CF LFFLFLFFF 
   746  747 A R  S >  S-     0   0   66   81   30  KRKRRKKRK    K NK RKRRKRRRK 
   747  748 A A  T 3  S-     0   0   39   81   14  AAAAAAAAA    A DA AAAAAAAAA 
   748  749 A G  T 3> S+     0   0   27   80    1  GGGGGGGGG    G GG GGGGGGGGG 
   749  750 A Q  H <>  +     0   0    2   80   53  LVLVVLIQL    L QL QVVQIQQVL 
   750  751 A L  H  4 S+     0   0   49   80   10  LLLLLLLIL    L LL MLLILMVLL 
   751  752 A A  H >> S+     0   0   27   80   34  GAGAAGAGG    G EG AAGAAAAGG 
   752  753 A R  H 3X S+     0   0  130   80   90  THTHHVRIT    L TT EEQYREYQI 
   753  754 A I  H 3X S+     0   0   24   80    7  LLLLLLLLL    L RL LLMLLLLML 
   754  755 A E  H X> S+     0   0    8   79    6  EEEEEEEDE    E DE DEEDEDEEE 
   755  756 A E  H 3X S+     0   0   61   79   23  EEEEEEDSE    E HE AEESDAKEE 
   756  757 A A  H 3< S+     0   0   72   79   76  MEMEEMHRM    M LM RQLQLRLLL 
   757  758 A R  H X< S+     0   0   20   78    0  RRRRRRRRR    R  R RRRRRRRRR 
   758  759 A E  H 3< S+     0   0   32   78   16  DDDDDDDAD    D  D ADDSDAADD 
   759  760 A Q  T 3< S+     0   0  104   78   73  DLEMLDEEE    D  E EGEIEEDDQ 
   760  761 A R    <>  +     0   0   43   78   47  KKKKKKIVK    K  K VVRLIVKRR 
   761  762 A L  T  4  +     0   0  128   78   26  LILIILLLL    L  L LLLHLLLLL 
   762  763 A E  T  4 S-     0   0  155   72   61  ATATTA DA    A  A G GSSA SA 
   763  764 A S  T  4 S+     0   0   48   48   67   DTDD  NT       S N KDKN KK 
   764  765 A N  S  < S-     0   0   72   14   63     I              A IAIA IV 
   765  766 A E  S    S+     0   0  152   14   72     I              A VSLA VL 
   766  767 A P        +     0   0   59   14   90     I              K SKTR ST 
   767  768 A P        +     0   0   72   14   98     S              I WKGL WL 
   768  769 A M  S    S+     0   0  137   14   39     F              I MILI LL 
   769  770 A D  S    S+     0   0   87   14    8     Q              Q QQQQ QQ 
   770  771 A F  S    S+     0   0  173    1    0                              
   771  772 A D  S    S+     0   0  134    1    0                              
   772  773 A D  S    S-     0   0   53    1    0                              
   773  774 A D  S    S+     0   0  142    1    0                              
   774  775 A I        +     0   0  121    1    0                              
   775  776 A P              0   0   60    1    0                              
   776  777 A F              0   0  243    1    0                              
 SeqNo PDBNo   V   L   I   M   F   W   Y   G   A   P   S   T   C   H   R   K   Q   E   N   D  NOCC NDEL NINS ENTROPY RELENT WEIGHT
    1    2 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0     1    0    0   0.000      0  1.00
    2    3 A   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0     1    0    0   0.000      0  1.00
    3    4 A   0   0  20  80   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0     5    0    0   0.500     16  0.49
    4    5 A   0   0   0   0   0   0   0   0  80   0   0   0   0  20   0   0   0   0   0   0     5    0    0   0.500     16  0.09
    5    6 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  80   0   0  20     5    0    0   0.500     16  0.55
    6    7 A   0   0   0   0   0   0   0   0   0   0  44  22   0   0  11  11  11   0   0   0     9    0    0   1.427     47  0.16
    7    8 A   0   0   0   0   0   0   0   0   9   0   0  18   0   0   0   0   0   9   0  64    11    0    0   1.034     34  0.41
    8    9 A  18   0   0   0   0   0   0   0  64   0   9   0   0   0   0   0   0   0   0   9    11    0    0   1.034     34  0.33
    9   10 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  63   0  38    16    0    0   0.662     22  0.81
   10   11 A   0   0   0   0   0   0   6   0   0   0   0   0   0   0  25  69   0   0   0   0    16    0    0   0.777     25  0.38
   11   12 A   0   0   0   0  41   0  53   0   0   0   0   0   0   6   0   0   0   0   0   0    17    0    0   0.869     28  0.70
   12   13 A   0  94   0   0   0   0   0   0   0   0   0   0   0   0   0   6   0   0   0   0    18    0    0   0.215      7  0.72
   13   14 A   0   0   0   0  28   0  67   0   0   0   6   0   0   0   0   0   0   0   0   0    18    0    0   0.787     26  0.80
   14   15 A  61  11   0   0   0   0   0   0  22   0   0   6   0   0   0   0   0   0   0   0    18    0    0   1.040     34  0.41
   15   16 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  11   0  11   0  78    18    0    0   0.684     22  0.57
   16   17 A   6   0   0   0   0   0   0   6   0   0   6   0   0   0  67  17   0   0   0   0    18    0    0   1.051     35  0.35
   17   18 A   0   0   0   0   0   0   0   0  22   0   0   0   0   0   0   6   0   0  72   0    18    0    0   0.730     24  0.48
   18   19 A  17   6   0   0  28   0   6   0   0   0   0  28   0   0   6   0  11   0   0   0    18    0    0   1.736     57 -0.03
   19   20 A  28   0  50   6   6   0   6   6   0   0   0   0   0   0   0   0   0   0   0   0    18    0    0   1.345     44  0.46
   20   21 A   0   0   0   0   0   6  17   0   0   0   6   0   0   0   0   0   0   0  67   6    18    0    0   1.051     35  0.33
   21   22 A   0   0  11   0   0   0   0   0   0   0  11   0   0   0   0   0   0   0  50  28    18    0    0   1.191     39  0.28
   22   23 A   0   0   0   0   0   0   0   0   0  94   0   0   0   0   0   0   0   0   0   6    18    0    0   0.215      7  0.78
   23   24 A   0  61   0   6   0   0   0   0  28   0   0   0   0   0   0   0   0   0   0   6    18    0    0   0.978     32  0.30
   24   25 A   0   0   0   0   6   0   0   0  72   0   0  22   0   0   0   0   0   0   0   0    18    0    0   0.730     24  0.47
   25   26 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   6  89   6   0   0    18    0    0   0.426     14  0.69
   26   27 A   0   6   0   0   0   0   0   0  89   0   0   0   0   0   0   0   0   6   0   0    18    0    0   0.426     14  0.54
   27   28 A   0   0   0   0   0   0   0   0   0   0   0   6   0   0   0   0   0  11   0  83    18    0    0   0.557     18  0.68
   28   29 A   6   0   0   0   0  94   0   0   0   0   0   0   0   0   0   0   0   0   0   0    18    0    0   0.215      7  0.64
   29   30 A   6   0   0   0   0   0   0   0  50   0  11  28   0   0   0   6   0   0   0   0    18    0    0   1.268     42  0.30
   30   31 A   0   0   0   0   0   0   0   0  53   0   5  26   0   0   0   0   5   5   0   5    19    0    0   1.309     43  0.32
   31   32 A   0   0   0   0   0   0   0   0   5   0   0   0   0   0   5  89   0   0   0   0    19    0    0   0.409     13  0.73
   32   33 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0  15  80   0   5   0   0    20    0    0   0.613     20  0.70
   33   34 A   0  85   0   0   0   5   5   0   0   0   0   0   0   0   5   0   0   0   0   0    20    0    0   0.588     19  0.56
   34   35 A  95   0   5   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    22    0    0   0.185      6  0.96
   35   36 A   0   0   0   0   0  96   0   0   0   0   0   0   0   0   0   4   0   0   0   0    24    1    0   0.173      5  0.88
   36   37 A  65   0  17   0   0   0   4   0   4   0   0   4   0   0   0   0   0   0   0   4    23    0    0   1.128     37  0.49
   37   38 A   0   0   0   0   0   0   4   0   0  78   0   0   0   0   0   0   0  13   4   0    23    0    0   0.730     24  0.39
   38   39 A   0   0   0   0   0   0   0   0   0   4  61   0   0   4   0   4   0   0   0  26    23    0    0   1.062     35  0.32
   39   40 A   4   0   0   0   0   0   0   0   4  13   0   0   0   0   0   0   0  67   4   8    24    0    0   1.135     37  0.44
   40   41 A   0   0   0   0   0   0   0   4   0   8   0   0   0   0  17  46   4   8   4   8    24    0    0   1.675     55  0.31
   41   42 A   4  25   0   0   0   0   0   0   0   0   8   0   0  17   0   4   8   8  13  13    24    0    0   2.051     68  0.14
   42   43 A   0   0   0   0   0   0   0  65  15   0   4   0   0   0   0   0   0  15   0   0    26   17    1   0.979     32  0.57
   43   44 A   0   0   0   0  30  20   0   0   0   0   0   0   0   0  20  20   0   0  10   0    10    0    0   1.557     51  0.36
   44   45 A   8   8   0   0   0   0   0   0   0   0   0   0   0   0   0   8  25  33   8   8    12    0    0   1.748     58  0.28
   45   46 A   7   0   0   0   0   7   7  40  20   7   7   0   0   0   0   0   0   0   0   7    15    1    0   1.772     59  0.16
   46   47 A   3   0   0   0  68   3  10   3   6   0   0   3   0   0   0   3   0   0   0   0    31    0    0   1.221     40  0.44
   47   48 A  13   0  10   0   0   0   0   0   0   0   6   0   0   0   0   0   0  68   0   3    31    0    0   1.042     34  0.40
   48   49 A   3   3   3   0   0   0   0   3  72   0   3   0   3   0   0   0   0   3   3   3    32    0    0   1.212     40  0.49
   49   50 A   6   3   6   0   0   0   0  24  48   0   0   3   0   0   0   6   0   3   0   0    33    0    0   1.522     50  0.33
   50   51 A   6   0   0   0   0   0   0   0   0   0  61   3   0   0   0   3   3  21   3   0    33    0    0   1.226     40  0.30
   51   52 A  11   6  69   0   0   0   0   0   0   0   0   0   0   0   0   3   3   6   0   3    35    0    0   1.138     38  0.56
   52   53 A  11   0   0   3   0   0   0   0   0   0   3   6   0   3   6  63   3   3   0   0    35    0    0   1.375     45  0.34
   53   54 A   0   3   3   0   0   0   0  11   5   0  11   0   0   0   5   3   0  57   0   3    37    0    0   1.508     50  0.34
   54   55 A   5   0   3   0   0   0   0   0   3   0   3   8   0   0   8   3   3  63   0   3    38    0    0   1.420     47  0.32
   55   56 A   5   0   0   0   0   0   0   2   0   0   2  15   0  10  20  15   2  20   2   7    41    1    0   2.128     71  0.23
   56   57 A   0   0   0   0   0   0   0  83   4   0  10   0   0   0   2   0   0   2   0   0    52    0    0   0.660     22  0.77
   57   58 A   0   0   4   0   0   0   0  26   0   0   0   0   0   0   0   2   0   4   0  64    53    0    0   0.959     32  0.64
   58   59 A   7   0   0   2   0   0   0   0   0   0   2   2   0   0   2  34   5  43   0   4    56    0    0   1.482     49  0.32
   59   60 A  70   5   3   0   2   0   0   0   7   0   0   0  10   0   0   0   0   3   0   0    60    0    0   1.105     36  0.57
   60   61 A   7  15   4   6   0   0   0   0   0   0   1  58   0   1   0   1   0   4   0   0    67    0    0   1.427     47  0.30
   61   62 A  85   0   1   1   1   0   0   0   9   0   0   0   0   1   0   0   0   0   0   0    68    0    0   0.598     19  0.76
   62   63 A   9   1   1   0   0   0   0   0   1   0   0   1   0   0   0  28   4  48   0   6    69    0    0   1.467     48  0.36
   63   64 A   1  36   0   0   0   0   0   0   1   0   3  52   0   0   0   3   0   0   3   0    69    0    0   1.138     37  0.29
   64   65 A   7   9   0   0   0   0   0   4  25   0   4   6   0   6   0   3   1  28   1   6    69    0    0   2.096     69  0.20
   65   66 A   0   0   0   0   1   0   6   9   6   1   7   4   1   0   1   9   0  19   3  32    69    0    0   2.108     70  0.29
   66   67 A   0   0   0   1   0   0   0  50   0   0   9   7   0   0   0   8   1   1  20   1    74    6   25   1.512     50  0.40
   67   68 A   0   0   0   0   0   0   0   0   6   0   3   4   0   0   3  59   9  13   4   0    70    0    0   1.424     47  0.49
   68   69 A   1   0   1   0   0   0   0   0   0   0   3  48   0   0   4  27   1  13   0   1    75    0    0   1.429     47  0.29
   69   70 A  42  24   8   0   0   0   0   0  10   0   0   0   0   0   8   8   0   0   0   0    78    0    0   1.533     51  0.37
   70   71 A   9   0   0   8   0   0   0   0   0   1   1  64   0   0   3  12   1   0   0   1    78    0    0   1.265     42  0.41
   71   72 A  77   5   5   1   6   0   0   0   5   0   0   0   0   0   0   0   0   0   0   0    80    0    0   0.875     29  0.73
   72   73 A   0   2   0   0   0   0   0   4   0   2   4   1   0   0   4  61   0   0  22   0    82    0    0   1.232     41  0.41
   73   74 A   0   2   1   0   0   0   0   1   1   0   1   1   0   0   4  37   1  43   0   6    83    0    0   1.429     47  0.34
   74   75 A   0   0   0   0   0   0   1   1   4   0   1   1   7   0   0   0   0   4   1  80    84    0    0   0.871     29  0.64
   75   76 A   0   2   0   0   0   0   0   0   0   0   6   0   0   0   0   2  24  15   1  49    85    0    0   1.371     45  0.52
   76   77 A  29   6  56   0   0   0   0   0   5   1   0   3   0   0   0   0   0   0   0   0    86    0    0   1.162     38  0.65
   77   78 A   0   0   0   3  26   0  10   0   0   0   2   0   0  13   0   0  42   1   1   1    86    0    0   1.572     52  0.12
   78   79 A   0   1   0   0   0   0   0   0   0  40   9   0   0   0   0  30  17   2   0   0    86    0    0   1.393     46  0.29
   79   80 A   5   0   0  74   0   0   0   0   0   0   0   0   0   0   5   3  13   0   0   0    86    0    0   0.885     29  0.59
   80   81 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  97   3    89    0    0   0.147      4  0.94
   81   82 A   0   0   0   0   0   0   0   0   0  97   0   2   0   0   0   0   0   1   0   0    89    0    0   0.169      5  0.91
   82   83 A   0   0   1   0   0   0   0   0   1  92   0   1   0   0   0   0   0   2   0   2    89    0    0   0.397     13  0.80
   83   84 A   1   0   1   0   0   0   0   0   1   0   0   1   0   0   1  94   0   0   0   0    89    0    0   0.307     10  0.84
   84   85 A   0   1   0   0  69   0  26   0   0   3   0   0   0   0   0   0   0   0   0   0    91    0    0   0.768     25  0.81
   85   86 A   1   0   0   1   2   0   0   0   2   2  24   0   0   0   0   0   0   7   0  61    92    0    0   1.170     39  0.38
   86   87 A   0   3   0   4   0   0   0   3   1   0   0   0   0   0   1  86   0   0   0   1    92    0    3   0.638     21  0.67
   87   88 A  33   1  51   4   0   0   0   0   4   0   0   3   2   0   0   0   0   1   0   0    92    0    0   1.274     42  0.60
   88   89 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  91   1   7    94    0    0   0.323     10  0.91
   89   90 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100    95    0    0   0.000      0  1.00
   90   91 A   0   1   1  98   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.114      3  0.98
   91   92 A   1   0   0   0   0   0   0   0  81   0   8  10   0   0   0   0   0   0   0   0    98    0    0   0.658     21  0.68
   92   93 A   0   0   0  49   0   0   0   0   2   0   0   0   0   0   4   5   0  27  12   1    98    0    0   1.367     45  0.16
   93   94 A   0  54   0  39   7   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.888     29  0.90
   94   95 A   0   0   0   0   0   0   0   0   5   0   8  87   0   0   0   0   0   0   0   0    98    0    0   0.480     16  0.74
   95   96 A   0   0   0   0  16   0  18   0   0   0   0   0  24  41   0   0   0   0   0   0    98    0    0   1.317     43  0.33
   96   97 A   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
   97   98 A   0   0   0   0   0   0   0   0   0   0   1   0   0  34   0   0   0   0  64   1    99    0    0   0.748     24  0.66
   98   99 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  93   0   7    99    0    0   0.255      8  0.95
   99  100 A   0   0   0   0   0   0   0   1  47  52   0   0   0   0   0   0   0   0   0   0    99    0    0   0.742     24  0.62
  100  101 A   0   0   0   0   0   0   0  14  29   0  55   0   2   0   0   0   0   0   0   0    99    0    0   1.046     34  0.57
  101  102 A 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  102  103 A   2  96   0   0   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.197      6  0.97
  103  104 A   0   0   0   0  14   0  35   0   2   0   2   0   0  37   0   0   2   2   1   4    99    0    0   1.503     50  0.28
