Complet list of 2hzi hssp fileClick here to see the 3D structure Complete list of 2hzi.hssp file
THRESHOLD  according to: t(L)=(290.15 * L ** -0.562) + 5
REFERENCE  Sander C., Schneider R. : Database of homology-derived protein structures. Proteins, 9:56-68 (1991).
CONTACT    Maintained at by Maarten L. Hekkelman 
DATE       file generated on 2014-05-20
HEADER     TRANSFERASE                             09-AUG-06   2HZI
DBREF      2HZI A  229   500  UNP    P00519   ABL1_HUMAN     229    500
DBREF      2HZI B  229   500  UNP    P00519   ABL1_HUMAN     229    500
NCHAIN        2 chain(s) in 2HZI data set
KCHAIN        1 chain(s) used here ; chains(s) : A
NALIGN       50
NOTATION : ID: EMBL/SWISSPROT identifier of the aligned (homologous) protein
NOTATION : STRID: if the 3-D structure of the aligned protein is known, then STRID is the Protein Data Bank identifier as taken
NOTATION : from the database reference or DR-line of the EMBL/SWISSPROT entry
NOTATION : %IDE: percentage of residue identity of the alignment
NOTATION : %SIM (%WSIM):  (weighted) similarity of the alignment
NOTATION : IFIR/ILAS: first and last residue of the alignment in the test sequence
NOTATION : JFIR/JLAS: first and last residue of the alignment in the alignend protein
NOTATION : LALI: length of the alignment excluding insertions and deletions
NOTATION : NGAP: number of insertions and deletions in the alignment
NOTATION : LGAP: total length of all insertions and deletions
NOTATION : LSEQ2: length of the entire sequence of the aligned protein
NOTATION : ACCNUM: SwissProt accession number
NOTATION : PROTEIN: one-line description of aligned protein
NOTATION : SeqNo,PDBNo,AA,STRUCTURE,BP1,BP2,ACC: sequential and PDB residue numbers, amino acid (lower case = Cys), secondary
NOTATION : structure, bridge partners, solvent exposure as in DSSP (Kabsch and Sander, Biopolymers 22, 2577-2637(1983)
NOTATION : VAR: sequence variability on a scale of 0-100 as derived from the NALIGN alignments
NOTATION : pair of lower case characters (AvaK) in the alignend sequence bracket a point of insertion in this sequence
NOTATION : dots (....) in the alignend sequence indicate points of deletion in this sequence
NOTATION : SEQUENCE PROFILE: relative frequency of an amino acid type at each position. Asx and Glx are in their
NOTATION : acid/amide form in proportion to their database frequencies
NOTATION : NOCC: number of aligned sequences spanning this position (including the test sequence)
NOTATION : NDEL: number of sequences with a deletion in the test protein at this position
NOTATION : NINS: number of sequences with an insertion in the test protein at this position
NOTATION : ENTROPY: entropy measure of sequence variability at this position
NOTATION : RELENT: relative entropy, i.e.  entropy normalized to the range 0-100
NOTATION : WEIGHT: conservation weight

## PROTEINS : identifier and alignment statistics
    1 : Q9PWS3_MLVAB        1.00  1.00    1  268  119  386  268    0    0  818  Q9PWS3     Gag-abl gene product (Fragment) OS=Abelson murine leukemia virus PE=4 SV=1
    2 : G3PAB4_GASAC        0.92  0.97    1  268  226  493  268    0    0  607  G3PAB4     Uncharacterized protein OS=Gasterosteus aculeatus PE=4 SV=1
    3 : E9GB51_DAPPU        0.77  0.93    1  266    5  270  266    0    0  270  E9GB51     Putative uncharacterized protein (Fragment) OS=Daphnia pulex GN=DAPPUDRAFT_5206 PE=3 SV=1
    4 : SRK2_SPOLA          0.53  0.76    1  265   86  348  265    2    2  362  P42688     Tyrosine-protein kinase SRK2 (Fragment) OS=Spongilla lacustris GN=SRK2 PE=2 SV=1
    5 : Q9PVU9_LETRI        0.51  0.74   36  265    4  232  230    1    1  245  Q9PVU9     Src-like B (Fragment) OS=Lethenteron reissneri PE=2 SV=1
    6 : V9IH22_APICE        0.51  0.74   46  263    1  217  218    1    1  249  V9IH22     Tyrosine-protein kinase Src42A OS=Apis cerana GN=ACCB08470 PE=2 SV=1
    7 : Q5U175_DROME        0.50  0.73   46  265    1  222  222    1    2  235  Q5U175     RE19378p OS=Drosophila melanogaster GN=Src42A PE=2 SV=1