  104  105 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0    99    0    0   0.000      0  1.00
  105  106 A   0  97   2   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.155      5  0.98
  106  107 A   0   0   0   0   0   0   0   0   6   0   0   0   0   0  23  69   1   1   0   0    99    0    0   0.860     28  0.62
  107  108 A   5   1   0   0   0   0   0   0   2   0   3   3   1   0   3   1   8  64   0   9    99    0    0   1.396     46  0.44
  108  109 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0    99    0    0   0.000      0  1.00
  109  110 A   0   0   0   0   1   0  98   0   0   0   0   0   1   0   0   0   0   0   0   0    99    0    0   0.113      3  0.99
  110  111 A   0   0   1   0   5   0  26   2  53   0   3   2   0   0   0   1   2   3   2   0    99    0    0   1.460     48  0.17
  111  112 A   0   6   1   0   0   0   0   0  48   0  30   0   0   2   2   4   1   0   3   2    99    0    0   1.448     48  0.27
  112  113 A   0   0   0   3   0  48   0  29   0   0   1   0   0   0   0   3   2   0  11   2    99    0    1   1.371     45 -0.07
  113  114 A   0  36   3  53   0   0   1   0   1   0   0   0   0   0   0   0   0   4   0   2    99    0    0   1.113     37  0.65
  114  115 A   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  115  116 A   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  116  117 A   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  117  118 A   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  118  119 A   0   0   0   0   0   0   0   0   0   1  88  10   1   0   0   0   0   0   0   0    99    1    0   0.438     14  0.75
  119  120 A   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.000      0  1.00
  120  121 A   0  89   1   0   0   0   0   0   0   0   3   0   0   0   0   0   0   0   7   0    99    0    0   0.444     14  0.63
  121  122 A   2   0  10   0  88   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.424     14  0.82
  122  123 A   0  14   0   0   0   0   0   0   0   0   0   0  86   0   0   0   0   0   0   0    99    0    0   0.408     13  0.45
  123  124 A  77   0  12   0   0   0   0   0  11   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.703     23  0.77
  124  125 A  31   0   0   0   0   0   0   0  19   0   1  48   0   0   0   0   0   0   0   0    99    0    0   1.078     35  0.36
  125  126 A  66   0  34   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.643     21  0.86
  126  127 A   0   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  98   1    99    0    0   0.113      3  0.97
  127  128 A   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  128  129 A   0   0   0   0  11   0  89   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.349     11  0.98
  129  130 A   0   0   0   0   0   0   0   0   1   0   0   4   0   0   6  82   6   1   0   0    99    0    0   0.726     24  0.69
  130  131 A   0   0   0   4   0  45   4   0   1   1   1   0   0   2  21   5   1   0  14   0    99    0    0   1.638     54  0.37
  131  132 A   0  94   1   0   4   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.281      9  0.95
  132  133 A   0   0   0   0   0   0   0   0   0  99   1   0   0   0   0   0   0   0   0   0    99    0   10   0.056      1  0.98
  133  134 A  52  10  38   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.941     31  0.75
  134  135 A   3   0   0   0   0   0  97   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.136      4  0.91
  135  136 A   0   0   0   0   0   0   0   2   0   0  20  20   0   0   0   4   0   0  23  30    99    0    0   1.556     51  0.34
  136  137 A   4   1   0   0   0   0   0   0  18  20  11   6   0   2   1   0   3  28   3   2    99    0    0   1.996     66  0.23
  137  138 A   8   1   1   0   0   0   0   0   2   1   9   0   0   7   3  10   5  43   7   2    99    0    0   1.943     64  0.29
  138  139 A  56   0  28   7   0   0   1   0   0   0   0   3   4   0   0   0   0   0   0   1    99    0    0   1.199     40  0.60
  139  140 A  67   0  16  12   0   0   0   0   4   0   0   0   1   0   0   0   0   0   0   0    99    0    0   0.997     33  0.66
  140  141 A   1   8   0   1   0   0   0   4  23   0   5   6   0   0   0  11   2  30   4   4    99    0    0   2.030     67  0.25
  141  142 A   0   4   2  25   1   0   0  11  38   0   0   0   0   1   3   7   6   1   0   0    99    0    0   1.770     59  0.16
  142  143 A   0   0   0   0   1   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.056      1  1.00
  143  144 A   0   0   0   2   0   0   0   0   0   0   1   0   0   0  59  35   3   0   0   0    99    0    0   0.912     30  0.65
  144  145 A   0   0   0   0   0   0   0  99   0   0   1   0   0   0   0   0   0   0   0   0    99    0    0   0.056      1  0.99
  145  146 A   0   0   3   0   0   0   0   0   9   0   0   0   0   0   4  83   1   0   0   0    99    0    0   0.656     21  0.62
  146  147 A   0   0   0   0   0   0   0   0   3   2   2   0   0   0  18  70   0   1   4   0    99    0    0   1.001     33  0.58
  147  148 A   0   4   0   1   6   0   0   0   0   0   0   0   0   0  88   1   0   0   0   0    99    0    0   0.506     16  0.61
  148  149 A   3   0   8   9   0   0   0  13   1   0   8   6   0  24   0   0  17   1   8   1    99    0    0   2.156     71  0.12
  149  150 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1   0  92   0   7    99    0    0   0.311     10  0.92
  150  151 A  10  10   1  28   0   0   0   0  48   0   0   1   0   0   0   0   0   0   1   0    99    0    0   1.311     43  0.31
  151  152 A   0   0   0   0   0   0   0   1   2  86   6   0   0   0   0   1   0   0   0   4    99    0    0   0.602     20  0.70
  152  153 A   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  153  154 A   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  154  155 A  10   8  81   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0    99    0    0   0.653     21  0.83
  155  156 A   0   0   0   0  75   0  24   0   0   0   1   0   0   0   0   0   0   0   0   0    99    0    0   0.608     20  0.95
  156  157 A   0   0   0   0   0   0   0   0  47   0  53   0   0   0   0   0   0   0   0   0    99    0    0   0.692     23  0.56
  157  158 A  15   2  80   1   0   0   0   0   0   0   0   2   0   0   0   0   0   0   0   0    99    0    0   0.670     22  0.86
  158  159 A   0   0   0   0   0   0   0   0  27   0  58  15   0   0   0   0   0   0   0   0    99    0    0   0.958     31  0.49
  159  160 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   7   0  93    99    0    0   0.255      8  0.95
  160  161 A   5   0   0   0   0   0   0   3   5   0   7  15   0   0   2   0   0   6  57   0    99    0    0   1.452     48  0.31
  161  162 A   0   0   0   0   0   0   0   0  91   0   7   1   1   0   0   0   0   0   0   0    99    0    0   0.367     12  0.84
  162  163 A   0   0   0   0   3   1  96   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.192      6  0.99
  163  164 A   4   0   0   0   0   0   0   0   0   0   1   0   0   2  42   1  46   0   3   0    99    0    0   1.127     37  0.42
  164  165 A   0   1   0   0  31   0   9   0  10   0  17   0   5   0   0   0   4   1  18   3    99    0    0   1.905     63  0.04
  165  166 A   0   2   0  98   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.099      3  0.99
  166  167 A   6  66   7  15   0   0   0   1   1   0   0   1   0   1   0   0   2   0   0   0    99    0    0   1.184     39  0.69
  167  168 A   2   0   0   0   0   0   1   2   1   0   8  39   0   0   4   0  29   2   9   2    99    0    0   1.686     56  0.21
  168  169 A   0   0   0   0   0   0   0   0   0   0   0   1   0   0   1   0   0  13   6  79    99    0    0   0.717     23  0.80
  169  170 A   0   0   1   0   0   0   0   7   0   0   1   0   0   3  82   3   1   2   0   0    99    1    0   0.781     26  0.60
  170  171 A   0   0   1   0   0   0   0   1   0   0   1   1   0   0   1   7   2  83   0   3    98    0    0   0.766     25  0.69
  171  172 A   0   0   0   0   0   0   0   1   0   0  10   0   0   0   0   0   0   0  65  24    99    0    0   0.904     30  0.56
  172  173 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  93   0   7   0    99    0    0   0.255      8  0.86
  173  174 A   0   0   0   0   0   0   0   0   1   0  98   0   0   0   0   1   0   0   0   0    99    0    0   0.113      3  0.96
  174  175 A  25   1  64   9   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1    99    0    0   0.946     31  0.77
  175  176 A   0  98   1   0   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.113      3  0.97
  176  177 A  12   0  63   0   0   0   0   1   0   0   0   0  24   0   0   0   0   0   0   0    99    0    0   0.939     31  0.52
  177  178 A   0   0   0   0   0   0   0   0   0   0  11  88   0   0   0   1   0   0   0   0    99    0    0   0.404     13  0.74
  178  179 A   0   0   0   0   0   0   1  99   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.056      1  0.97
  179  180 A   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0  99   0   0    99    0    0   0.056      1  0.98
  180  181 A   0   0   0   0   0   0   0   0   1   0  99   0   0   0   0   0   0   0   0   0    99    0    0   0.056      1  0.98
  181  182 A   0   0   0   0   0   0   0  99   0   0   1   0   0   0   0   0   0   0   0   0    99    0    0   0.056      1  0.99
  182  183 A   1   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.056      1  0.98
  183  184 A   0   0   0   0   0   0   1  99   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.056      1  0.97
  184  185 A   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0  99   0   0   0   0    99    0    0   0.056      1  0.98
  185  186 A   0   0   0   0   0   0   0   0   1   0   0  99   0   0   0   0   0   0   0   0    99    0    0   0.056      1  0.98
  186  187 A  48   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0  51   0   0    99    0    0   0.742     24  0.31
  187  188 A   0   0   0   0   0   0   0   0   0   0   3   9   0   0   0   0   0   0  88   0    99    0    0   0.437     14  0.73
  188  189 A   0   0   0   0   0   0   0   0   1   0   0  98   0   0   0   0   0   0   1   0    99    0    0   0.113      3  0.96
  189  190 A   0   0   0   0   0   0   0   0   0   0   0   0   1   0   0  99   0   0   0   0    99    0    0   0.056      1  0.97
  190  191 A   0   5   0   5   0   0   1   0   0   0   0   0   0   0  47  40   0   1   0   0    99    0    0   1.114     37  0.45
  191  192 A  87   8   2   0   0   0   0   0   3   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.510     17  0.82
  192  193 A   0   1  88  11   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.404     13  0.81
  193  194 A   0   0   0   1   0   0   0   1   4   0   6   1   0   0   7   0  80   0   0   0    99    0    0   0.806     26  0.61
  194  195 A   0   0   1   0   3   0  96   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.192      6  0.97
  195  196 A   1  37   0   0  61   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0    99    0    0   0.764     25  0.84
  196  197 A   0   0   0   0   0   0   0   0  97   0   1   2   0   0   0   0   0   0   0   0    99    0    0   0.155      5  0.94
  197  198 A   6   1   3   3   9   0  10   0   1   1  11  42   0   9   0   0   2   0   1   0    99    0    0   1.922     64  0.11
  198  199 A  55   6  36   2   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0    99    0    0   0.994     33  0.76
  199  200 A   0   0   0   0   0   0   0  21  76   1   2   0   0   0   0   0   0   0   0   0    99    0    0   0.664     22  0.74
  200  201 A  14   0   0   1   1   0   0  13  45   0  19   5   0   0   0   0   0   0   1   0    99    0    0   1.508     50  0.38
  201  202 A   7   5   8   6   0   0   0   1   6   0  40  10   0   1   9   1   4   1   0   0    99    0   50   2.012     67  0.18
  202  203 A   0   0   0   0   0   0   0  69   5   2  10   7   0   2   0   0   1   0   1   3    99    6   87   1.184     39  0.61
  203  204 A   1   0   1   0   0   0   0   0   6   2   4   4   0   0   1  59   4  10   0   6    93    0    0   1.525     50  0.42
  204  205 A   0   0   0   0   0   0   0   2   4   4   3   3   0   1   0   1   8  44   1  28    99   18   78   1.610     53  0.53
  205  206 A   1   6   0   0   2   0   0   2   5   1  10   5   0   0   1  51   0  10   5   0    81    0    0   1.765     58  0.23
  206  207 A   1   4  13  32   1   0   0   1   2   2  10   2   0   2   0  20   2   0   6   0    82    0    0   2.085     69  0.15
  207  208 A   0   2   3   0   0   0   2   7   1   4   2   4   0   6   0  26  40   0   0   2    90    0    0   1.835     61  0.23
  208  209 A   0   0   0   0   0   0   0  90   3   0   2   0   0   0   1   1   1   1   0   1    98    1   11   0.517     17  0.83
  209  210 A   1   1   0   0   0   0   0   0   0   0  22  45   0   0   0   0   0  24   6   0    98    0    0   1.304     43  0.35
  210  211 A  11  89   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.349     11  0.86
  211  212 A   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0   0   1  98   0   0    99    0    0   0.113      3  0.96
  212  213 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0  10  13  13   4   0  60    99    0    0   1.203     40  0.47
  213  214 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1  99   0   0   0    99    0    0   0.056      1  0.98
  214  215 A  14  24  62   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.919     30  0.72
  215  216 A  19  38  42   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   1.048     34  0.68
  216  217 A   0   0   0   0   0   0   0   0  17   0  13   0   0   0   1   0  57  12   0   0    99    0    0   1.194     39  0.46
  217  218 A   0   0   0   0   0   0   0   0  78   0  11   9   2   0   0   0   0   0   0   0    99    0    0   0.736     24  0.64
  218  219 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0    99    0    0   0.000      0  1.00
  219  220 A   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  220  221 A  20  38  28   0   0   0   0   0  13   0   0   0   0   0   0   0   0   0   0   0    99    0    0   1.314     43  0.53
  221  222 A   0  96   0   4   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.169      5  0.99
  222  223 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0    99    0    0   0.000      0  1.00
  223  224 A   0   0   0   0   0   0   0   0  95   0   5   0   0   0   0   0   0   0   0   0    99    0    0   0.200      6  0.92
  224  225 A   0   0   1   0  77   0  22   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.584     19  0.96
  225  226 A   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0    99    0    1   0.000      0  1.00
  226  227 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0    99    0    0   0.000      0  1.00
  227  228 A   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  228  229 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   2  95   3   0   0   0    99    0    0   0.234      7  0.92
  229  230 A   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  230  231 A  78   3  11   0   0   0   0   0   1   0   1   5   0   0   0   0   0   0   1   0    99    0    0   0.836     27  0.76
  231  232 A   0   0   0   0   0   0   1   0   0   0   0   0   0   0  74  25   0   0   0   0    99    0    0   0.619     20  0.74
  232  233 A   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0  99   0    99    0    0   0.056      1  0.97
  233  234 A   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0  21  78    99    0    0   0.571     19  0.75
  234  235 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0    99    0    1   0.000      0  1.00
  235  236 A   0   0   0   0   0   0   0   0   0   1  98   0   0   0   0   1   0   0   0   0    99    0    0   0.113      3  0.96
  236  237 A   0   0   0   0   0   0   0   0   0   0  99   0   0   1   0   0   0   0   0   0    99    0    0   0.056      1  0.97
  237  238 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0    99    0    0   0.000      0  1.00
  238  239 A   0   1   0   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.056      1  1.00
  239  240 A   0   0   0   0   0   0   0  99   0   0   1   0   0   0   0   0   0   0   0   0    99    1    0   0.056      1  0.99
  240  241 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0    98    0    0   0.000      0  1.00
  241  242 A   0   0   0   0  99   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.057      1  1.00
  242  243 A  12   0  88   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.372     12  0.92
  243  244 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0  88   0   0  12   0   0    98    0    0   0.372     12  0.68
  244  245 A   1   2  95   0   0   0   0   0   0   0   0   2   0   0   0   0   0   0   0   0    98    0    0   0.255      8  0.93
  245  246 A   0   0   0   0   0   0   0   1   1   0   0   0   0  61   0   0  11   1  24   0    98    0    0   1.031     34  0.52
  246  247 A   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.000      0  1.00
  247  248 A   0   0   0   0   0   0   0  56   1   0   3   1   0   0   0   0   0   0   2  37    98    0    0   0.972     32  0.61
  248  249 A  28   1   0   0   0   0   0   3  17   5   8  26   0   1   1   7   0   0   2   1    98    0    0   1.926     64  0.21
  249  250 A   0   0   0   0   0   0   1   0   4   0  22  47   0   3   2   1   2   0  16   1    98    0    0   1.523     50  0.34
  250  251 A   0   0   0   0   0   0   1  99   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.057      1  0.96
  251  252 A   0   0   0   0   3   0  22   0   0   0   1   0   0   0   5  67   1   0   0   0    98    0    0   0.954     31  0.26
  252  253 A   0  55  45   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.688     22  0.71
  253  254 A  22   0   1   0   0   0   0   0  57   0  19   0   0   0   0   0   0   0   0   0    98    0    0   1.020     34  0.39
  254  255 A   0   0   0   0   0   0   0  52   0   0  47   0   0   0   0   1   0   0   0   0    98    0    0   0.742     24  0.63
  255  256 A   0   0   0   0   0   0   0   2  97   0   1   0   0   0   0   0   0   0   0   0    98    0    0   0.156      5  0.96
  256  257 A   0   0   0   0   0   0   1   0  10   0   2   0   0   0   0   0   0   0  26  61    98    0    0   1.008     33  0.50
  257  258 A   2   0  97   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.156      5  0.97
  258  259 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0  11   0   1  84   0   4    98    0    0   0.572     19  0.66
  259  260 A   0   0   2   0   0   2   1   0   0   0   4  86   0   4   0   0   1   0   0   0    98    0    1   0.646     21  0.70
  260  261 A   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   0   0   1    98    0    0   0.057      1  0.97
  261  262 A   0  99   0   0   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0   0    98    0    0   0.057      1  0.98
  262  263 A   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.000      0  1.00
  263  264 A   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0  99   0   0    98    0    0   0.057      1  0.99
  264  265 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0  10  89   0   0   1   0    98    0    0   0.385     12  0.86
  265  266 A   0   0   0   0   0   0   0   0   3   0  97   0   0   0   0   0   0   0   0   0    98    0    0   0.137      4  0.95
  266  267 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0    98    0    0   0.000      0  1.00
  267  268 A  74   0   0   0   0   0   0   1  22   0   0   0   2   0   0   0   0   0   0   0    98    0    0   0.681     22  0.59
  268  269 A  15   0  33   0   0   0   0   0   0   0   2  42   8   0   0   0   0   0   0   0    98    0    0   1.301     43  0.37
  269  270 A   0   0   0   0  43   0   9   0   0   0   7   1   0   1  27   1  10   1   0   0    98    0    0   1.543     51  0.00
  270  271 A   1   1   7   0   0   0   0   1   0   0   0   2   1   0   1   0  86   0   0   0    98    0    0   0.634     21  0.60
  271  272 A   0  45   0   2   0   0   0   0  29   0   9   3   0   0   0   0   9   0   3   0    98    0    0   1.449     48  0.14
  272  273 A   0   0   0   0   0   0   0   0   1  16  20   0   1   0   4  46   0   2   1   8    98    0    0   1.532     51  0.35
  273  274 A   0   4   1   0   0   0   0  11  34  10   4   3   0   1   0   0   1   4   0  26    99    2    2   1.828     61  0.30
  274  275 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0    97    0    0   0.000      0  1.00
  275  276 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0    97    0    0   0.000      0  1.00
  276  277 A   0   0   0   0   0   0   0   8   6   0  34  19   3   0   0   0   0   0  23   7    97    0    0   1.691     56  0.32
  277  278 A   0   0   0   0  26   0  74   0   0   0   0   0   0   0   0   0   0   0   0   0    97    0    0   0.571     19  0.97
  278  279 A   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0    97    0    0   0.000      0  1.00
  279  280 A   6   0  84   0   0   0   0   0   0   0   0   0  10   0   0   0   0   0   0   0    97    0    0   0.557     18  0.72
  280  281 A   0   0   0   0  97   0   3   0   0   0   0   0   0   0   0   0   0   0   0   0    97    0    0   0.138      4  1.00
  281  282 A   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0    97    0    0   0.000      0  1.00
  282  283 A   0   3   0   3   4   1  16   0   0   0   0   0   0   0   0   0  72   0   0   0    97    0    0   0.926     30  0.31
  283  284 A   2  49  33  15   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    97    0    0   1.083     36  0.74
  284  285 A   1  38   6  35   0   0   1   0   0   0   0   6  12   0   0   0   0   0   0   0    97    0    0   1.432     47  0.38
  285  286 A   0   0   1   0   0   0   0   0  15   0  57  24   0   0   1   0   1   1   0   0    97    0    0   1.140     38  0.49
  286  287 A   0   0   0   0   1   0   0  47  10   0   2   1   0   0   0   0   7   0  31   0    97    0    0   1.315     43  0.44
  287  288 A   0   0   0   0   1   0   1   3  33   8   3   0   0  16   0  32   1   1   0   0    97    0    0   1.637     54  0.20
  288  289 A   5   0   1   2   1   0   0  20   1   1   5   3   0   1   6  51   0   0   1   2    97    0    0   1.693     56  0.24
  289  290 A   0   1   0   0   0   0   0   0   3  55   3   1   0   1   0   2   0  21   1  12    97    0    0   1.398     46  0.33
  290  291 A   0   1   0   0   0   0   0   4   6   1   2   0   0  11   0  14   2  49   0   8    97    0    0   1.638     54  0.39
  291  292 A   3  68   7   7   0   1   5   0   0   0   0   0   1   0   1   0   2   4   0   0    97    0    0   1.255     41  0.55
  292  293 A   3  18  25   0   1   0   0   0   1   0   0   1   0   3  16  24   4   3   0   1    97    0    0   1.932     64  0.11
  293  294 A   0   0   0   0   0   0   2   1   0   0  13   3   0   0   2   9   0  48   4  16    97    0    0   1.584     52  0.37
  294  295 A   0   2   0  41   1   0   7   0   9   0   1   0   0   0   0  13   0   9   1  14    97    0    0   1.766     58  0.09
  295  296 A   0  73   0   2   3   0   2   0   0   0   1   6   5   0   1   6   0   0   0   0    97    0    0   1.087     36  0.48
  296  297 A   1  84   2   2   1   0   0   1   0   0   0   0   4   1   1   2   0   0   0   1    97    0    0   0.805     26  0.65
  297  298 A   9  39  40   0   0   0   0   6   0   0   0   0   0   2   0   0   2   0   0   1    97    0    0   1.333     44  0.42
  298  299 A   1   0   0   0   0   0   0   2   1   2   9  47   0   1   0   0   3  24   2   7    97   35    1   1.594     53  0.31
  299  300 A   0   0   0   3   0   0   0   5   2   2   0  56   0   2   2   3   0   2  24   0    62    0    0   1.367     45  0.34
  300  301 A   0   0   0   0   1   0   0  10   3   6   2   0   0   0   0   1   0   1  57  17    87    0    0   1.377     45  0.44
  301  302 A   4   2   2   0  10   0  11   0   4  61   1   1   0   0   0   0   0   1   1   0    96    0    0   1.399     46  0.16
  302  303 A   0   0   0   0   1   0  47   3   3   0   9   0   0   2   2   8   1   2  21   0    97    0    0   1.655     55  0.06
  303  304 A   0   5   0   0   2   0   3   0   0   0   9   2   0   1   0   8   0   3  12  54    97    0    0   1.594     53  0.28
  304  305 A   0   0   0   0  28   0  69   0   0   0   0   0   0   1   1   0   0   0   1   0    97    0    0   0.753     25  0.89
  305  306 A   0   1   0   0   3   0   3   0  10  22   8   5   0  23  18   2   2   2   1   0    97    0    0   2.115     70  0.16
  306  307 A   0   3   1  15  53   0  26   0   0   0   2   0   0   0   0   0   0   0   0   0    97    0    0   1.211     40  0.71
  307  308 A  23  35  25   0   0   0   0   0   0   0   2   2  11   0   0   0   0   0   2   0    97    1    0   1.536     51  0.40
  308  309 A   0   0   0   0   0   0   0   0   2   0  78   0   0   0   1   1   2   0  16   0    96    0    0   0.739     24  0.60
  309  310 A   0   0   0   1   0   0   1   0   0   0   2   0   0   3   0   1  67   1  22   2    97    0    0   1.056     35  0.55
  310  311 A   0   0   0   0   0   0   0  86   3   0   9   1   0   0   0   1   0   0   0   0    97    0    4   0.556     18  0.77
  311  312 A   4   0   0   0   3   0   6   1   2   0   6   0   4   6   2   4   7  43   9   1    97    1   11   2.045     68  0.17
  312  313 A  25  10  45   0   1   0   5   0   1   1   0  10   0   0   0   0   0   0   0   1    96    0    0   1.522     50  0.49
  313  314 A   4   0   0   0   0   0   0   0   0  11   6  55   1   0   3   0   9   8   0   1    96    0    0   1.514     50  0.34
  314  315 A  58   7  34   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    96    0    0   0.872     29  0.79
  315  316 A   2   1   0   0   0   0   0   0  26  33   1   3   0   0   0  11   0   2   1  19    96    0    0   1.691     56  0.30
  316  317 A   0   0   0   0   0   0   0  41   5   1  47   0   0   0   0   0   0   0   5   0    97    0    0   1.072     35  0.55
  317  318 A  24   2  47   1   1   0   0   0   3   0   0   0   0   0   0   0  20   1   1   0    97    0    0   1.391     46  0.37
  318  319 A   0   3   0   0   0   0   0   1   0   0   4   0   1   0   1   0  19   0  14  57    97    0    0   1.294     43  0.49
  319  320 A   1   0   0   0   0   0   0   1   1   0   1   0   0   0   0   0   0   0   1  95    97    0    0   0.286      9  0.91
  320  321 A   7   0   0   1   0   0   2   5  18   0   8   1   1   0   6  26  14   5   0   5    97    0    0   2.182     72  0.20
  321  322 A   1   0   0   0   0   0   0   1   2   0   0   0   0   2   2   2   1  74   0  14    97    0    0   0.962     32  0.70
  322  323 A   0  11   0   5   0   0   1   0   0   0   0   0   0   1   0   0   0  72   6   3    97    0    0   1.009     33  0.49
  323  324 A   0  40   0  10  32   3  12   0   0   0   0   0   1   0   0   0   0   0   1   0    97    0    0   1.426     47  0.63
  324  325 A   5  14  14  25   0   0   0   3   3   0   0   1   1   2   2   5  18   2   0   4    97    0    0   2.196     73  0.19
  325  326 A   1   9   2   0   1   0   0   1  55   0   1   1   1   0   0   2   0  24   0   2    97    0    0   1.415     47  0.31
  326  327 A   2   2   0   0   0   0   0   0   0   0   1  93   1   0   0   0   0   1   0   0    97    0    0   0.371     12  0.85
  327  328 A   3   6   4  11   0   0   0   0   0   0   0   1   1   0  11   2   3   1   0  56    97    0    0   1.560     52  0.15
  328  329 A   0   0   0   0   0   0   0   1   0   0  24  14   0   3   5   4   4  25   7  12    97    0    0   1.985     66  0.27
  329  330 A   0   0   1   0   0   0   0   1  92   0   5   0   0   0   0   1   0   0   0   0    98    0    0   0.370     12  0.87
  330  331 A   2   1  32  34  28   0   0   0   0   0   0   2   0   0   0   0   0   0   0   0    99    0    0   1.293     43  0.52
  331  332 A   1   0   0   0   0   0   0   3   1   0   3   2   0   5   6   7   0   1   5  66    99    0    0   1.365     45  0.50
  332  333 A  19   1  76   2   0   0   0   0   0   0   0   2   0   0   0   0   0   0   0   0    99    0    0   0.731     24  0.83
  333  334 A  12  59   0  28   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0    99    0    0   0.973     32  0.76
  334  335 A   0   0   1   0   0   0   0  93   0   0   3   0   0   0   1   1   0   0   1   0    99    0    0   0.360     12  0.88
  335  336 A   2   1  18   2  77   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.717     23  0.74
  336  337 A   0   1   1   0   0   0   0   1   0   7  32  43   0   0   0   0   0   1  10   3    99    3    3   1.438     47  0.40
  337  338 A   2   0   0   0   0   0   0   3  19  11   5   0   0   7   0   1  16  20   5  10    96    0    0   2.144     71  0.30
  338  339 A   0   0   0   0   0   0   0   0   4   0   2   0   0   0   0   1   1  49   1  41    97    0    0   1.066     35  0.70
  339  340 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1  97   0   2    98    0    0   0.156      5  0.97
  340  341 A   2   0   5   1   1   0   0   0   0   0   2   0   0   0   5  56  27   0   0   1    99    0    5   1.279     42  0.38
  341  342 A  11  13   7  16   0   0   2   1   3   0   6  16   1   0   0   1   0   6  11   5    99    0    0   2.346     78  0.16
  342  343 A   0   0   0   0   1   0   0  33  19   0  33   0   2   0   0   0   1   1   1   8    99    0    0   1.517     50  0.48
  343  344 A   6  19  61   9   1   0   1   0   1   0   1   0   1   0   0   0   0   0   0   0    99    0    0   1.240     41  0.66
  344  345 A   0  23   1   1  19   0  54   0   0   0   0   1   0   1   0   0   0   0   0   0    99    0    0   1.176     39  0.64
  345  346 A   0   0   0   1   0   0   1   0   1   0   0   0   0   0  19  76   2   0   0   0    99    0    0   0.745     24  0.72
  346  347 A  34  39   8   3   6   0   0   0   0   0   2   3   4   0   0   0   0   0   0   0    99    0    0   1.528     50  0.50
  347  348 A  33   4   4   0   0   0   0   1   0   0   1  54   3   0   0   0   0   0   0   0    99    0    0   1.159     38  0.39
  348  349 A   0   0   0   1   0   0   0  48  21   0  23   4   1   0   0   0   0   0   1   0    99    0    0   1.288     42  0.48
  349  350 A   1   0   0   0   0   0   0   5  75   0  15   2   0   1   1   0   0   0   0   0    99    0    0   0.872     29  0.66
  350  351 A  68   2  30   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.705     23  0.86
  351  352 A   1  46   0  48   1   0   0   0   0   0   1   0   2   0   0   0   0   0   0   0    99    0    0   0.925     30  0.82
  352  353 A   0   3   0   0   0   0   0   0   0   0   0   0   0  73   0   0  21   0   2   1    99    0    0   0.792     26  0.68
  353  354 A   1  27   2   7  22   0  23   0   0   0   0   0   0  17   0   0   0   0   0   0    99    0    0   1.643     54  0.43
  354  355 A   0   0   0   0   0   0   0  98   0   1   1   0   0   0   0   0   0   0   0   0    99    0    0   0.113      3  0.97
  355  356 A   0   0   1   0   0   0   0   1   1   0   4   1   0   0   0   0   0   8  84   0    99    0    0   0.666     22  0.77
  356  357 A   7  10  26  57   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    1    0   1.092     36  0.65
  357  358 A   6   0   0   0   0   0   0   0   4   0  12   0   0   0   0  63   0   8   4   2    98    0    0   1.263     42  0.37
  358  359 A   1   0   2   0  96   0   0   0   0   0   0   0   0   0   0   0   1   0   0   0    98    0    0   0.213      7  0.91
  359  360 A   0   0   0   1   0   0   0   2   5   0   4   0   0   0   2  84   0   1   0   1    98    0    0   0.731     24  0.64