    8 : V4AEP1_LOTGI        0.50  0.76   36  265   10  238  230    1    1  249  V4AEP1     Uncharacterized protein OS=Lottia gigantea GN=LOTGIDRAFT_172047 PE=4 SV=1
    9 : V4B9Z9_LOTGI        0.50  0.69   46  265    1  224  224    2    4  237  V4B9Z9     Uncharacterized protein OS=Lottia gigantea GN=LOTGIDRAFT_237974 PE=4 SV=1
   10 : G9K7Z3_MUSPF        0.49  0.72   38  265   10  236  228    1    1  247  G9K7Z3     Lymphocyte-specific protein tyrosine kinase (Fragment) OS=Mustela putorius furo PE=2 SV=1
   11 : T1E221_9DIPT        0.49  0.73    1  265   54  316  268    3    8  329  T1E221     Putative catalytic domain of fyn-related kinase-like protein tyrosine kinase (Fragment) OS=Psorophora albipes PE=2 SV=1
   12 : T1G3H9_HELRO        0.48  0.73   36  264    8  237  230    1    1  250  T1G3H9     Uncharacterized protein (Fragment) OS=Helobdella robusta GN=HELRODRAFT_78992 PE=4 SV=1
   13 : W8B5E0_CERCA        0.48  0.72   14  266    2  254  254    2    2  258  W8B5E0     Tyrosine-protein kinase Btk29A OS=Ceratitis capitata GN=BTKL PE=2 SV=1
   14 : U3I607_ANAPL        0.47  0.69    1  235   10  242  235    2    2  242  U3I607     Uncharacterized protein (Fragment) OS=Anas platyrhynchos GN=FGR PE=3 SV=1
   15 : A8Q317_BRUMA        0.46  0.71    1  265  120  381  265    3    3  395  A8Q317     Protein-tyrosine kinase, putative OS=Brugia malayi GN=Bm1_41725 PE=4 SV=1
   16 : M3WXI7_FELCA        0.45  0.69   36  262   11  231  227    3    6  259  M3WXI7     Uncharacterized protein (Fragment) OS=Felis catus GN=MATK PE=4 SV=1
   17 : T1FP44_HELRO        0.45  0.71    1  265   55  319  266    2    2  327  T1FP44     Uncharacterized protein OS=Helobdella robusta GN=HELRODRAFT_186886 PE=4 SV=1
   18 : U3I628_ANAPL        0.44  0.64    1  235   27  260  239    4    9  260  U3I628     Uncharacterized protein (Fragment) OS=Anas platyrhynchos GN=FGR PE=4 SV=1
   19 : H2WQ88_CAEJA        0.43  0.69    1  266   88  351  270    4   10  364  H2WQ88     Uncharacterized protein OS=Caenorhabditis japonica GN=WBGene00138116 PE=4 SV=2
   20 : I3MQD8_SPETR        0.43  0.70    2  264    1  261  263    2    2  265  I3MQD8     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=3 SV=1
   21 : E9HBK3_DAPPU        0.41  0.63    1  265    1  285  285    7   20  313  E9HBK3     Putative uncharacterized protein (Fragment) OS=Daphnia pulex GN=DAPPUDRAFT_60789 PE=3 SV=1
   22 : G3T7L2_LOXAF        0.41  0.62    1  268  236  531  299    7   34  539  G3T7L2     Uncharacterized protein OS=Loxodonta africana GN=LCK PE=4 SV=1
   23 : H0YV01_TAEGU        0.41  0.65   10  268   53  316  266    5    9  328  H0YV01     Uncharacterized protein (Fragment) OS=Taeniopygia guttata GN=EPHA2 PE=3 SV=1
   24 : S4R915_PETMA        0.41  0.64   46  267    4  246  244    6   23  252  S4R915     Uncharacterized protein (Fragment) OS=Petromyzon marinus PE=4 SV=1
   25 : C3YM64_BRAFL        0.39  0.62    4  266    3  282  282    6   21  309  C3YM64     Putative uncharacterized protein (Fragment) OS=Branchiostoma floridae GN=BRAFLDRAFT_225325 PE=3 SV=1
   26 : R7TLA1_CAPTE        0.39  0.67    1  264   58  326  271    6    9  330  R7TLA1     Uncharacterized protein OS=Capitella teleta GN=CAPTEDRAFT_178598 PE=3 SV=1
   27 : A7RW90_NEMVE        0.38  0.60   41  263    2  244  244    8   22  253  A7RW90     Predicted protein OS=Nematostella vectensis GN=v1g163453 PE=4 SV=1
   28 : H3BPR7_HUMAN        0.38  0.59   12  265    2  286  287    8   35  286  H3BPR7     Tyrosine-protein kinase receptor TYRO3 (Fragment) OS=Homo sapiens GN=TYRO3 PE=3 SV=1
   29 : U3IR81_ANAPL        0.38  0.63    7  247   21  279  259    6   18  279  U3IR81     Tyrosine-protein kinase receptor (Fragment) OS=Anas platyrhynchos GN=NTRK2 PE=3 SV=1
   30 : V4B9P3_LOTGI        0.38  0.60   14  266    2  270  269    7   16  298  V4B9P3     Uncharacterized protein (Fragment) OS=Lottia gigantea GN=LOTGIDRAFT_107599 PE=3 SV=1
   31 : H3BAW8_LATCH        0.37  0.63    5  264    4  284  281    5   21  296  H3BAW8     Tyrosine-protein kinase receptor (Fragment) OS=Latimeria chalumnae PE=3 SV=1