  360  361 A   0   0   0   0   0   0   0   0   0   2   1   0   0   0   0  33  61   2   0   1    98    0    0   0.918     30  0.51
  361  362 A   0   0   0   0   0   0   0  11   0   0   0   1   0   0  13  48   0  26   0   1    98    0    0   1.308     43  0.30
  362  363 A   0   0   0   0   0   0   0   4   1   9   2   2   0   0  27   3  48   2   0   1    99    4   22   1.488     49  0.33
  363  364 A   1   0   0   0   0   0   0   1   0   0  16   0   0   2  59   0   3   0  17   1    95    0   85   1.237     41  0.31
  364  365 A   5   0   1   1   0   0   0   0   3   0   1   0   0   0   0   1   0  63   0  24    98    0    0   1.080     36  0.55
  365  366 A   1   3   5   0   0   0   0   1   2   2   0   0   0   0   0   0  86   0   0   0    98    0    0   0.643     21  0.61
  366  367 A   0   2   1   0   0   0   0   0  87   0   0   0   0   0   1   8   0   0   0   1    98    0    0   0.548     18  0.65
  367  368 A   1   0   0   0   0   0   0   1   1   0  21   4   0   0   0   0   2  59   2   8    98    0    7   1.275     42  0.44
  368  369 A   2   3   1  17   0   0   0   0  15  46   4   1   2   0   0   0   1   3   0   4    98    0    0   1.722     57  0.21
  369  370 A   0   0   0   0   0   0   0   0   0  20   0   1   0   0   0   9   1   5   2  61    98    0    0   1.169     39  0.42
  370  371 A   0   0   1   0   0   0   0  58   2   0  10   0   0   0   0   0   0   5   2  22    99    7    2   1.239     41  0.52
  371  372 A   1   0   1   1   1   0   0   0   1   0   1  54   0   0   7   2   1   1  26   2    92    0    0   1.420     47  0.29
  372  373 A   1   1   0   0   9   0   1   0   5   0   0  27   0   0   1   0   1  53   0   1    98    0    0   1.340     44  0.17
  373  374 A  30   0   0   0   0   0   0   0  21   1   2   0   0  11   0   0   0  16   1  17    98    0    0   1.709     57  0.21
  374  375 A   1  13   0   0   0   0   0   4  81   0   0   1   0   0   0   0   0   0   0   0    98    0    0   0.666     22  0.57
  375  376 A   0   0   0   0   0   0   0   0   1   0   0   1   0   0   1   3  30   9   5  50    98    0    0   1.325     44  0.53
  376  377 A   0   1   1   3   0   0   0   0   2   0   0   6   0   0   3  82   0   0   2   0    99    0    0   0.796     26  0.62
  377  378 A  34   6  20   0   1   0   0   0  31   0   4   3   0   0   0   0   0   0   0   0    99    0    0   1.506     50  0.40
  378  379 A   0   0   0   0   0   0   0   6  60   0  12   1  21   0   0   0   0   0   0   0    99    0    0   1.109     37  0.52
  379  380 A   0   0   0   0   6   0  48   0   0   0   0   1   0  28   0   4   1   8   0   3    99    0    0   1.410     47  0.22
  380  381 A   1  97   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0   0   1   0    99    0    0   0.169      5  0.92
  381  382 A   2  43   0  37   7   0   0   0   0   0   1   2   0   0   0   0   7   0   0   0    99    0    0   1.309     43  0.68
  382  383 A   0   0   0   9   0   0   0  82   0   0   5   0   1   0   0   1   0   0   2   0    99    0    0   0.705     23  0.59
  383  384 A  11  47  18  11   0   0   0   0   0   0   0   0  12   0   0   0   0   0   0   0    99    0    0   1.408     46  0.40
  384  385 A   0   0   0   0   0   0   0   0   1   1   5   1   0   0   0   0   1   0  77  14    99    0    0   0.816     27  0.68
  385  386 A  27   0   0   0   0   0   1   0   4   5  49   1   7   2   0   0   1   2   0   0    99    0    0   1.467     48  0.22
  386  387 A   1   0   0   7   0   0   0   1  49   0   5  15   0   0   0   5   2   8   5   1    99    0    0   1.695     56  0.27
  387  388 A   1   2   0   0   0   0   0   1   4   0   1   0   0   0   0   4   1  11   0  75    99    0    0   0.985     32  0.63
  388  389 A   0  52   0  22  26   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   1.027     34  0.81
  389  390 A   4  47   8   1   0   0   3   0   1   0   2  24   0   0   0   0   1   8   0   0    99    0    0   1.557     51  0.20
  390  391 A   0   0   0   0   0   0   0   0   2   0   1   2   0   0  25  60   2   1   4   3    99    0    0   1.221     40  0.51
  391  392 A   0   0   0   0   0   1   1  21  63   0   7   2   3   0   0   0   0   0   2   0    99    0    0   1.166     38  0.58
  392  393 A   1  71  23   1   4   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.807     26  0.77
  393  394 A   2  39   4   2   0   0   0   0   0   0   0   2  51   0   0   0   0   0   0   0    99    0    0   1.078     35  0.11
  394  395 A   0   3   0   0   2   0  32   0   0   0   6  20   1  15   2  16   0   2   0   0    99    0    0   1.827     60  0.04
  395  396 A   0   0   0   0   0   0   0   0   0  89   0   0   0   0  11   0   0   0   0   0    99    0    0   0.349     11  0.76
  396  397 A   5   0   0   0   0   0   0   0   0   0   1   1   0   0  85   5   0   3   0   0    99    0    0   0.640     21  0.65
  397  398 A  59   1  36   4   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.857     28  0.78
  398  399 A   2   2   2   0   0   0   0   0   1   0   0   0   0   0   4  84   2   0   3   0    99    0    0   0.745     24  0.65
  399  400 A  86   0   0   0   0   0   0   0   3   0   0  11   0   0   0   0   0   0   0   0    99    0    0   0.481     16  0.68
  400  401 A   0   0   0   0   0   0   0  89   1   7   0   0   0   0   3   0   0   0   0   0    99    0    0   0.444     14  0.73
  401  402 A   0   0   0   0   0   0   0   1   0   0   1   5   0   2  26   0   0   8  56   1    99    0    0   1.250     41  0.33
  402  403 A   0   0   0   0   0   0   0   6   0   0   0   0   0   0   0   0   0  70   0  24    99    0    0   0.765     25  0.76
  403  404 A   9   1   0  10  24  12  38   0   0   0   3   1   0   0   0   0   0   0   1   0    99    0    0   1.662     55  0.45
  404  405 A  89   0  10   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.383     12  0.90
  405  406 A   2   0   2   0   0   0   0   0   1   0   0  66   0   0   0   1  23   2   3   0    99    0    0   1.051     35  0.37
  406  407 A   0   0   0   0   0   0   0   0   0   0   0   3   0   0   3  87   7   0   0   0    99    0    0   0.522     17  0.78
  407  408 A   2   0   0   0   0   0   0  62  26   2   2   4   0   1   0   0   0   0   1   0    99    0    0   1.108     37  0.54
  408  409 A   3   9   0   0   0   0   0   0   0   0   0   0   0   0   6   0  82   0   0   0    99    0    0   0.658     21  0.57
  409  410 A   0   0   0   0   0   0   0   3   0   1   5  65   0   0   0   0   0   0  19   7    99    0    0   1.089     36  0.49
  410  411 A  51   4   0   0   0   0   1   0   1   9   0   0   2   0   1  25   6   0   0   0    99    0    0   1.428     47  0.16
  411  412 A   0   2   0   0   0   0   0   0   3  16   1   0   0   0   1   0  22  38   9   7    99    0    0   1.679     56  0.39
  412  413 A   0   0   0   0   0   0   0   1   4   0   5   0   0   0   0   1  89   0   0   0    99    0    0   0.478     15  0.71
  413  414 A  63   0   0   0   0   0   0   1  33   0   2   0   1   0   0   0   0   0   0   0    99    1   10   0.831     27  0.45
  414  415 A  11   5   4   0   2   0  26   0   0   0   2   2   0   5   2   0   1   8  16  15    98    9    2   2.180     72  0.06
  415  416 A   2   1   0   0  29   3  20   1   2   0   2   0   0   0   0   0   0   0  38   1    90    0    0   1.565     52  0.18
  416  417 A   0   0   0   0   0   0   0   1  49   0  45   0   0   0   0   0   0   1   3   0    99    0    0   0.905     30  0.57
  417  418 A  67   2  19   0   0   0   0   0   0   0   0   0   0   0  12   0   0   0   0   0    99    0    0   0.922     30  0.53
  418  419 A   0   0   0   1   0   0   0  39   5   0  16   1   0   0   0   0   0  24   0  13    99    0    0   1.515     50  0.44
  419  420 A   0   0   0   0   0   0   0   7  93   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.255      8  0.90
  420  421 A   0  94   2   2   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.295      9  0.96
  421  422 A   1   0   0   0   0   0   0   4  70   0  12   0  13   0   0   0   0   0   0   0    99    0    0   0.950     31  0.65
  422  423 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1  99   0   0   0   0    99    0    0   0.056      1  0.99
  423  424 A   0   0   1   0   0   0   0   4  49   0  34   7   0   1   0   0   3   0   0   0    99    0    0   1.231     41  0.44
  424  425 A  41   7  21   6   0   0   0   0   0   0   2  20   2   0   0   0   0   0   0   0    99    0    0   1.532     51  0.44
  425  426 A   0   0   0   0  10   0  90   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.327     10  0.99
  426  427 A   0   0   0   0   0   0   0   1   6   0   9   0   0   0   0   0   0  72   3   9    99    0    0   0.997     33  0.59
  427  428 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0  61  38   1   0   0   0    99    0    0   0.717     23  0.75
  428  429 A   0  35   0  63   0   0   0   1   0   0   0   1   0   0   0   0   0   0   0   0    99    0    0   0.754     25  0.87
  429  430 A   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  430  431 A   0  44   1   0   1   0   0   4   1   0   1   0   0   0  22  12   1   1   2   9    99    0    0   1.655     55  0.04
  431  432 A   0   0   0   0   1  96   0   0   0   0   2   0   0   0   0   0   0   0   1   0    99    0    0   0.211      7  0.93
  432  433 A   0  45   9  44   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0   0    99    0    0   0.983     32  0.81
  433  434 A  88   6   5   0   0   0   0   0   0   0   0   0   0   0   0   0   1   0   0   0    99    0    0   0.481     16  0.89
  434  435 A  18   2  17   9   0   0   0   2   4   0   9  12   0   5   0   5   1   4   6   5    99    0    0   2.390     79  0.11
  435  436 A   0   0   0   0   0   0   0   0   0   0   0   0   0   1  88  11   0   0   0   0    99    0    0   0.404     13  0.86
  436  437 A  14   2  77   0   0   0   0   0   0   0   0   0   7   0   0   0   0   0   0   0    99    0    0   0.746     24  0.79
  437  438 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0    99    0    0   0.000      0  1.00
  438  439 A   0   0   1   1   1   0   0   0   5   0   1   0   0   0   6  33  33  14   4   0    99    0    0   1.645     54  0.32
  439  440 A   1   0   0  17   0   0   0   0  24   0  19  19   0   0   0   0  19   0   0   0    99    0    0   1.643     54  0.20
  440  441 A   2  90   8   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.378     12  0.87
  441  442 A   1   0   0   0   0   0   0  10   1   0   0   0   1   0   0   0   0   4   1  82    99    0    0   0.711     23  0.75
  442  443 A   0   0   0   0   0   0   0   0   3   0   0  60   0   0  10  16  11   0   0   0    99    5   85   1.185     39  0.30
  443  444 A   2   3   1   0   1   0   0   0   1   0   1   1   0   5  22   0  52   1   1   7    94    0    0   1.554     51  0.33
  444  445 A   0   0   1   0   0   0   0   1   3  45   2   1   0   0   4   8  29   1   1   3    99    0   19   1.574     52  0.36
  445  446 A   0   0   0   0   0   0   0  24   1   0   9   0   1   0  59   4   1   0   0   1    99    0    0   1.190     39  0.24
  446  447 A   0   0   0   0   0   0   0   0  25   0   3   2   0   1   1   5  48   2   9   3    99    0    0   1.530     51  0.33
  447  448 A   0   0   2   1  23   0  31   0   0   0  30   0   1   7   0   3   0   0   1   0    99    0    0   1.576     52  0.14
  448  449 A   0   5   3   0  85   0   5   0   0   0   0   0   0   0   0   0   2   0   0   0    99    0    0   0.626     20  0.83
  449  450 A   0   6  94   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.229      7  0.94
  450  451 A   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  451  452 A  75   0  25   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.565     18  0.87
  452  453 A   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  453  454 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100    99    0    0   0.000      0  1.00
  454  455 A   0   0  98   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.099      3  0.97
  455  456 A   0   0   0   0   0   0  11   0  88   0   1   0   0   0   0   0   0   0   0   0    99    0    0   0.404     13  0.62
  456  457 A   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  457  458 A   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  458  459 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0    99    0    0   0.000      0  1.00
  459  460 A   0   0  89   0   0   0   0   0   0   0   9   1   1   0   0   0   0   0   0   0    99    0    0   0.416     13  0.69
  460  461 A   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  461  462 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  11   2  30   1  56    99    0    0   1.058     35  0.60
  462  463 A   6  21   2   0  41   0  15   0   0   0   0   7   0   1   0   0   0   2   1   3    99    0    0   1.694     56  0.36
  463  464 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0    99    0    0   0.000      0  1.00
  464  465 A   0   1   0   0   0   0   0   6   0   0  82  11   0   0   0   0   0   0   0   0    99    0    2   0.625     20  0.76
  465  466 A   0  24   0   6  70   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.765     25  0.87
  466  467 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0    99    0    0   0.000      0  1.00
  467  468 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0    99    0    0   0.000      0  1.00
  468  469 A   0  91   2   1   6   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.382     12  0.94
  469  470 A   0   0   0   0   0   3   0   0   0   0   1   0  96   0   0   0   0   0   0   0    99    0    0   0.192      6  0.87
  470  471 A   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  471  472 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0    99    0    0   0.000      0  1.00
  472  473 A   0   2   0   0  60   0  37   0   0   0   1   0   0   0   0   0   0   0   0   0    99    0    0   0.802     26  0.92
  473  474 A   3   0   0   0   0   0   0   0   3   0   0  94   0   0   0   0   0   0   0   0    99    0    0   0.271      9  0.88
  474  475 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0    99    0    0   0.000      0  1.00
  475  476 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0    99    0    0   0.000      0  1.00
  476  477 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   9  91   0   0   0   0    99    0    0   0.305     10  0.91
  477  478 A   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  478  479 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0    99    0    0   0.000      0  1.00
  479  480 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0    99    0    0   0.000      0  1.00
  480  481 A   0  24   0   0  64   0   1   0   0   0   0   0   0  10   0   0   1   0   0   0    99    0    0   0.956     31  0.58
  481  482 A   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  482  483 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0    99    0    0   0.000      0  1.00
  483  484 A   0   0   0   1   0   0   0   0   0   0   0   0   0  87   1   0   9   2   0   0    99    0    0   0.512     17  0.78
  484  485 A   0   0   0   0   0   0   1   0   0   1   0  26   0  69   0   0   0   0   3   0    99    0    0   0.808     26  0.44
  485  486 A  11   0   0  89   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.349     11  0.82
  486  487 A   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  487  488 A  62   0  26   0   0   0   0   0   0   0   0   0   0   0   0  12   0   0   0   0    99    0    0   0.905     30  0.53
  488  489 A   0  89   0  11   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.349     11  0.96
  489  490 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0    99    0    0   0.000      0  1.00
  490  491 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0    99    0    0   0.000      0  1.00
  491  492 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0    99    0    0   0.000      0  1.00
  492  493 A   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  98   0   1    99    0    0   0.113      3  0.96
  493  494 A   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  494  495 A   1   1   0   1   0   0   1   1   2   0   0   6   0   0   1  61  24   1   0   0    99    0    0   1.221     40  0.37
  495  496 A   0   0   1   0   0   0   0   0   0   0   0   0   0   0  38  61   0   0   0   0    99    0    0   0.717     23  0.71
  496  497 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0    99    0    0   0.000      0  1.00
  497  498 A   0   0   0   0   0   0   0  85   1   0   0   0   0   0   0   2   5   6   1   0    99    0    4   0.632     21  0.71
  498  499 A   0   1  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.056      1  0.99
  499  500 A   6   0   1   0   1   0   0   0   0   2   0   0   0   0   0   0   7  59   7  17    99    0    0   1.332     44  0.55
  500  501 A   0   0   0   0   0  98   0   0   0   0   0   0   0   0   2   0   0   0   0   0    99    1    0   0.099      3  1.00
  501  502 A   1   0   0   0   0   0   0   0   3   0  17  15   0   0   0   3   1  44  15   0    98    0    0   1.547     51  0.33
  502  503 A   0   1   0   0  89   0  10   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.385     12  0.97
  503  504 A   2   0  97   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.156      5  0.97
  504  505 A   0   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   1   9   0  89    98    0    0   0.419     13  0.88
  505  506 A   0   0   0   0  99   0   0   1   0   0   0   0   0   0   0   0   0   0   0   0    98    1    0   0.057      1  0.97
  506  507 A   9   0   1   0   0   0   1  89   0   0   0   0   0   0   0   0   0   0   0   0    97    0    0   0.422     14  0.71
  507  508 A   1  32   0  55   0   0   0   0   0   0   0   0   0   1   1   0   0   0   0  10    98    0    0   1.066     35  0.53
  508  509 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  10  90    98    0    0   0.330     11  0.85
  509  510 A   0  87   1   0   0   0   0   0   0   0   1   0   0   0   0   0  10   0   1   0    98    0    0   0.497     16  0.63
  510  511 A   0   1   0   0   0   0   0   0  38   1   0   0   0   0   0   0  50   2   0   8    98    0    0   1.092     36  0.45
  511  512 A   8   0   1   0   0   0   0   1  54  28   3   0   1   0   0   0   1   1   1   1    98    0    0   1.326     44  0.40
  512  513 A   1   9   1   0   1   0   0   0   0   0   0   6  82   0   0   0   0   0   0   0    98    0    0   0.696     23  0.46
  513  514 A   1   1  86   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1   2   9    98    0    0   0.571     19  0.63
  514  515 A   0  10   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0  59   2  28    98    0    0   1.025     34  0.50
  515  516 A   0  89  10   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.385     12  0.87
  516  517 A   0   0  89   0   0   0   0   0   0   0   0   0   0   0   0   0   0  11   0   0    98    0    0   0.351     11  0.67
  517  518 A   0   0   0   0   1   0   0   0   1   0   0   0   0   0   0   9   0  86   0   3    98    0    0   0.552     18  0.72
  518  519 A   0   1   0   0   0   0   0   1   0   0   1   0   0   0  13  83   0   0   1   0    98    0    0   0.613     20  0.78
  519  520 A   0   0   0   2   1   0   1   0   0  91   1   1   0   0   1   2   0   0   0   0    99   70   27   0.476     15  0.78
  520  521 A   0   0   0   0   0   0   0  45   3   0   0   0   0   0   0   0   3   0  48   0    29    0    0   0.943     31  0.51
  521  522 A   3   0   9   0   0   0   0   9   0  76   0   0   0   0   0   0   0   0   3   0    33    3    5   0.858     28  0.42
  522  523 A   0  15   4  49   0   0   0   7   0  24   0   0   0   0   0   0   0   0   0   0    95    0    0   1.299     43  0.24
  523  524 A   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   1   0   0    99    0    0   0.056      1  0.99
  524  525 A   8   2  90   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.378     12  0.94
  525  526 A   0  36  13  14  36   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   1.279     42  0.71
  526  527 A   0   0   0   0   0   0   0   0  35   0  64   0   0   0   0   0   0   0   0   1    99    0    0   0.702     23  0.55
  527  528 A   0  36  59   3   0   0   0   0   0   0   0   0   2   0   0   0   0   0   0   0    99    0    0   0.866     28  0.66
  528  529 A   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.000      0  1.00
  529  530 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  58   0  42    99    0    0   0.682     22  0.79
  530  531 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1   0  99   0   0    99    0    0   0.056      1  0.99
  531  532 A   0   0   0   0   0   0   0   0   9   0   0   1   0   0   0   0   1  88   0   1    99    0    0   0.471     15  0.76
  532  533 A   0   0   0   0   0   0   0   0   0   0   6   0  94   0   0   0   0   0   0   0    99    0    0   0.229      7  0.93
  533  534 A   2   0   6  67   0  24   0   0   0   0   0   0   0   0   0   1   0   0   0   0    99    0    0   0.909     30  0.35
  534  535 A   4   1   0   3  91   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.415     13  0.87
  535  536 A   0   0   0   0   0   0   0   0   0  99   0   0   0   0   1   0   0   0   0   0    99    0    0   0.056      1  0.98
  536  537 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  98   0   0   2   0    99    0    0   0.099      3  0.96
  537  538 A   0   0   0   0   0   0   0   1  89   0  10   0   0   0   0   0   0   0   0   0    99    0    0   0.383     12  0.78
  538  539 A   0   0   0   0   0   0   0   0   0   0  22  78   0   0   0   0   0   0   0   0    99    0    0   0.530     17  0.72
  539  540 A   0   0   0   0   0   0   0   0   0   1   0   0   0   9   0   0   0   0   0  90    99    0    0   0.360     12  0.79
  540  541 A   4   0   1   8   0   0   0   0   6   0   0  32   0   0   0  27  10   9   1   1    99    0    0   1.811     60  0.22
  541  542 A   0   0   0   0   0   0   0   0   0   0  54  46   0   0   0   0   0   0   0   0    99    0    0   0.691     23  0.57
  542  543 A   0   6   0   0  91   1   2   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.382     12  0.96
  543  544 A  27   3   2   1   0   0   0   0   5   0   6   3   2   0   1  48   0   1   0   0    99    0    0   1.535     51  0.15
  544  545 A   0   0   0   0   0   0   0   0  17   0   2   3   0   0   0   0   9  30  36   2    99    0    0   1.514     50  0.38
  545  546 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1  99   0   0   0   0    99    0    0   0.056      1  0.99
  546  547 A  11  88   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.404     13  0.89
  547  548 A  15   2   2   1   4   0  55   0   0   0   0   0   3  10   0   1   0   0   7   0    99    0    0   1.522     50  0.33
  548  549 A   0   0   0   0   0   0   0   0   1   0   6   2   0   0   0   1  25  10   6  48    99    0    0   1.442     48  0.50
  549  550 A   0   1   2   0   0   0   0   0   2   0   1   5   0   2   0   4  38  20  24   0    99    0   90   1.644     54  0.34
  550  551 A   0   0   0   0   5   1   1   1   0   0  38   1  13  25   0   0   1   0  13   0    99    0    7   1.631     54  0.18
  551  552 A   0   0   2   0   0   0   0   2   8  36  17   0   0   0   1  14   0   0  18   1    99   17    8   1.711     57  0.31
  552  553 A   0   2   1   0   6   0   0   0  17   0   0   6   0   4   5  22   0   0  37   0    82    0    0   1.756     58  0.17
  553  554 A   0   1   0   0  82   0   2   3   0   0   1   1   0   0   1   2   2   0   3   0    91    0    0   0.834     27  0.57
  554  555 A   0   2   2   1   3   0   0   3   1   0   2   1   0   2   0  13  61   6   2   0    96    0    0   1.495     49  0.39
  555  556 A   0   0   0   0   5   0   0   0   1   6   0   2   0   1   0  82   2   0   0   0    97    0    0   0.738     24  0.62
  556  557 A   0   1   0   0   1   0   0   0   2  80   0   2   0   0   5   6   3   0   0   0    98    0    0   0.864     28  0.63
  557  558 A   2   2   0   1   3   0   1   0   0   5   0   0   0   0  16  67   0   1   0   1    98    0    0   1.167     38  0.52
  558  559 A   7   5   5   1   2   0   2   2   2  44   2   0   0   0   0   8  12   1   4   2    98    0    0   2.016     67  0.16
  559  560 A  12  17   2   1   0   0   0   9  20   6   5   5   0   0   3  15   0   2   0   1    98    0    0   2.226     74  0.12
  560  561 A   0   0   0   0   0   0   0   1   0   7   1   0   0   1   6  73   5   1   3   1    98    0    0   1.078     36  0.58
  561  562 A   3   5   0   0   1   0   0  50   3   3   3   4   0   0   4   6   0   0   0  17    98   24    9   1.708     57  0.27
  562  563 A   0   5   0   0   4   0   0   0   0   0   0   0   1   1  12  66   8   1   0   0    74    0    0   1.195     39  0.37
  563  564 A   5   1   0   0   3   0   7   3  46   9  11   0   0   1   0   0   5   0   1   7    74    0    0   1.870     62  0.20
  564  565 A   1   0   0   0   0   0   0   0   4   1   0   1   0   0   3  20   2  60   1   5    91    0    0   1.316     43  0.44
  565  566 A   0   0   0   0   0   0   0   0  80   3   1  13   0   0   0   0   2   0   0   0    92    0    0   0.685     22  0.68
  566  567 A   0   0   1   0   0   0   0   2   5   0   1   0   0  60   0   0   0   6   0  24    98    0    0   1.146     38  0.42
  567  568 A   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.000      0  1.00
  568  569 A   0   0   2   1   0   0   0   1  16   0  46  12  12   0   0   0   0   9   0   0    98    0    0   1.560     52  0.34
  569  570 A   8  54  36   1   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0   0    98    1    0   0.998     33  0.68
  570  571 A  44   2  26   3   0   0   2   3   1   0   4   2   0   4   0   1   5   1   1   0    97    0    0   1.770     59  0.33
  571  572 A   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0    98    0    0   0.000      0  1.00
  572  573 A   0   0   0   0   1   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.057      1  1.00
  573  574 A   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.000      0  1.00
  574  575 A   0   0   0   0   0   0   0  97   2   0   0   0   0   0   0   0   0   0   0   1    98    0    1   0.156      5  0.96
  575  576 A   4   0   1   0   0   0   0   0   0   0   2  51   0   0   6  21   1   4   5   4    98    0    0   1.561     52  0.27
  576  577 A 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.000      0  1.00
  577  578 A   0   0   3   1   0   0   0   2   1   8   0   6   0   0   2   0   3   3   1  69    98    0    0   1.249     41  0.48
  578  579 A   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.000      0  1.00
  579  580 A   0   0   0   0   0   0   0   0   0   0   6   2   0   1   1  16  10   1  61   1    98    0    0   1.267     42  0.45
  580  581 A   4   0  55   0   0   0   0   0  30   0   4   5   2   0   0   0   0   0   0   0    98    0    0   1.181     39  0.31
  581  582 A   2   2   2   3   0   0   0   0   6   0  17  30   0   0   0   0   2   2  11  22    98    0    0   1.920     64  0.27
  582  583 A   0   2   0   0   0   0   0  53   8   0   1   2   0   3   0   2   4  16   7   1    98    0    0   1.594     53  0.38
  583  584 A   0   0   0   0  13  86   0   0   0   0   0   0   0   0   0   0   0   0   1   0    99    0    0   0.444     14  0.94
  584  585 A   0  99   0   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.056      1  1.00
  585  586 A   6   2   0  16   0   0   0   0   0   0   0   6   0   0   0   0   2  31   0  37    98    0    0   1.527     50  0.33
  586  587 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0    99    0    0   0.000      0  1.00
  587  588 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0    99    0    0   0.000      0  1.00
  588  589 A   0   0   1  24   0   0   0   0   0   0   0   0   0   0   2  73   0   0   0   0    99    0    0   0.700     23  0.56
  589  590 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100    99    0    0   0.000      0  1.00
  590  591 A   0   0   0   0   1   0   9   0   0  89   0   1   0   0   0   0   0   0   0   0    99    0    0   0.416     13  0.56
  591  592 A  10  86   3   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.515     17  0.82
  592  593 A  10   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   3   0  87   0    99    0    0   0.460     15  0.63
  593  594 A   2   0   0   0   0   0   0   0   6   2   0   0   0   0   0   0   1  44   1  43    99    0    0   1.143     38  0.59
  594  595 A   0   0   0   0   0   0   0   0   0   0  24  35   2   0   0   0   0  11  26   1    99    0    0   1.432     47  0.30
  595  596 A  79   1   6   0   0   0   0   0   3   0   0   0   0  10   0   0   1   0   0   0    99    0    0   0.788     26  0.55
  596  597 A  54   2  10   0   0   0   0   1  16   0   0   6   2   0   0   1   7   1   0   0    99    0    0   1.515     50  0.32
  597  598 A   1   1   1   0   0   0   0  29   5   1   5  19   0   0   2   0  20   6   3   6    99    0    0   2.011     67  0.25
  598  599 A   5  90   2   0   0   0   0   0   0   0   0   0   1   0   0   0   2   0   0   0    99    0    0   0.451     15  0.84
  599  600 A   0  43   0   3  12   0  40   0   0   0   0   0   0   1   0   0   0   0   0   0    99    0    0   1.137     37  0.56
  600  601 A   0   0   0   1   0   0   0   2   2   0   5   2   0   7   1   8  54   0  18   0    99    0    0   1.515     50  0.36
  601  602 A   0   0   0   0   0   0   0   5  12   0   5   1   0   2   0  54  18   0   2   1    99    0    0   1.452     48  0.30
  602  603 A   0   0   0   0   0   0   0   2   2   0  94   0   0   1   0   0   0   0   1   0    99    0    0   0.309     10  0.90
  603  604 A   4   0   0   0   0   0   0   1   6   0  53  13   0   0   3  11   4   2   3   0    99    0    0   1.615     53  0.34
  604  605 A  20  14   0   6   1   0   0   2   0   0   3   1  11   0   0   0   0   5  11  25    99    0    3   2.034     67  0.03
  605  606 A   0   0   0   0   0   0   0   0   2  12   5   1   1   0   5  68   4   0   1   1    99    0    0   1.216     40  0.46
  606  607 A   6  42   1   0  35   0   0   0   0   0   0  14   0   1   0   0   0   0   0   0    99    0    0   1.271     42  0.57
  607  608 A  41  49   5   4   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.994     33  0.69
  608  609 A   3   2   1   1   0   0   0   1  55   0  30   1   3   0   0   0   3   0   0   0    99    0    0   1.275     42  0.47
  609  610 A   2  12   0   0  16   0   2   5   1   0   8   9   1   2   0   1   1  20   9  10    99    0    0   2.317     77  0.06
  610  611 A   0  90   7   1   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   0.408     13  0.92
  611  612 A   0   0   0   0  53  27  20   0   0   0   0   0   0   0   0   0   0   0   0   0    99    0    0   1.016     33  0.91
  612  613 A   2   0   0   0   0   0   0   0  31  17  16   1   0   0   3  25   0   3   1   0    99    0    0   1.692     56  0.27
  613  614 A   1   1   0   0   0   0   0  10   5  15  11   7   0   0   0   0   0   1  11  37    99    0    0   1.851     61  0.33
  614  615 A  29   5   0   0   1   0  27   1  10   3   1   2   2  15   0   0   0   3   0   0    99    0    0   1.891     63  0.15
  615  616 A  10   0   3   0   0   0   0  12  17  12   7   2   0   0   0   0   6   7   2  21    99    0    0   2.183     72  0.25
  616  617 A   0   0   3   0   0   0   0  23  15   2   6   5   0   2  18   1   2  18   0   4    99    9   88   2.084     69  0.19
  617  618 A   2   0   0   0   2   0   0  34   1   2  17   1   0   0   0  38   0   2   0   0    90    0    0   1.472     49  0.27