   32 : T1EI21_HELRO        0.37  0.61   16  254    1  267  267    6   28  267  T1EI21     Uncharacterized protein (Fragment) OS=Helobdella robusta GN=HELRODRAFT_133652 PE=3 SV=1
   33 : V8P0B3_OPHHA        0.37  0.63    5  264   17  297  281    5   21  309  V8P0B3     Tyrosine-protein kinase receptor (Fragment) OS=Ophiophagus hannah GN=NTRK3 PE=3 SV=1
   34 : C3YIG6_BRAFL        0.36  0.59   10  261    1  270  271    8   20  270  C3YIG6     Putative uncharacterized protein (Fragment) OS=Branchiostoma floridae GN=BRAFLDRAFT_241990 PE=3 SV=1
   35 : C3Y4Y2_BRAFL        0.35  0.59    1  253   15  289  275   11   22  289  C3Y4Y2     Putative uncharacterized protein (Fragment) OS=Branchiostoma floridae GN=BRAFLDRAFT_255484 PE=3 SV=1
   36 : C3YGZ0_BRAFL        0.35  0.59   16  266    2  278  277   12   26  288  C3YGZ0     Putative uncharacterized protein (Fragment) OS=Branchiostoma floridae GN=BRAFLDRAFT_220364 PE=3 SV=1
   37 : C3ZWR7_BRAFL        0.35  0.59    4  263   15  292  282   10   26  292  C3ZWR7     Putative uncharacterized protein (Fragment) OS=Branchiostoma floridae GN=BRAFLDRAFT_241702 PE=3 SV=1
   38 : Q70W10_CIOIN        0.34  0.59    2  268   98  392  299   12   36  395  Q70W10     Fibroblast growth factor receptor (Fragment) OS=Ciona intestinalis GN=fgfr PE=2 SV=1
   39 : C3ZIW9_BRAFL        0.33  0.58    2  261    1  282  283   11   24  282  C3ZIW9     Putative uncharacterized protein (Fragment) OS=Branchiostoma floridae GN=BRAFLDRAFT_148158 PE=4 SV=1
   40 : J9BEW9_WUCBA        0.33  0.55    1  267  211  526  319   12   55  612  J9BEW9     TK protein kinase OS=Wuchereria bancrofti GN=WUBG_03305 PE=4 SV=1
   41 : Q4RM64_TETNG        0.33  0.52    4  262   54  365  312    9   53  410  Q4RM64     Chromosome 10 SCAF15019, whole genome shotgun sequence. (Fragment) OS=Tetraodon nigroviridis GN=LTK PE=3 SV=1
   42 : X1YR73_ANODA        0.33  0.55    1  267  464  783  320    8   53  809  X1YR73     Uncharacterized protein OS=Anopheles darlingi PE=4 SV=1
   43 : A7RVT8_NEMVE        0.32  0.53    1  268   18  318  302   10   35  318  A7RVT8     Predicted protein (Fragment) OS=Nematostella vectensis GN=v1g94997 PE=3 SV=1
   44 : C3YJF0_BRAFL        0.32  0.57    2  261    1  277  281   11   25  279  C3YJF0     Putative uncharacterized protein (Fragment) OS=Branchiostoma floridae GN=BRAFLDRAFT_157795 PE=3 SV=1
   45 : G3U477_LOXAF        0.32  0.56    5  264    5  324  320    7   60  336  G3U477     Tyrosine-protein kinase receptor (Fragment) OS=Loxodonta africana GN=NTRK3 PE=3 SV=1
   46 : L1IC02_GUITH        0.32  0.55    2  264    1  269  278   11   24  276  L1IC02     Uncharacterized protein (Fragment) OS=Guillardia theta CCMP2712 GN=GUITHDRAFT_81534 PE=3 SV=1
   47 : D8RFU9_SELML        0.31  0.59    8  264    2  263  266   10   13  266  D8RFU9     Putative uncharacterized protein (Fragment) OS=Selaginella moellendorffii GN=SELMODRAFT_146775 PE=4 SV=1
   48 : G6CZ59_DANPL        0.31  0.51    1  265  269  582  314    9   49  616  G6CZ59     Tyrosine-protein kinase receptor torso OS=Danaus plexippus GN=KGM_18755 PE=3 SV=1
   49 : E9GD15_DAPPU        0.30  0.55    2  261    7  311  308   13   51  311  E9GD15     Putative uncharacterized protein (Fragment) OS=Daphnia pulex GN=DAPPUDRAFT_4284 PE=4 SV=1
   50 : Q1HTP2_HAPBU        0.30  0.47    3  268  572  908  339   12   75 1024  Q1HTP2     Tyrosine-protein kinase receptor OS=Haplochromis burtoni GN=pdgfrbb PE=3 SV=1
## ALIGNMENTS    1 -   50
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....1....:....2....:....3....:....4....:....5....:....6....:....7
     1  233 A D    >         0   0  115   19   15  DDDD      D  DD DDD DD   D        G    D DH    D  
     2  234 A K  T 3   +     0   0  161   25   79  KKEM      Q  VQ KAQKGE   V        R  QRI RDR E TR 
     3  235 A W  T 3  S+     0   0   48   26    2  WWWW      W  WW WWWWWW   F        W  WWW WFW W WWW
     4  236 A E  B <   +a   72   0A  60   29    8  EEEE      E  EE EEEEEE  EN        E EEEEEEEQ E EEE