  618  619 A   0   0   0   0   0   0   0  52  26   0   2   1   0   0   2  12   0   4   0   0    92    0    0   1.296     43  0.42
  619  620 A   4   0   0   1   6   0   6  34   4   1  13   0   0   0   2  23   0   4   0   1    96    0    0   1.932     64  0.11
  620  621 A   0   0   0   0   0   0   0   1   2   0   7   2   0   0  12  73   0   1   1   0    98    0    0   0.971     32  0.59
  621  622 A   2   0   0   1   0   0   0   3   1   0   4  29   0   0   2  56   0   0   2   0    98    0    0   1.251     41  0.34
  622  623 A   0   0   0   0   0   0   0   0   0   0   4   1   0   0  13  82   0   0   0   0    98    0    0   0.611     20  0.76
  623  624 A   0   0   1   0   0   0   0  55   2   0  12   0   0   0   1  28   1   0   0   0    98    0    0   1.160     38  0.31
  624  625 A   0   0   0   0   0   0   2  46   8   0  41   2   0   0   0   0   0   1   0   0    98    0    0   1.133     37  0.53
  625  626 A   0   1   0  24   0   0   0   1   8   0  53   1   0   1   0   8   1   0   1   0    98    0    0   1.371     45  0.18
  626  627 A   0   0   0   8  86   0   2   0   0   0   1   0   0   0   1   2   0   0   0   0    98    0    0   0.589     19  0.76
  627  628 A   0   1   1   4   1   0   0   0   0   0  10   0   0   0  27   1  55   0   0   0    98    0    0   1.231     41  0.29
  628  629 A   0   0   0   0   0   0   0   0   0   0   9  90   0   0   0   1   0   0   0   0    98    0    0   0.363     12  0.77
  629  630 A  89   0  11   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.351     11  0.93
  630  631 A   0   0   0   0   1   0   0  29   7   0  62   1   0   0   0   0   0   0   0   0    98    0    0   0.935     31  0.56
  631  632 A   1   1   0   3   0   0   1   0  45   0  15   3   1   2   0   0  28   0   0   0    98    0    0   1.482     49  0.26
  632  633 A   3  64   2   3   1   0   0   2   0   0   2   4   0   0   9   0   9   0   0   0    98    0    0   1.352     45  0.35
  633  634 A   0   0   0   0  46   0  32   0   0   0   0   0   0  21   0   1   0   0   0   0    98    0    0   1.098     36  0.61
  634  635 A   0   0   0   0   0   0   0   0   0   0   0   1   0   0  58  41   0   0   0   0    98    0    0   0.728     24  0.69
  635  636 A   0   3   0   3   0   0   0   0   0   0   0   0   0   0   0   0   4  89   1   0    98    0    0   0.496     16  0.72
  636  637 A   0   0   0   0   0   0   0   0   0   0  14   0   0   0   1   0  37   0  47   1    98    0    0   1.094     36  0.41
  637  638 A   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.000      0  1.00
  638  639 A   0   0   0   4   0   0   0  18   9   0   6   7   0   3   0   0   8   1  43   0    98    0    0   1.742     58  0.30
  639  640 A   0   0   0   1   0   0   0   0   3   0   3   1   0   0   0  77   2   3  10   0    98    0    0   0.931     31  0.58
  640  641 A   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.000      0  1.00
  641  642 A   0   1   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.057      1  1.00
  642  643 A   1   0   0   0   1   0   0   0  17   0   6  56   0   0   0   3   0  11   2   2    98    0    0   1.404     46  0.39
  643  644 A   0   0   0   3   0   0   0   0   0   0   0  43   0   0   0   0   1   0  53   0    98    0    0   0.853     28  0.41
  644  645 A   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.000      0  1.00
  645  646 A   0   0   0   1   0   0   3   0   0   0   6   0   0   4  71   7   2   1   4   0    98    0    0   1.141     38  0.50
  646  647 A   0   0   0   0   0   0   0   0   6   0  58   6   0   0   0   0   3   0  27   0    98    0    0   1.116     37  0.43
  647  648 A   0   0   1   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0    98    0    0   0.057      1  0.97
  648  649 A   0   0   0   0   1   0   0   0   0   0   4   5   0  52   0   0   8   8  19   2    98    0    0   1.476     49  0.38
  649  650 A   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0    98    0    0   0.000      0  1.00
  650  651 A   0   1   0   0   0   0   1   0   0   0   3   0   0  70   0   0   0   0  24   0    98    0    0   0.792     26  0.59
  651  652 A   0   0   0   0  89   0  11   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.351     11  0.98
  652  653 A  85   0  15   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.428     14  0.91
  653  654 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0    98    0    0   0.000      0  1.00
  654  655 A   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0    98    0    0   0.000      0  1.00
  655  656 A   7  33  60   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    98    0    0   0.859     28  0.75
  656  657 A   4   1  84   0   0   0   0   0   0   0   0   0   0   0   0  11   0   0   0   0    98    0    0   0.572     19  0.63
  657  658 A   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0    98    0    0   0.000      0  1.00
  658  659 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0    98    0    0   0.000      0  1.00
  659  660 A   0   0   0   0   0   0   0   1   1   0   5   0   0  26   0   0   0  61   5   1    98    0    0   1.093     36  0.45
  660  661 A   5   6   0   0   6   0   0   0   1   0  17  29   0   0   2   6   3  23   1   0    98    0    0   1.947     64  0.10
  661  662 A   0   7   0   0   1   0   0   0   1   0   0   0   0   0   0  88   1   0   2   0    99    0    0   0.519     17  0.65
  662  663 A   0   2   0   0   0   0   0   0   2   0   1  47   0   0  14  23   9   0   0   1    98    0    0   1.445     48  0.26
  663  664 A   0   0   0   0   0   0   0   0  18  71  11   0   0   0   0   0   0   0   0   0    96    0    0   0.799     26  0.63
  664  665 A   0   0   0   0   2   0   0  89   5   0   0   0   1   0   0   1   2   0   0   0    96    0    0   0.518     17  0.75
  665  666 A  11  22  11   1   0   0   0   0  26   0   1   0   0   0   1  24   1   1   0   0    96    0    0   1.759     58  0.16
  666  667 A   2  23  13  50  13   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    96    0    0   1.285     42  0.66
  667  668 A   0   0   0   0   0   0   0   0   4   0   1   0   0   0   0   0   0  55   0  40    96    0    0   0.875     29  0.75
  668  669 A   1   0   0   0   0   0   0   0  17  13   7   0   0  22   0   0   0   0  40   1    96    0    0   1.544     51  0.31
  669  670 A   0   1   0   0  20   0   5   1   4  16   2   3   0  28   0   2   1  15   2   0    96    0    0   2.027     67  0.11
  670  671 A   1  85   0   1   0   0   0   0   0   0   2   0   0   0   1   0   1   0   8   0    96    0    0   0.613     20  0.58
  671  672 A  95   0   4   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0    96    0    0   0.231      7  0.95
  672  673 A   1  59  21  19   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    96    0    0   0.998     33  0.80
  673  674 A   0   0   0   0   0   0   0   0   0   0   0   0   0  64   0   0   7   3   4  22    96    0    0   1.052     35  0.54
  674  675 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0    96    0    0   0.000      0  1.00
  675  676 A   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    96    0    0   0.000      0  1.00
  676  677 A   0   0   0   0   0   0   0   0   0   0   0   7   0   2  88   0   3   0   0   0    96    0    0   0.497     16  0.77
  677  678 A   0   0   0   0   0   0   0   0   1   0   0   0  99   0   0   0   0   0   0   0    96    0    0   0.058      1  0.98
  678  679 A   0   0   0   0   0   0   0   7   0   0   3   0   1   0   0   0   0   0  89   0    96    0    0   0.455     15  0.75
  679  680 A   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0    96    0    0   0.000      0  1.00
  680  681 A 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    96    0    0   0.000      0  1.00
  681  682 A   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    95    0    0   0.000      0  1.00
  682  683 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0    95    0    0   0.000      0  1.00
  683  684 A   0   0   0   0   0   0   0  87  11   0   0   1   0   0   0   0   0   0   0   1    95    0    0   0.451     15  0.82
  684  685 A   2   0  98   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    95    0    0   0.102      3  0.98
  685  686 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0    95    0    0   0.000      0  1.00
  686  687 A   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    95    0    0   0.000      0  1.00
  687  688 A   0   0   0   0   0   0   0   0   2   0  12   1  85   0   0   0   0   0   0   0    95    0    0   0.515     17  0.77
  688  689 A   0   2   0   0   0   0   0   0   1   0   0   2   7   0  87   0   0   0   0   0    95    0    0   0.521     17  0.62
  689  690 A   0   2   0   0   0   0   0   0   9   0   1   1   0   0   0  64  22   0   0   0    95    0    0   1.019     33  0.39
  690  691 A   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0    95    0    0   0.000      0  1.00
  691  692 A   0   0   0   0  86   0  14   0   0   0   0   0   0   0   0   0   0   0   0   0    95    0    0   0.399     13  0.98
  692  693 A   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0    95    0    0   0.000      0  1.00
  693  694 A   0   0   0   0   0   0   0   1   0   0  34  11   0   0   0   0   0   0  54   0    93    0    0   0.989     33  0.45
  694  695 A   0   0   0   0   0   0   0   0   0   0   0   0   0   1  98   1   0   0   0   0    93    0    0   0.119      3  0.97
  695  696 A  12   6  59  11   0   1   0   0   0   0   0   0   0   0   6   4   0   0   0   0    93    0    0   1.341     44  0.46
  696  697 A  23  46  13   0   0   0   0   0   1   6   0   8   0   0   0   0   3   0   0   0    93    0    0   1.488     49  0.40
  697  698 A   0   0   0   0  33   0  66   0   0   0   0   0   0   1   0   0   0   0   0   0    93    0    0   0.692     23  0.94
  698  699 A   0   1   0   0   2   0   2  30  23   4   9   0   0   4   0   0  23   0   0   2    93    0    0   1.812     60  0.20
  699  700 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  41   0  59    93    0    0   0.676     22  0.80
  700  701 A   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    93    0    0   0.000      0  1.00
  701  702 A   3   5   3   0   1   0   0   0   0   0   0   0   0   0  30  57   0   0   0   0    93    0    0   1.109     37  0.41
  702  703 A   0   4   0   0   0   0   0   0   1   0   1   0   0   8   0   1  80   0   1   4    93    0    0   0.842     28  0.65
  703  704 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0    93    0    0   0.000      0  1.00
  704  705 A   0   0   0   0  11   0  89   0   0   0   0   0   0   0   0   0   0   0   0   0    90    0    0   0.349     11  0.98
  705  706 A   0   0   0   1   0   0   1   8   4   0   6   0   1   0  21  32   1  24   0   0    90    0    0   1.735     57  0.21
  706  707 A  34   8  57   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    90    0    0   0.938     31  0.79
  707  708 A   0  99   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    90    0    0   0.061      2  0.99
  708  709 A   0   0   0   1   0   0   0   0  26   0   0  21   3   0   0   0   1   0  48   0    90    0    0   1.243     41  0.30
  709  710 A   0   1   1   0   0   0   0   0  41  54   0   0   0   0   0   1   1   0   0   0    90    0    0   0.896     29  0.58
  710  711 A   0   0   0   0   0   0   0   6   4   0  41   0   0   0   0   1   2  10  32   3    90    4   75   1.508     50  0.35
  711  712 A   7   2  80   2   1   0   0   0   0   0   0   0   0   0   0   0   0   1   6   0    86    0    0   0.806     26  0.74
  712  713 A   1   7   0   1   0   0   0   0   7  82   0   0   0   0   0   1   1   0   0   0    88    5   44   0.734     24  0.59
  713  714 A   0   0   0   0   0   0   0  51   4   1   0   0   0   0   2  31   1   1   0   8    84    0    0   1.279     42  0.29
  714  715 A   1   0   0   1   0   0   0  35   2   0   0   1   0   0   1   4  45   6   0   3    89    0    0   1.429     47  0.35
  715  716 A   0   1   0   0  79   0   2   0   3   2   6   0   1   0   0   3   0   1   0   1    90    0    0   0.944     31  0.45
  716  717 A  11   0  40  31   0   0   3   0   1   1   1   0   1   1   0   2   0   2   4   0    90    0    0   1.645     54  0.31
  717  718 A   0   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0   0   6   0  93    90    0    0   0.275      9  0.94
  718  719 A   1   0   0   0   0   0   0  31   1   2  27   0   0   0   0   2   1   8  22   4    90    0    0   1.706     56  0.37
  719  720 A   1   0   0   0   0   0   0   0   0   0   1   0   0   0  11  82   3   1   0   0    90    0    0   0.668     22  0.78
  720  721 A   3   2   1   0   0   0   0   0   7   0   0   3   0   0   0  55  24   3   1   0    89    0    0   1.380     46  0.31
  721  722 A   5   0   0   0   0   0   1   5  84   0   2   3   0   0   0   0   0   0   0   0    88    0    0   0.679     22  0.75
  722  723 A   0   0   0   0   0   0   0   1  13   0  39  11  36   0   0   0   0   0   0   0    88    0    0   1.293     43  0.47
  723  724 A  10   1   2   3   0   0   0   1   2   0   0   1   0   0   2   6   6  63   0   2    88    0    0   1.465     48  0.37
  724  725 A   0  15   2   2   0   0   0   1   3   0   0   0   0   0   8  67   0   0   1   0    88    0    0   1.141     38  0.40
  725  726 A   6  51  17  25   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0    88    0    0   1.205     40  0.70
  726  727 A   7  70  17   1   0   0   0   0   0   0   0   2   2   0   0   0   0   0   0   0    88    1    0   0.954     31  0.67
  727  728 A   1   0   0   0   0   0   0  40  10   0   2   1   0   0   9  14   1   8   1  11    87    5    3   1.837     61  0.27
  728  729 A   0   0   0   0   0   0   0   1  29   0  54   1   0   1   0   7   2   1   0   2    82    0    0   1.281     42  0.37
  729  730 A   0  48  43   0   0   0   0   2   0   0   1   2   0   0   0   1   1   0   0   0    83    0    0   1.053     35  0.56
  730  731 A   1   0   0   0   0   0   0   6   0   0   0   0   0   1   0   8   6  27   6  45    88    0    0   1.505     50  0.50
  731  732 A  24  43  25   5   0   0   0   0   1   0   0   0   0   0   0   1   0   1   0   0    88    0    0   1.344     44  0.60
  732  733 A   0   0   0   0   0   0   0   6   1   0   0   1   0   0   0   3   0   6   7  76    87    1    0   0.941     31  0.72
  733  734 A   1   6   0   0   0   0   0   1   0  18  16   2   0  45   2   1   4   0   0   4    85    0    0   1.699     56  0.17
  734  735 A   0   0   0   0   0   0   1   0   1   0   9  27   0   0   0   2   2   8  36  13    86    0    0   1.687     56  0.34
  735  736 A   0  26   0   0   0   1   0   5   1   0   2   1   0   0   1   1  44  15   1   1    86    0    0   1.588     53  0.19
  736  737 A   2   0   0   0   7   0  91   0   0   0   0   0   0   0   0   0   0   0   0   0    86    0    0   0.362     12  0.92
  737  738 A   0   0   0   1   0   0   0   0   1   0   0   0   0   0  49  36  12   0   1   0    86    0    0   1.123     37  0.56
  738  739 A   6  12  26   7  46   0   0   0   0   0   0   0   2   0   0   0   0   0   0   1    85    0    0   1.453     48  0.52
  739  740 A   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   1   0   0   0   0    85    0    0   0.064      2  0.96
  740  741 A   2   1   1   0   0   0   0   0   0   0   2   2   0  53   1   6  24   0   7   0    85    0    0   1.452     48  0.37
  741  742 A   0   0   0   0   0   0   0   0   0   0  25  74   0   0   0   0   0   0   1   0    85    0    0   0.620     20  0.60
  742  743 A   0   0   0   1   0   0   0   0   0   0   1   0   1   0   0  96   0   0   0   0    85    0    0   0.191      6  0.90
  743  744 A  82   2  16   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    83    0    0   0.543     18  0.89
  744  745 A   0   2   0   0  98   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    81    0    0   0.116      3  0.99
  745  746 A   0   5   0   0  94   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0    81    0    0   0.263      8  0.93
  746  747 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0  37  62   0   0   1   0    81    0    0   0.720     24  0.70
  747  748 A   0   0   0   0   0   0   0   0  91   0   4   4   0   0   0   0   0   0   0   1    81    0    0   0.381     12  0.86
  748  749 A   0   0   0   0   0   0   0  99   1   0   0   0   0   0   0   0   0   0   0   0    80    0    0   0.067      2  0.98
  749  750 A  35  50   4   0   0   0   0   0   0   0   0   3   0   0   0   0   9   0   0   0    80    0    0   1.143     38  0.46
  750  751 A   3  89   6   3   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    80    0    0   0.464     15  0.90
  751  752 A   0   0   0   0   0   0   0  60  39   0   0   0   0   0   0   0   0   1   0   0    80    0    0   0.729     24  0.66
  752  753 A   1  14   3   0   1   0   5   0   4   0   1  28   0  26   5   0   8   4   1   0    80    0    0   2.030     67  0.10
  753  754 A   0  95   1   3   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0   0    80    0    0   0.251      8  0.93
  754  755 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  94   0   6    79    0    0   0.236      7  0.94
  755  756 A   0   0   0   0   0   0   0   0   3   0   3   0   0   1   0   1   0  84   0   9    79    0    0   0.662     22  0.76
  756  757 A   0  13   1  51   0   1   0   0   1   0   1   0   0   1   4   0   3  24   0   0    79    0    0   1.443     48  0.24
  757  758 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0    78    0    0   0.000      0  1.00
  758  759 A   0   0   0   0   0   0   0   0   5   0   1   0   0   0   0   0   0   1   0  92    78    0    0   0.338     11  0.83
  759  760 A   1  15   1   8   1   0   0   3   0   0   0   0   0   0   0   0   3  45   0  23    78    0    0   1.539     51  0.26
  760  761 A   5   1   4   0   0   0   0   0   1   0   0   1   0   0  22  65   0   0   0   0    78    0    0   1.055     35  0.52
  761  762 A   0  74  24   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0    78    0    0   0.620     20  0.74
  762  763 A   1   0   0   0   0   0   0   3  49   0  17  26   0   0   0   0   0   1   1   1    72    0    0   1.338     44  0.39
  763  764 A   0   0   0   0   0   0   0   2   2   0  15  13   0   0   2   8   6   4   6  42    48    0    0   1.833     61  0.32
  764  765 A  29   0  43   0   0   0   0   0  21   0   0   0   0   0   0   0   0   0   7   0    14    0    0   1.240     41  0.36
  765  766 A  14  14  43   0   0   0   0   0  14   0   7   0   0   0   0   0   0   7   0   0    14    0    0   1.574     52  0.27
  766  767 A   0   0  36   0   0   0   0   0   0   7  14  21   0   0   7  14   0   0   0   0    14    0    0   1.631     54  0.10
  767  768 A   0  14   7   0   0  14   0   7   0   7  14   0   0   0   7   7   0   0  21   0    14    0    0   2.107     70  0.01
  768  769 A   0  21  29  14  36   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    14    0    0   1.334     44  0.61
  769  770 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  93   0   0   7    14    0    0   0.257      8  0.92
  770  771 A   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0     1    0    0   0.000      0  1.00
  771  772 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100     1    0    0   0.000      0  1.00
  772  773 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100     1    0    0   0.000      0  1.00
  773  774 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100     1    0    0   0.000      0  1.00
  774  775 A   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0     1    0    0   0.000      0  1.00
  775  776 A   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0     1    0    0   0.000      0  1.00
  776  777 A   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0     1    0    0   0.000      0  1.00
 AliNo  IPOS  JPOS   Len Sequence
     1   148   191     3 gETKs
     1   308   354     1 rEe
     1   387   434     1 tKf
     1   492   540     4 nHDGKs
     1   652   704     1 gAi
     1   654   707     1 pSg
     2   132   205     4 gRKDHn
     2   290   367     1 nTd
     2   369   447     2 rTKr
     2   446   526     1 pAn
     2   478   559     1 gSh
     2   543   625    16 rIVGLDQVTGMTETAFGs
     2   637   735     1 nAi
     3   138   197     1 tKk
     3   140   200     4 eEDEGs
     3   299   363     1 rEe
     3   378   443     1 tKv
     3   483   549     4 nHLGKs
     3   485   555     1 pNf
     3   550   621     1 gEp
     3   644   716     1 nAi
     4   138   146     5 dTPRVKs
     4   140   153     1 sGr
     4   234   248     1 gDk
     4   298   313     3 sSRAd
     4   299   317     1 dQa
     4   378   397     2 rTSs
     4   380   401     4 gAYADd
     4   551   576     7 eTDDVEGAt
     5    24    66     1 nGk
     5   160   203     3 hKGKk
     5   162   208     1 dTs
     5   320   367     1 nTd
     5   399   447     1 kTh
     5   401   450     1 rQg
     5   476   526     1 pNn
     5   506   557     3 eQGNh
     5   571   625    16 rIVGLDQMAKMTESSLPs
     6    25    66     1 nGk
     6   160   202     2 sHKg
     6   161   205     1 gKk
     6   163   208     1 dTs
     6   321   367     1 nTd
     6   400   447     1 kTh
     6   402   450     1 rQg
     6   477   526     1 pNn
     6   507   557     3 eQGSh
     6   572   625    16 rIVGLDQMAKMTESSLPs
     6   666   735     1 nAi
     7   138   201     5 gDPMGKk
     7   140   208     4 nQPATk
     7   299   371     1 rEe
     7   378   451     1 tKl
     7   483   557     4 nHLGKs
     7   485   563     1 pNl
     7   550   629     8 sSDSADHGGe
     7   644   731     1 sAi
     7   646   734     1 pEd
     8    14    66     1 nGk
     8   149   202     2 sHKg
     8   150   205     1 gRk
     8   152   208     1 dHn
     8   310   367     1 nTd
     8   389   447     2 rTKr
     8   466   526     1 pAn
     8   496   557     3 eQGSh
     8   561   625    16 rIVGLDQVTGMTETAFGs
     8   655   735     1 nAi
     9   146   200     3 aSKKd
     9   147   204     5 dEEEEQk
     9   149   211     1 qSg
     9   218   281     1 gLe
     9   308   372     1 rEe
     9   387   452     1 tKh
     9   492   558     4 nHMGKs
     9   494   564     1 pNf
     9   559   630     2 dGDs
     9   653   726     1 nVi
    10    26    66     1 sGk
    10   161   202     2 sHKt
    10   162   205     1 tKr
    10   164   208     2 dQLl
    10   322   368     1 hTd
    10   401   448     2 kTKr
    10   478   527     1 pAn
    10   508   558     3 eQGTh
    10   573   626    14 hIVGLDKVSGMSEMPg
    10   667   734     1 nAi
    11    22    65     1 nGk
    11   157   201     2 sHKg
    11   158   204     1 gKk
    11   317   364     1 rNq
    11   397   445     2 kTKr
    11   474   524     1 pNn
    11   504   555     3 tQGNh
    11   569   623    16 rVVGLDTLAKMSDTSMPs
    12   148   203     4 gDRGKk
    12   150   209     3 dNPNa
    12   309   371     1 rEe
    12   388   451     1 tKq
    12   493   557     4 nHLGKs
    12   560   628    11 aVDIVLGDSGKGk
    12   654   733     1 aAi
    12   656   736     1 pEg
    13   160   204     5 gEGIGKk
    13   162   211     4 sQAPAt
    13   166   219     1 gGt
    13   321   375     1 rEe
    13   400   455     1 tKl
    13   505   561     4 nHLGKs
    13   507   567     1 pNf
    13   572   633    11 sSYTSGEHKTGVk
    13   666   738     1 nAi
    13   668   741     1 pDd
    14   150   204     3 gEKKk
    14   152   209     3 eEPGk
    14   311   371     1 rEe
    14   390   451     1 tKq
    14   495   557     4 qHLGKs
    14   562   628     8 gADAESGGKk
    15    56    72     1 nQk
    15   191   208     2 sHKg
    15   192   211     1 gRk
    15   194   214     1 dHg
    15   352   373     1 nTd
    15   431   453     2 rTKr
    15   508   532     1 pAg
    15   538   563     3 eQGTh
    15   603   631    16 rIVGLDTVSGMTDTAFGs
    15   697   741     1 nAi
    16   147   202     1 vSg
    16   148   204     1 gKk
    16   150   207     3 dAASe
    16   309   369     1 rEe
    16   388   449     1 tKq
    16   493   555     4 nHLGKn
    16   560   626    11 gADSAQDSKGGKg
    16   654   731     1 sAn
    16   656   734     1 pEg
    17   143   202     1 mSg
    17   144   204     3 gPKKa
    17   146   209     4 ePVPGk
    17   305   372     1 rEe
    17   384   452     1 tKq
    17   489   558     4 qHLGKc
    17   556   629     5 aAEEGGg
    17   650   728     1 sVi
    17   652   731     1 pEg
    18   147   202     1 vSg
    18   148   204     1 gKk
    18   150   207     3 dAASe
    18   309   369     1 rEe
    18   388   449     1 tKq
    18   493   555     4 nHLGKn
    18   560   626    11 gADSAQDSKGGKg
    18   654   731     1 sAn
    18   656   734     1 pEg
    19    56    66     1 nGk
    19   191   202     2 sHKg
    19   192   205     7 gKKDSSITq
    19   194   214     2 gPSf
    19   352   374     1 nTd
    19   431   454     1 kTh
    19   433   457     1 rQg
    19   508   533     1 pNn
    19   538   564     3 eQGNh
    19   603   632    16 rIVGLDQMAKMTESSLPs
    19   697   742     1 nAi
    20   119   155     4 gEKKKe
    20   121   161     4 eITSGk
    20   280   324     1 rEe
    20   330   375     1 vSn
    20   358   404     1 tKq
    20   463   510     4 qHLGKs
    20   530   581    11 tAEGEGAGGGAKk
    20   624   686     1 sAi
    20   626   689     1 pEg
    21   198   198     2 sHKs
    21   199   201     1 sKk
    21   357   360     1 nTd
    21   436   440     2 kTKr
    21   513   519     1 pAg
    21   543   550     3 eQGTh
    21   608   618    16 rIIGLDQVAGMSETALPg
    21   702   728     1 nSi
    22    26   112     1 tGk
    22   161   248     8 sKPKGSGAVp
    22   162   257     5 pHPAVLi
    22   164   264     4 sSHQEt
    22   321   425     1 rNn
    22   401   506     2 rTKr
    22   506   613     3 aHSMh
    22   570   680    12 iVGMAQQALTDTQf
    23   147   202     1 vSg
    23   148   204     1 gKk
    23   150   207     3 dAASe
    23   309   369     1 rEe
    23   388   449     1 tKq
    23   493   555     4 nHLGKn
    23   560   626    11 gADSAQDSKGGKg
    23   654   731     1 sAn
    23   656   734     1 pEg
    24   133   200     3 gDKKk
    24   135   205     4 eEQSGk
    24   294   368     1 rEe
    24   373   448     1 tKq
    24   478   554     4 qHLGKs
    24   544   624     7 gEAEGGGKk
    24   638   725     1 sAi
    24   640   728     1 pEg
    25   144   204     3 gDKKk
    25   146   209     4 eQQPGk
    25   305   372     1 rEe
    25   384   452     1 tKq
    25   489   558     4 qHLGKs
    25   556   629    10 gAEAGDSGGSKk
    25   650   733     1 sAi
    25   652   736     1 pEg
    26   148   202     1 aPg
    26   149   204     2 gLKk
    26   151   208     3 dAAAe
    26   310   370     1 rEe
    26   389   450     1 tKq
    26   494   556     4 nHLGKs
    26   561   627    13 gADSVQESGGKGKGg
    26   655   734     1 sSi
    26   657   737     1 pEg
    27   148   203     4 gDRSKk
    27   150   209     3 eNPNa
    27   309   371     1 rEe
    27   388   451     1 tKq
    27   493   557     4 nHLGKs
    27   560   628     9 sADTGDSGKGk
    27   654   731     1 aAi
    27   656   734     1 pEg
    28   142   202     1 mSg
    28   143   204     3 gPKKp
    28   145   209     4 ePVPGk
    28   304   372     1 rEe
    28   383   452     1 tKq
    28   488   558     4 qHLGKc
    28   555   629     7 aAEAEGGGk
    29   135   203     3 gPKKa
    29   137   208     4 eAVPGk
    29   296   371     1 rEe
    29   375   451     1 tTn
    29   480   557     4 qHLGKc
    29   547   628     6 eAEAAGKk
    30    22    65     1 nGk
    30   157   201     2 sHKg
    30   158   204     1 gKk
    30   317   364     1 rNq
    30   369   417     7 rPTEHHADf
    30   397   452     2 kTKr
    30   474   531     1 pNn
    30   504   562     3 tQGNh
    30   569   630    16 rVVGLDTLAKMSDTSMPs
    31   129   203     2 sGKk
    31   131   207     3 dAASe
    31   290   369     1 rEe
    31   369   449     1 tKq
    31   474   555     4 nHLGKn
    31   541   626    11 gADSAQDSKGGKg
    31   635   731     1 sAn
    31   637   734     1 pEg
    32    62    62     1 nGk
    32   197   198     2 sHKs
    32   198   201     1 sKk
    32   356   360     1 nTd
    32   435   440     2 kTKr
    32   512   519     1 pAg
    32   542   550     3 eQGTh
    32   607   618    16 rIVGLDQVAGMGDTALPg
    32   701   728     1 nAi
    33    56    66     1 nGk
    33   191   202     2 sHKg
    33   192   205     1 gRk
    33   194   208     1 dHn
    33   352   367     1 nTd
    33   431   447     2 rTKr
    33   508   526     1 pAn
    33   538   557     3 eQGSh
    33   603   625    16 rIVGLDQVTGMTETAFGs
    33   697   735     1 nAi
    34   159   183     2 sKKd
    34   161   187     4 dDDPSk
    34   319   349     1 rEe
    34   398   429     1 tKv
    34   503   535     4 nHLGKs
    34   505   541     1 pNf
    34   570   607     3 dPSQs
    34   664   704     1 nAi
    35   144   204     3 gDKKk
    35   146   209     4 eEAAAk
    35   305   372     1 rEe
    35   384   452     1 tKq
    35   489   558     4 qHLGKs
    35   556   629     8 aTDAEGGSKk
    35   650   731     1 sAi
    35   652   734     1 pEg
    36   137   137     3 gDKKk
    36   139   142     4 eEQSGk
    36   298   305     1 rEe
    36   377   385     1 tKq
    36   482   491     4 qHLGKs
    36   549   562    10 gAEAESGGGGKk
    37   151   152     3 gEKKk
    37   153   157     4 eEQPGk
    37   312   320     1 rEe
    37   391   400     1 tKq
    37   496   506     4 qHLGKs
    37   563   577    10 gADAEAGGGGKk
    37   657   681     1 sAi
    37   659   684     1 pEg
    38   149   206     3 gEKKk
    38   151   211     3 eEPGk
    38   310   373     1 rEe
    38   389   453     1 tKq
    38   494   559     4 qHLGKs
    38   561   630     8 gADAESGGKk
    38   655   732     1 sAi
    38   657   735     1 pEg
    39   136   136     3 gDKKk
    39   138   141     4 eEQSGk
    39   297   304     1 rEe
    39   376   384     1 tKq
    39   481   490     4 qHLGKs
    39   548   561    10 gAEAESGGGGKk
    40   136   205     3 gEKKk
    40   138   210     4 eEQSGk
    40   297   373     1 rEe
    40   376   453     1 tKq
    40   481   559     4 qHLGKs
    40   548   630    11 gAEAEASAGAGKk
    40   642   735     1 sAi
    40   644   738     1 pEg
    41   132   203     5 gQKGDEe
    41   134   210     4 eEKKDe
    41   371   451     1 tKa
    41   476   557     4 nHLGKs
    41   543   628     6 pAAASGGp
    41   637   728     1 nAi
    42    59    60     1 sGk
    42   194   196     2 sFKt
    42   195   199     2 tKKd
    42   197   203     4 qSSIAl
    42   354   364     1 rNs
    42   359   370     1 sMp
    42   433   445     2 kTKr
    42   510   524     1 pNg
    42   540   555     3 eLGNn
    42   605   623    15 rIVGLDKVAGMGESLHg
    42   699   732     1 nAi
    43   124   205     4 gPEKKk
    43   126   211     4 eQAAGk
    43   285   374     1 rEe
    43   364   454     1 tKq
    43   469   560     4 qHLGKc
    43   536   631     6 eETGGGKk
    43   630   731     1 sVi
    43   632   734     1 pEg
    44   141   202     1 mSg
    44   142   204     3 gPKKa
    44   144   209     4 ePVPGk
    44   303   372     1 rEe
    44   382   452     1 tKq
    44   487   558     4 qHLGKc
    44   554   629     6 aAEAEGGg
    44   648   729     1 sVi
    44   650   732     1 pEg
    45   138   206     3 gEKKk
    45   140   211     3 dESGk
    45   299   373     1 rEe
    45   378   453     1 tKq
    45   483   559     4 qHLGKs
    45   550   630     8 sAEADSSAKk