     5  237 A M        -     0   0   26   32   47  MMII      I  II IIVIFV  FL    I I K VLKLVFFIIV VFI
     6  238 A E    >   -     0   0  133   32   67  EEES      D  PD DADDPP  PH    K K K DKKEPPPDKD RPD
     7  239 A R  G >  S+     0   0   78   33   45  RRRR      R  RR RRRPRR  RR  R R R I PRIRRRESRV PRR
     8  240 A T  G 3  S+     0   0  105   34   76  TTTD      T  ER RERTHE  SG  H R R K SEKRKHESRKTEND
     9  241 A D  G <  S+     0   0   58   34   72  DDDS      S  SS TSSERT  QD  N D D H RDHnNRRQDDQRRH
    10  242 A I  E <   -B   29   0A   9   36   26  IIII      L  LI LIVLLLI LL  I I ILL VILiILLLILLLLV
    11  243 A T  E     -B   28   0A  59   36   81  TTAT      K  QR TSRAHKT DE  V L ITT TLTYTKVTVTFLTV
    12  244 A M  E     +B   27   0A  49   37   43  MMML      F  LL KLLFVLR IL LL L LLP LLPDLVLLLLLLFL
    13  245 A K  E     -     0   0A  87   37   87  KKKI      V  LV IDIIIVQ KH GK M KGG GHGDLFGGKGGHGG
    14  246 A H  E     -     0   0A 101   39   67  HHQR      R EKR EERKSEK EE RRRR RKP QEPQRNKDRKHEMQ
    15  247 A K  E     -B   25   0A  69   39   82  KKKK      K EKQ IKQEIRV AK MELE EVL RRLKAISMELKVEV
    16  248 A L  S >  S+     0   0   36   41   21  LLLL      L LLI LLIILLI LL LLLLLLLIIIIILLLLILLFIIL
    17  249 A G  G >  S-     0   0   34   40    5  GGGG      G GGG G.GGGGG GG GGGGGGGGGGDGGGGGGGGAGGG
    18  250 A G  G 3  S-     0   0   81   40   68  GGGA      S SNA S.ASEAA QA KEHEEEKEESEESHEQMESSEAS
    19  251 A G  G X  S+     0   0   34   40    0  GGGG      G GGG G.GGGGG GG GGGGGGGGGGGGGGGGGGGGGGG
    20  252 A Q  T <  S+     0   0  106   41   71  QQQQ      Q QQQ NGQQCQE EN EAAAEAQMMAFMAAAAAASAAHA
    21  253 A Y  T 3  S-     0   0   32   41    9  YYYF      F FFF FIFFFFF FF FFFFFFFFFFFFFFFFFFFHFFF
    22  254 A G  S <  S-     0   0   21   41    3  GGGG      G GGG GGGGGGG GG GGGGGGGGGGGGGGGGGGGSGGG
    23  255 A E  S    S+     0   0    1   41   77  EEDE      D VEE EVEVQEE TS SKEKKKEQRLQLSEQQLKDRVRR
    24  256 A V  E     - C   0  39A  21   40    7  VVVV      . VVV VPVVVVV VV VVVVVVVVVVVVVVVVVVVLVVV
    25  257 A Y  E     -BC  15  38A  41   40   67  YYYY      . RWW WGWHWWY YM RFYFVFRRIYFRYYWLTFYYRVV
    26  258 A E  E     + C   0  37A  30   40   77  EVEQ      . RME RPELKMK KK ELQLMLLKQRRKKERRQLKHRKE
    27  259 A G  E     -BC  12  36A   0   40   33  GGAG      . GGG GGGGCGG AG AAGAAAGAAAAGGGCAAAGGGAA
    28  260 A V  E     -BC  11  35A  38   41   84  VVML      V KTR TTREQYT EV QEFEKEEQQTDKRQEENEMITET
    29  261 A W  E >>> -BC  10  34A  31   41   77  WWWW      W WWW WWWWAYL AF LCLCLCLLLLLLLLAALCWYLAI
    30  262 A K  G >45S+     0   0  100   40   90  KKKN      E .NN NNNRLNK WR KYAYKYRRRTIRILTIAYLKAVS
    31  263 A K  G 345S+     0   0  158   41   79  KKRN      g RGH SGSAnGr qr qnsnvnkttrrtggdglnGgPgg
    32  264 A Y  G <45S-     0   0  127   34   87  YYY.      n GT. ...Hg.k gq sdededvrgregekgkgd.vAkh
    33  265 A S  T <<5 +     0   0  107   40   86  SNNS      T STS TTNLSHE VL FKDKIKTQDTKENPVMQK.ANHS
    34  266 A L  E   < -C   29   0A  77   41   81  LLMT      T IKT RTVPSTV TI VILMIMQLIEVLCMSRQMAVKKT
    35  267 A T  E     +C   28   0A  49   40   83  TTTP      P D.P QKQVFKP TP KLKLDLTDTDDADQIDTLEKDTK
    36  268 A V  E     -CD  27  84A   0   45   23  VVVVV  V  VVTVVVVVVAVVV VV VVVVVVVVVVAVVVTKVVVVVVA
    37  269 A A  E     -CD  26  83A  12   45   19  AAAAA  A  AAAAAAAAAIAAA AA AAAAAAAAAVAAAAAFAAAMAAA
    38  270 A V  E     -CD  25  82A   1   45   32  VVVVI  I VIIVVVVIVV.VVI VV VVVVVVVAAVVAVIVRAVVRVVV
    40  272 A T  E     - D   0  80A   0   46   65  TTTTT  T STTMTMNLTKATST ET MTTTMATTTTMTKTTSMARPMMM
    41  273 A L        +     0   0   25   47   23  LLLLL  L LLLMLLVMLLILLL LLLLLLLLLLVVVLVLLLFILLELVV
    42  274 A K  S    S+     0   0  123   47   31  KKKKK  K KKKKKKKKKKNKKK KKKKKPKKKKRRKKRLPKrRKrEkRK
    43  275 A E  S    S-     0   0  121   44   79  EEEAP  V QSEEPSCPPAEEQV GQAADTDDDEVVE.V.EEkFDaDyS.
    44  276 A D        +     0   0  123   46   71  DDDGG  G GGGGGGDGGGGSGG MDGDALPCPFEENSEEINGNPREPQ.
    45  277 A T  S    S+     0   0   74   47   68  TTTTT  T STTTTTVTTTSASY TEVISCTTTADDATDYCAADTGESTP
    48  280 A V  H  > S+     0   0   45   51   78  VVLPPPPPAPPVEPPAKPPEkPkAannsaqagarssdesqqascaaread
    49  281 A E  H  > S+     0   0    7   50   76  EEKAEKKAEDKEDENQTESEqDv.tsqekikrkerrllrsmskqkkrrdq
    62  294 A K        +     0   0  167   51   75  KKKRRRRRRQRRQRRQRRRSkQCTgQRDQNQNQghhgghgSeghQRHggg
    63  295 A H    >   -     0   0   27   51   10  HHHHHHHHHHHHHHHHHHHHhHHHhHHHHHHHHhqdhhqhHhheHHHhhh
    64  296 A P  T 3  S+     0   0   90   51   77  PPPPDATDRQNNPDPKPDPSPQHPTREPEPEEDDrnKKrEEIKkEVRPVL
    65  297 A N  T 3  S+     0   0   16   51   48  NNNKKKKKKRKRNKKNKKKRNRNNNNNHHNHNHNnnNNnRNNNnHNNHNN
    73  305 A C  E     + E   0  80A   4   50   37  CCCC.CCCCVCCCVCICVCCCVVCCCCsCCCcCCIIcCIISCCNCCCccC
    74  306 A T        +     0   0   42   47   64  TTTTVTTTTTTSSS.LSVTIT.SAT..gVFVsGTTTvTTTLTTIGTKriT
    98  330 A C  S  < S-     0   0   28   51   92  CCAEGKIGDPKDHPRRDPgRscKcsarShshfhnIfcnFlnsrKhEnlhk
    99  331 A N    >>  -     0   0   95   51   70  NDNADGASQPGKEPGGGPpKgpEpggsRgpqpqpkdepgdphpkqrpddk
   100  332 A R  T 34 S+     0   0  139   51   81  RKRGGKgKGGRGTWRRGWMGggGggRaIrrkskgkdgrnqgkpkkwSvty
   101  333 A Q  T 34 S+     0   0  165   41   84
   102  334 A E  T <4 S+     0   0  107   46   82  EEEAYLSLSKLRLDNLKD.LHKEVSEK.EGDGEQED.PDVLIE.E.SETE
   103  335 A V  S  < S+     0   0    0   47   65  VVILLNLGVLKLITCVLT.RLLFSLLVGLLLHMLYI.LLILLY.L.LLIP
   104  336 A N     >  -     0   0   67   48   81  SNDKKLKLRTLKGQASTQ.KSTGLSTTETKGGGPANETLTSTT.G.PTCA
   107  339 A V  H  > S+     0   0   13   51   78  VVVQQLTLIKLdgQQQVQQLDKQaDKAfQDQDQQNdVAIQEDDHQLVDDe
   108  340 A L  H  X S+     0   0   26   45   43  LLLLL.L.LL.alRLLLRL.LLLkLVLlMLMLMLFf.L.LLLTLMKTLLp
   144  376 A L    <   -     0   0   58   51   70  LVLIIVIEESIAVVCVMVSIVSVVTFTTLrLILTLVKVVNvTVVLTCTVL
   154  386 A R  E     +I  127   0C  56   51   13  RRRRRRRKrRRRRRRKkrrRrRrqRkrrrrrrrrrrerrrrrrrrRRrrr
   155  387 A L        -     0   0   23   48   56  LLLLLLLVlLLVYLL.lwlYiLdi.glivivvviyyiinyiiiyvF.vml
   156  388 A M    >   -     0   0  108   49   81  MMMIIIIIHIIIVII.KLIVMIDY.LYYYYYYYYATYRTRYVYNYKCYYL
   162  394 A T  E     -J  183   0D  15   51   84  TTTNTEENETEETCEKVSEIETTKEKRRRKRFRVrsRrNKgEVprvsKeI
   163  395 A A        -     0   0    2   49   77  AAAAAAAPAAAASPAGFPASRA.ASAIQVKVKVTrdQtRSrR.hssgQgA
   165  397 A A  T 3  S+     0   0   41   51   68  AAAEQIVQEEVQGPVDEPTSSESETSGCGGGSGTgeRGgGgStggNAGGG
   166  398 A G  T 3  S+     0   0   51   46   70  GGGGGGGGNGGGGGGSGGGGEGGNKARAHKHKHKdhL.d.rEseh..N.N
   167  399 A A    <   -     0   0   22   49   64  AAAAAAAATAASTAASSAAAGAGDTGVSTATGTSERQ.EGAGGQTRDG.S
   182  414 A N     <  +     0   0   35   51   78  NNNNGSSGRGSGTGNGQGNNNGRNRFGNRGRRRHGGgNDYGNRLREkRYN
   204  436 A G  S     S-     0   0    2   51    5  YYYYYYYYYYYYYYYYYYYFYYYYYYYYWYWYWYyyYYyYYYYyWWFYYY
   210  442 A G  T 3  S+     0   0   88   51   40  GGGGGGGGGGGGRGGKGGGNGGEGGGDGQGQGQQggGGgGCGGnQDeGgd
   211  443 A I    <   -     0   0   40   51   51  IIIMMMMMMMMMLMMMMMMKMMLMMLLILCLILTllLVlIKILpLMqVnp
   229  461 A P    >   -     0   0   12   51    3  PPPPPPPPPPPPPPPPPPPPPPPPPPspPPPPPPPPPPPPPPPPPpPPPP
   230  462 A E  T 3  S+     0   0  192   46   77  EEPVPPPKHDPPKGVEPGAHE.LDRDpgRERLR.PPE.P.QEQARpEH.D
   231  463 A G  T 3  S+     0   0   70   51   71  GGGTSGNDgNNSSNGGGNNLHdDGHQelTGVSVaEGNqGdNHNEVGNNdH
   232  464 A C    <   -     0   0    5   51   17  CCCTCCCCcCCCCCCCCCCACcCCCCcsCCCCCcCCCaCcCCCCCCCCaA
   245  477 A Q    <   -     0   0   93   49   73  QQHKKNHDNKNKS HEH RHEKQANRASQTQNQERRRERAQAMSQQSRKE
   252  484 A P        -     0   0   17   48   15  PPPPPPPPPPPPP PPP PPPPPPPPPP PLPLPPPPPPPPPPPLPPPPP
   253  485 A S     >  -     0   0   23   48   65  SSTTTTTTTTTTS TPT TAATKSESDS SNSNTTTSQTDNGHKNKGTTS
   254  486 A F  H  > S+     0   0    0   47   28  FFFFFFFFFFFFF FFF FFFFFFFFFF FIFIF PFFPFFFFPIMFFFF
   255  487 A A  H  > S+     0   0   36   46   75  AAQEEEEEEDEER ERD ETSDAARRHT SK KP DRREGSPGEKRPTSS
   256  488 A E  H  > S+     0   0  120   46   80  EEEAYTTYSYTYI TKS TEEYDSKDDC TE EQ ESQGTTETVEEEEQS