    45   644   732     1 sAi
    45   646   735     1 pEg
    46    58    60     1 sGk
    46   193   196     2 sFKt
    46   194   199     2 tKKd
    46   196   203     4 qSSIAl
    46   353   364     1 rNs
    46   433   445     2 kTKr
    46   510   524     1 pNg
    46   540   555     3 eLGNn
    46   605   623    15 rIVGLDKVAGMGESLHg
    46   699   732     1 nAi
    47   152   173     7 lGEVRDGGg
    47   153   181     4 gFGGKk
    47   389   421     2 eLKr
    47   492   526     4 nHAGKs
    47   504   542     1 kVk
    47   559   598    12 gSNSQNGEGKKPKk
    47   653   704     1 qVv
    48    54   114     1 tGk
    48   189   250     3 sKPKg
    48   190   254     4 gSGAVp
    48   192   260     2 hPAv
    48   326   396     1 dFn
    48   348   419     1 rNn
    48   428   500     2 rTKr
    48   534   608     3 hSMHp
    48   597   674    12 iVGMAQQALTDTQf
    48   691   780     1 nVi
    49   142   201     1 mSg
    49   143   203     3 gPKKa
    49   145   208     4 ePVPGk
    49   304   371     1 rEe
    49   383   451     1 tKq
    49   488   557     4 qHLGKc
    49   555   628     5 aAEEGGg
    49   649   727     1 sVi
    49   651   730     1 pEg
    50    59    60     1 sGk
    50   194   196     2 sFKt
    50   195   199     2 tKKd
    50   197   203     4 qSSIAl
    50   354   364     1 rNs
    50   359   370     1 sMp
    50   433   445     2 kTKr
    50   510   524     1 pNg
    50   540   555     3 eLGNn
    50   605   623    15 rIVGLDKVAGMGESLHg
    50   699   732     1 nAi
    51   133   204     4 sGAKKq
    51   135   210     4 ePVAGk
    51   294   373     1 rEe
    51   373   453     1 tKq
    51   478   559     4 qHLGKc
    51   545   630     9 aAEAEGGGGKk
    51   639   733     1 sVi
    51   641   736     1 pEg
    52   124   205     4 gPEKKk
    52   126   211     4 eQAAGk
    52   285   374     1 rEe
    52   364   454     1 tKq
    52   469   560     4 qHLGKc
    52   536   631     6 eETGGGKk
    52   630   731     1 sVi
    52   632   734     1 pEg
    53   147   202     1 vSg
    53   148   204     1 gKk
    53   150   207     3 dAASe
    53   309   369     1 rEe
    53   316   377     1 gTe
    53   388   450     1 tKq
    53   493   556     4 nHLGKn
    53   560   627    11 gADSAQDSKGGKg
    53   654   732     1 sAn
    53   656   735     1 pEg
    54   144   204     3 gAKKa
    54   146   209     4 ePTPGk
    54   305   372     1 rEe
    54   384   452     1 tKq
    54   489   558     4 qHLGKt
    54   556   629     9 aADEAAASGKk
    54   650   732     1 sVi
    54   652   735     1 pEg
    55   120   121     5 gDPGKKk
    55   122   128     3 ePSNs
    55   281   290     1 rEe
    55   360   370     1 tKq
    55   465   476     4 qHLGKc
    55   532   547     7 aSEADSGKg
    55   626   648     1 sAi
    55   628   651     1 pDg
    56   149   206     3 gEKKk
    56   151   211     3 dESRk
    56   310   373     1 rEe
    56   389   453     1 tKq
    56   494   559     4 qHLGKs
    56   561   630     8 sAEADSNTKk
    56   655   732     1 sAi
    56   657   735     1 pEg
    57   146   196     1 sQs
    57   147   198     1 sKk
    57   149   201     2 aASk
    57   308   362     1 rEe
    57   389   444     2 dLSr
    57   492   549     4 qHQGKh
    57   504   565     1 gKq
    57   547   609     1 gNq
    57   559   622    16 tQEDVAAATARGAAKATg
    57   670   749     4 gVLANk
    58   144   203     5 gDPGKKk
    58   146   210     3 ePSNs
    58   305   372     1 rEe
    58   384   452     1 tKq
    58   489   558     4 qHLGKc
    58   556   629     7 aSEADSGKg
    58   650   730     1 sAi
    58   652   733     1 pDg
    59   145   204     4 gDKKKe
    59   147   210     4 eATSGk
    59   306   373     1 rEe
    59   385   453     1 tKq
    59   490   559     4 qHLGKs
    59   557   630     9 aAEAEGGGGKk
    59   651   733     1 sAi
    59   653   736     1 pEg
    60   198   198     2 sHKs
    60   199   201     1 sKk
    60   357   360     1 nTd
    60   436   440     2 kTKr
    60   513   519     1 pAg
    60   543   550     3 eQGSh
    60   608   618    16 rIVGLDQVAGMSDTALPg
    60   702   728     1 nAi
    61    62    62     1 nGk
    61   197   198     2 sHKs
    61   198   201     1 sKk
    61   356   360     1 nTd
    61   435   440     2 kTKr
    61   512   519     1 pAg
    61   542   550     3 eQGSh
    61   607   618    16 rIVGLDQVAGMSDTALPg
    61   701   728     1 nAi
    62    59    60     1 sGk
    62   194   196     2 sFKt
    62   195   199     2 tKKd
    62   197   203     4 qSSIAl
    62   354   364     1 rNs
    62   359   370     1 sMp
    62   433   445     2 kTKr
    62   510   524     1 pNg
    62   540   555     3 eLGNn
    62   605   623    15 rIVGLDKVAGMGESLHg
    62   699   732     1 nAi
    63   148   204     4 gEKKKe
    63   150   210     4 eATSGk
    63   309   373     1 rEe
    63   388   453     1 tKq
    63   493   559     4 qHLGKs
    63   560   630    12 aAAEAESGGGGGKk
    63   654   736     1 sAi
    63   656   739     1 pEg
    64   145   203     4 gEKKSk
    64   147   209     4 dEAPGk
    64   306   372     1 rEe
    64   385   452     1 tKq
    64   490   558     4 qHLGKs
    64   557   629     8 aTDADAGSKg
    64   651   731     1 sAi
    64   653   734     1 pEg
    65   147   200     3 sQKKe
    65   149   205     4 eAASGa
    65   153   213     1 kGs
    65   218   279     1 gLe
    65   281   343     1 dEv
    65   308   371     1 rEe
    65   387   451     1 tKt
    65   492   557     4 nHEKKs
    65   494   563     1 kNf
    65   559   629     3 dESGg
    65   653   726     1 nAi
    66   137   137     2 gGKk
    66   139   141     3 dSAAa
    66   298   303     1 rEe
    66   377   383     1 tKq
    66   482   489     4 nHLGKs
    66   518   529    12 gADSGPTQESKGKg
    66   612   635     1 sAi
    66   614   638     1 pEg
    67   131   205     4 gGDKKk
    67   133   211     4 eQAAGk
    67   292   374     1 rEe
    67   371   454     1 tKq
    67   476   560     4 qHLGKc
    67   543   631     6 eETGGGKk
    67   637   731     1 sVi
    67   639   734     1 pEg
    68    12    68     1 tKe
    68   148   205     4 gPEKKk
    68   150   211     4 eQASGk
    68   309   374     1 rEe
    68   388   454     1 tKq
    68   493   560     4 qHLGKc
    68   494   565     1 cNa
    68   559   631     6 eETGGGKk
    68   653   731     1 sVi
    68   655   734     1 pEg
    69     8    68     1 tQe
    69   144   205     4 gGEKKk
    69   146   211     1 eGk
    69   305   371     1 rEe
    69   384   451     1 tKq
    69   489   557     4 qHLGKs
    69   556   628     4 eDTTKk
    69   650   726     1 gVi
    69   652   729     1 pEg
    70    58    65     1 nGk
    70   193   201     2 sHKg
    70   194   204     1 gKk
    70   196   207     1 dTt
    70   354   366     1 nTd
    70   358   371     1 sMp
    70   432   446     2 kTKr
    70   509   525     1 pNn
    70   539   556     3 eQGNh
    70   540   560     1 hIk
    70   603   624    16 rIVGLDQMAKMTESSLPs
    70   697   734     1 gAi
    71   153   204     3 gGKKs
    71   155   209     4 eHVTGk
    71   314   372     1 rEe
    71   393   452     1 tKq
    71   498   558     4 qHLGKs
    71   499   563     1 sAp
    71   564   629     8 sTEAEGGAKk
    71   658   731     1 sVi
    71   660   734     1 pEg
    72    56    66     1 nGk
    72   191   202     2 sHKg
    72   192   205    11 gRKDHNIPQESPk
    72   194   218     1 pVk
    72   352   377     1 nTd
    72   431   457     2 rTKr
    72   508   536     1 pAn
    72   538   567     3 eQGSh
    72   697   767     1 nAi
    73    10    68     1 sNe
    73   146   205     3 aEKKq
    73   148   210     2 qSGk
    73   307   371     1 rEe
    73   386   451     1 tKq
    73   491   557     4 qHLGKs
    73   558   628     7 aEDIDTTKk
    73   652   729     1 sVi
    73   654   732     1 pEg
    74    59    60     1 sGk
    74   194   196     2 sHKt
    74   195   199     2 tKRd
    74   197   203     4 qNSLAf
    74   355   365     1 hTd
    74   359   370     1 sMp
    74   433   445     2 kTKr
    74   510   524     1 pAn
    74   540   555     3 eQGTh
    74   605   623    14 hIVGLDKVSGMSEMPg
    74   699   731     1 nAi
    75    56    66     1 nGk
    75   191   202     2 sHKg
    75   192   205    11 gRKDHNIPQESPk
    75   194   218     1 pVk
    75   352   377     1 nTd
    75   431   457     2 rTKr
    75   508   536     1 pAn
    75   538   567     3 eQGSh
    75   697   766     1 nAi
    76   146   203     5 gEKKKDe
    76   148   210     4 pQQTGk
    76   307   373     1 rEe
    76   386   453     1 tKq
    76   491   559     4 qHLGKs
    76   558   630     8 aTDADSGSKk
    76   652   732     1 sAi
    76   654   735     1 pEg
    77   165   201     2 tQQa
    77   166   204     3 aAEKk
    77   168   209     1 eGt
    77   327   369     1 rEe
    77   406   449     1 aKq
    77   408   452     1 iEr
    77   511   556     4 qHLGKh
    77   523   572     1 gKq
    77   566   616     2 tSCk
    77   578   630    14 tQEEAAEAAKSGTGGg
    77   688   754     4 dKLVTd
    78    44   107     1 pHl
    78   113   177     2 rAAg
    78   269   335     3 kEHDs
    78   270   339     1 sSa
    78   350   420     2 dINs
    78   453   525     3 hFRSh
    79     9    68     1 tQe
    79   144   204     1 sGg
    79   145   206     4 gGDKKk
    79   147   212     2 eASk
    79   306   373     1 rEe
    79   385   453     1 tKq
    79   490   559     4 qHLGKn
    79   557   630     4 eDTTKk
    79   651   728     1 gVi
    79   653   731     1 pEg
    80    45   109     1 pHi
    80   115   180     1 aAt
    80   118   184     1 gRt
    80   219   286     1 kCf
    80   270   338     3 kEIDs
    80   271   342     1 sSv
    80   321   393     1 aLv
    80   349   422     1 qDh
    81    44   126     1 pNl
    81   113   196     1 rSg
    81   117   201     1 gRt
    81   218   303     1 sCi
    81   269   355     3 tEADs
    81   270   359     1 sSv
    81   351   441     1 pSs
    81   520   611     4 eENTKs
    82    38   123     1 pHl
    82   107   193     2 kAQa
    82   110   198     1 gRs
    82   211   300     1 nCi
    82   262   352     3 sEADs
    82   263   356     1 sSm
    82   313   407     1 aAl
    82   343   438     1 pDs
    82   446   542     3 kFKDn
    83    44   109     1 pHl
    83   113   179     2 rAVg
    83   116   184     1 dRn
    83   142   211    13 nCLPSYGATVLVGYk
    83   216   298     1 kVy
    83   241   324     1 sHe
    83   245   329     6 sIFSSYQe
    83   267   357     3 kEHDs
    83   268   361     1 sSv
    83   348   442     2 dMNs
    83   461   557     1 aKf
    83   474   571     7 gKARSTQTi
    84   148   205     4 gEKKKe
    84   150   211     4 eTTSGk
    84   220   285     1 rEe
    84   270   336     1 vTn
    84   298   365     1 tKq
    84   403   471     4 qHLGKs
    84   470   542    11 tAEAEAGGGGGKk
    84   564   647     1 sAi
    84   566   650     1 pEg
    85   137   202     1 iSd
    85   138   204     3 dRSKk
    85   140   209     4 eQQVDk
    85   299   372     1 rEe
    85   349   423    15 gTLEDQIIQANPALEAf
    85   350   439     7 fGNAKTVAy
    85   378   474     1 tKq
    85   465   562     4 nHLGKs
    85   582   683     1 aAi
    85   584   686     1 pEg
    86    46   110     1 pNl
    86   115   180     1 rSg
    86   119   185     1 gRt
    86   220   287     1 sCi
    86   271   339     3 tEADs
    86   272   343     1 sSv
    86   322   394     1 aTv
    86   352   425     1 pSs
    87   146   204     3 gGKKe
    87   148   209     4 qQSSGk
    87   226   291     1 kIk
    87   311   377     1 tKq
    87   416   483     4 qHLGKn
    87   483   554     8 gAEDAGGAKk
    87   577   656     1 sVi
    87   579   659     1 pEg
    88    46   110     1 pSl
    88   115   180     1 rSg
    88   119   185     1 eRt
    88   220   287     1 aCi
    88   271   339     3 rEVDs
    88   272   343     1 sSi
    88   322   394     1 aTi
    88   352   425     1 pDs
    88   455   529     3 kFKTh
    89    51    62     1 gGv
    89    97   109     1 pHl
    89   166   179     1 rSg
    89   170   184     1 gRt
    89   271   286     1 kYy
    89   322   338     3 eEIDs
    89   323   342     1 sSv
    89   404   424     1 pNs
    89   507   528     3 tYPKn
    89   662   686     1 eVl
    90    14    32     4 gYLAGw
    90   172   194     8 eSAAGAVPEg
    90   175   235     4 aTITTs
    90   332   396     1 rTd
    90   412   477     2 pTSk
    90   487   554     1 tSa
    90   489   557    21 nGQGGGTVSGHGPGGGGAGVGWi
    90   517   606     4 iWSPPg
    90   518   611     5 gLDEEQp
    90   519   617     1 pAh
    90   584   683    15 dAGAGVVGGAGAAFGGv
    90   678   792     1 gVi
    91   128   253     3 sKKEk
    91   130   258     3 eEPGk
    91   237   403     1 gKi
    91   289   456     1 rEe
    91   339   507     1 vAy
    91   367   536     1 tKq
    91   446   707    21 iDWVFIDFGMDLLACIELIEKPm
    91   474   756     4 nHLGKs
    91   486   772     1 pGq
    91   541   828    12 gQSGDAGGGGGGKg
    91   635   934     1 nAv
    92    52    65     1 dGv
    92    98   112     1 pNl
    92   167   182     1 hKg
    92   171   187     1 gRt
    92   272   289     1 nCy
    92   323   341     3 eEVDs
    92   324   345     1 sSa
    92   405   427     1 pDs
    92   508   531     3 sFKSh
    92   571   597     2 eDIv
    93   157   229     5 tQSASAg
    93   158   235     1 gKt
    93   160   238     2 eEGk
    93   181   261     2 gDRn
    93   318   400     3 pREEq
    93   319   404     1 qAe
    93   326   484     1 iTf
    93   398   557     2 aKEi
    93   400   561     7 qREPNPLLc
    93   503   671     4 qHLGKh
    93   515   687     1 gKq
    93   558   731     1 gNq
    93   680   887     4 dKLCNd
    94    50    63     1 aGv
    94    96   110     1 pHl
    94   165   180     1 rSg
    94   169   185     1 gRt
    94   270   287     1 nCy
    94   321   339     3 qEIDs
    94   322   343     1 sSk
    94   372   394     1 aAl
    94   402   425     1 pDa
    94   506   530     3 yKAHk
    95    92    97     1 sKl
    95   287   293     1 rSp
    95   314   321     2 sYQm
    95   336   345     2 dADs
    95   386   397     1 aTn
    95   415   427     2 nVKq
    95   517   531     4 tHLKTc
    95   580   598    23 kATSPTGQTPGTGGRTRLSIKPDKg
    95   674   715     1 qKd
    96   124   253     1 qKk
    96   126   256     3 dPSQe
    96   258   422     1 dDg
    96   262   427     2 mRIt
    96   284   451     3 rIPGv
    96   285   455     1 vNd
    96   364   599     1 tKq
    96   443   827    21 iLWTFMDFGLDLQPTIDLIEKPm
    96   471   876     4 nHLGKs
    96   472   881     1 sAp
    96   482   892     1 pGc
    96   537   948    14 gQSGDASGGAGGKGAg
    96   631  1056     1 nLi
    97   169   201     2 iIRg
    97   170   204    13 gPWLLGLLVSEQQAe
    97   172   219     4 pPHPLp
    97   227   278     8 sCESGRVEEd
    97   278   337    24 gVITVDNMDDGEELIATDVRAAASGe
    97   327   410     1 rEe
    97   406   490     1 tKl
    97   485   695    21 iDWVFIDFGLDLQPCIDLIEKPl
    97   513   744     4 nHAGKs
    97   525   760     1 kRk
    97   580   816    11 gSCSSEPPKSGVk
    97   674   921     1 sAi
    97   676   924     1 pDd
    98   119   251     3 sTKKp
    98   120   255     5 pTEEQQk
    98   225   365    18 gKTTIPNVDDNEECRLTDGk
    98   278   436     1 rEe
    98   328   487     1 vSy
    98   356   516     1 tKq
     +                   HHMFVLEQEEYKREGi
    98   435   915    21 vPWKFIDFGLDLQACIDLIEKPm
    98   463   964     4 nHLGKs
    98   475   980     1 pGq
    98   530  1036     8 gQSGGAEAKg
    98   624  1138     1 aTm