   257  489 A I  H  X S+     0   0    1   46   25  IIILLLLLLLLLL LLL LLLLIVIIIL II IL ILLIIIVLLIVILLL
   258  490 A H  H  X S+     0   0   25   46   87  HHHQQQQFHRQYK QAF QLVRVQQVHR VY YK EKVERLVVRYQVVQL
   259  491 A Q  H  X S+     0   0  109   46   83  QQHWAWWNNSWSE WEH WQQSSHQESM NK KS KDEEQEEEEKANSEI
   260  492 A A  H  X S+     0   0   32   46   86  AAGRFKKFLVKVQ KKI KVLVIVTLFE KI LT RKDRKRMRRIRTRMT
   261  493 A F  H  X S+     0   0    2   46   14  FFLLLLLFFLLML LLL LLLLLLVLLL IL LL LILLLILLLLLLLIM
   262  494 A E  H  X S+     0   0   55   42   56  EEEEEEEDDEEDA EAD ETEEDADREE EH H  LDD ANDG HLED G
   263  495 A T  H  X S+     0   0   45   40   71  TTNDDDDDDDDDL D D DEQDKRTKNN KA A  QKR S RN AEQA N
   264  496 A M  H  X S+     0   0   30   37   45  MMMFY FYYFFFV L F LILFLMLF I SL L  L M Q LV LMLL M
   265  497 A F  H >< S+     0   0   58   29   38  FFFFF YFFFF A F I F LFIHM  L L     L L L LL    L V
   266  498 A Q  H 3< S+     0   0  132   17   70  QHQ         Q     N  TRAE    E     P A E QE      T
   267  499 A E  H 3<        0   0  149   11   73  ED                   AAQ             S D TR      D
   268  500 A S    <<        0   0  101    8   70  SS                   TP              S    N      D
 SeqNo PDBNo   V   L   I   M   F   W   Y   G   A   P   S   T   C   H   R   K   Q   E   N   D  NOCC NDEL NINS ENTROPY RELENT WEIGHT
    1  233 A   0   0   0   0   0   0   0   5   0   0   0   0   0   5   0   0   0   0   0  89    19    0    0   0.409     13  0.84
    2  234 A   8   0   4   4   0   0   0   4   4   0   0   4   0   0  20  20  16  12   0   4    25    0    0   2.166     72  0.20
    3  235 A   0   0   0   0   8  92   0   0   0   0   0   0   0   0   0   0   0   0   0   0    26    0    0   0.271      9  0.98
    4  236 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   3  93   3   0    29    0    0   0.299      9  0.91
    5  237 A  19   9  41   9  16   0   0   0   0   0   0   0   0   0   0   6   0   0   0   0    32    0    0   1.587     52  0.53
    6  238 A   0   0   0   0   0   0   0   0   3  25   3   0   0   3   3  19   0  16   0  28    32    0    0   1.740     58  0.32
    7  239 A   3   0   6   0   0   0   0   0   0   9   3   0   0   0  76   0   0   3   0   0    33    0    0   0.916     30  0.55
    8  240 A   0   0   0   0   0   0   0   3   0   0   9  21   0   9  21  12   0  18   3   6    34    0    0   2.011     67  0.24
    9  241 A   0   0   0   0   0   0   0   0   0   0  18   6   0   9  18   0   9   3   9  29    34    0    0   1.885     62  0.28
   10  242 A   8  50  42   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    36    0    0   0.918     30  0.74
   11  243 A  11   8   3   0   3   0   3   0   6   0   3  39   0   3   6   8   3   3   0   3    36    0    0   2.143     71  0.19
   12  244 A   5  59   3  11   8   0   0   0   0   5   0   0   0   0   3   3   0   0   0   3    37    0    0   1.459     48  0.57
   13  245 A   8   5  14   3   3   0   0  30   0   0   0   0   0   8   0  22   3   0   0   5    37    0    0   1.978     66  0.12
   14  246 A   0   0   0   3   0   0   0   0   0   5   3   0   0  10  28  15  10  21   3   3    39    0    0   1.965     65  0.33
   15  247 A  10  10   8   5   0   0   0   0   5   0   3   0   0   0   8  28   5  18   0   0    39    0    0   2.078     69  0.17
   16  248 A   0  68  29   0   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    41    0    0   0.711     23  0.79
   17  249 A   0   0   0   0   0   0   0  95   3   0   0   0   0   0   0   0   0   0   0   3    40    0    0   0.233      7  0.94
   18  250 A   0   0   0   3   0   0   0  10  17   0  22   0   0   5   0   5   5  30   3   0    40    0    0   1.866     62  0.31
   19  251 A   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0    40    0    0   0.000      0  1.00
   20  252 A   0   0   0   7   2   0   0   2  34   0   2   0   2   2   0   0  32  10   5   0    41    0    0   1.750     58  0.28
   21  253 A   0   0   2   0  85   0  10   0   0   0   0   0   0   2   0   0   0   0   0   0    41    0    0   0.543     18  0.90
   22  254 A   0   0   0   0   0   0   0  98   0   0   2   0   0   0   0   0   0   0   0   0    41    0    0   0.115      3  0.97
   23  255 A  10   7   0   0   0   0   0   0   0   0   7   2   0   0  10  12  12  32   0   7    41    0    0   1.996     66  0.22
   24  256 A  95   3   0   0   0   0   0   0   0   3   0   0   0   0   0   0   0   0   0   0    40    0    0   0.233      7  0.93
   25  257 A   8   3   3   3  13  17  32   3   0   0   0   3   0   3  15   0   0   0   0   0    40    0    0   1.962     65  0.32
   26  258 A   3  15   0   8   0   0   0   0   0   3   0   0   0   3  17  22  10  20   0   0    40    0    0   1.948     65  0.23
   27  259 A   0   0   0   0   0   0   0  55  40   0   0   0   5   0   0   0   0   0   0   0    40    0    0   0.845     28  0.67
   28  260 A  12   2   2   5   2   0   2   0   0   0   0  17   0   0   7   7  12  24   2   2    41    0    0   2.233     74  0.15
   29  261 A   0  34   2   0   2  34   5   0  12   0   0   0  10   0   0   0   0   0   0   0    41    0    0   1.546     51  0.23
   30  262 A   3   8   8   0   0   3  10   0   8   0   3   5   0   0  15  20   0   3  17   0    40    0    0   2.243     74  0.09
   31  263 A   2   2   0   0   0   0   0  27   2   2   7   7   0   2  15  10   5   0  15   2    41    0    0   2.216     73  0.21
   32  264 A   6   0   0   0   0   0  12  21   3   0   3   3   0   6   6  12   3  12   3  12    34    0    0   2.351     78  0.13
   33  265 A   5   5   3   3   3   0   0   0   3   3  17  15   0   5   0  13   5   5  13   5    40    0    0   2.469     82  0.14
   34  266 A  12  15  12  12   0   0   0   0   2   2   5  17   2   0   5   7   5   2   0   0    41    0    0   2.348     78  0.18
   35  267 A   3  10   3   0   3   0   0   0   3  13   0  22   0   0   0  15   8   3   0  20    40    0    0   2.088     69  0.17
   36  268 A  87   0   0   0   0   0   0   0   7   0   0   4   0   0   0   2   0   0   0   0    45    0    0   0.528     17  0.77
   37  269 A   2   0   2   2   2   0   0   0  91   0   0   0   0   0   0   0   0   0   0   0    45    0    0   0.423     14  0.81
   38  270 A  71   0  16   0   0   0   0   0   9   0   0   0   0   0   4   0   0   0   0   0    45    0    0   0.885     29  0.67
   39  271 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   2  96   2   0   0   0    46    0    0   0.209      6  0.94
   40  272 A   0   2   0  20   0   0   0   0   7   2   7  52   0   0   2   4   0   2   2   0    46    0    0   1.567     52  0.35
   41  273 A  15  72   4   4   2   0   0   0   0   0   0   0   0   0   0   0   0   2   0   0    47    0    0   0.950     31  0.76
   42  274 A   0   2   0   0   0   0   0   0   0   4   0   0   0   0  15  74   0   2   2   0    47    0    0   0.883     29  0.68
   43  275 A  11   0   0   0   2   0   2   2  11   9   7   2   2   0   0   2   7  27   0  14    44    0    0   2.221     74  0.21
   44  276 A   0   2   2   2   2   0   0  37   2   9   4   0   2   0   2   0   2  11   7  15    46    0    0   2.088     69  0.29
   45  277 A   4   0   2   0   0   0   4   2  11   2  11  47   4   0   0   0   0   4   0   9    47    0    0   1.825     60  0.32
   46  278 A   4  10   4  40   0   0   0   2   6   0  12   6   0   0   6   0   0   2   2   6    50    0    0   2.019     67  0.23
   47  279 A   0   2   0   0   0   0   0   0  12   2  24   6   0   0   0   2  10  24   2  18    51    0    0   1.942     64  0.33
   48  280 A   8   2   0   0   0   0   0   2  22  24  10   0   2   0   4   6   6   8   4   4    51    0    0   2.244     74  0.22
   49  281 A   2   4   2   2   0   0   0   0   4   0   8   4   0   0  12  20  10  22   2   8    50    0    0   2.243     74  0.23
   50  282 A   0   0   0   0   0   0   0   2  22   0   4   2   0   0   0   2   2  14   2  51    51    0    0   1.459     48  0.53
   51  283 A   0  18   0   0  82   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    51    0    0   0.466     15  0.94
   52  284 A   0  57   8   4   4   0   8   0   4   0   0   0   0   4   4   2   6   0   0   0    51    0    0   1.599     53  0.41
   53  285 A   0   0   0   2   0   0   0   2  20   0  14   6   0   2  20  14   0  18   2   2    51    0    0   2.042     68  0.22
   54  286 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0    51    0    0   0.000      0  1.00
   55  287 A   6  14   4   4   2   0   0   0  67   0   0   4   0   0   0   0   0   0   0   0    51    0    0   1.168     38  0.47
   56  288 A   2   2   0   0   0   0   0   0  25   0   6   2   0   0   4  14  24  10   6   6    51    0    0   2.047     68  0.27
   57  289 A  20  25  49   0   0   0   0   0   2   0   0   0   2   0   0   0   2   0   0   0    51    0    0   1.249     41  0.65
   58  290 A   2  33   0  65   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    51    0    0   0.725     24  0.91
   59  291 A  12   0   4   2   0   0   0   2   8   0   6  14   0   2   0  49   2   0   0   0    51    0    0   1.676     55  0.28
   60  292 A   4   2   0   0   0   0   2   2   4   0   6   4   0   6  10  27   8  14  10   2    51    0    0   2.305     76  0.22
   61  293 A  20  57   8   4  10   0   0   0   0   0   0   0   2   0   0   0   0   0   0   0    51    0    0   1.272     42  0.70
   62  294 A   0   0   0   0   0   0   0  18   0   0   4   2   2  10  29  10  18   2   4   2    51    0    0   1.990     66  0.25
   63  295 A   0   0   0   0   0   0   0   0   0   0   0   0   0  92   0   0   4   2   0   2    51    0    0   0.356     11  0.90
   64  296 A   4   2   2   0   0   0   0   0   2  27   2   4   0   2  10  10   4  14   6  12    51    0    0   2.268     75  0.22
   65  297 A   0   0   0   0   0   0   0   0   0   0   0   0   0  12  10  24   0   0  55   0    51    0    0   1.149     38  0.51
   66  298 A  18  47  35   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    51    0    0   1.028     34  0.71
   67  299 A  76   6  16   0   0   0   0   0   2   0   0   0   0   0   0   0   0   0   0   0    51    0    0   0.739     24  0.85
   68  300 A   0   0   0   0   0   0   0   2   2   0   8   2   0   0  24  16  37   0  10   0    51    0    0   1.657     55  0.37
   69  301 A   2  76   0   6  14   0   0   0   0   0   0   0   2   0   0   0   0   0   0   0    51    0    0   0.799     26  0.85
   70  302 A  10  35  10   4   0   0  39   0   0   0   0   0   0   0   0   0   0   2   0   0    51    0    0   1.394     46  0.43
   71  303 A   0   0   0   0   0   0   0  66  32   0   0   0   0   0   0   0   0   0   2   0    50    0    0   0.717     23  0.73
   72  304 A  67   4   0   2   2   0   0   0  14   0   0   0  10   0   2   0   0   0   0   0    51    0    0   1.129     37  0.51
   73  305 A  10   0  10   0   0   0   0   0   0   0   4   0  74   0   0   0   0   0   2   0    50    0    0   0.890     29  0.63
   74  306 A  11   4   6   0   2   0   0   6   2   0  13  51   0   0   2   2   0   0   0   0    47    0    0   1.658     55  0.36
   75  307 A  10   6   0   0   0   0   0   2   0   2   4  14   0   2  16  16   8  10   2  10    51    0    0   2.338     78  0.18
   76  308 A   0   2   2   0   0   0   4  16   0   4   8   8   2   2   2  10   6  27   2   6    51    0    0   2.322     77  0.21
   77  309 A   0   4   0   0   0   0   0  10   6  18   0   2   0   0   4   8   0  27   2  20    51    0    0   1.983     66  0.30
   78  310 A   2   4   6   2   0   0   0   0   0  70   0   0   0   2   2   0   0  10   2   0    50    0    0   1.169     39  0.47
   79  311 A   6  24  27   4  14   0   8   0   0   4   0   2   0   0   4   8   0   0   0   0    51    0    0   1.992     66  0.33
   80  312 A   2   2  14   8   6   4  51   0   0   0   2   0  12   0   0   0   0   0   0   0    51    0    0   1.592     53  0.46
   81  313 A  14  22  54  10   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    50    0    0   1.171     39  0.71
   82  314 A  39  14  43   2   0   0   0   0   0   0   0   0   0   0   2   0   0   0   0   0    51    0    0   1.157     38  0.72
   83  315 A  10  20   4   4  10   0   0   0   0   0   0  49   2   0   0   0   0   2   0   0    51    0    0   1.533     51  0.33
   84  316 A   0   0   0   0   0   0   0   0   0   2   2   2   0   2   0   0   0  92   0   0    51    0    0   0.384     12  0.87
   85  317 A   2  18   0   0  33   2  43   0   0   0   0   0   0   0   0   0   0   2   0   0    51    0    0   1.266     42  0.74
   86  318 A   6   8   2  57   0   0   0   0  14   0   2   2   8   0   0   0   0   0   0   2    51    0    0   1.468     49  0.39
   87  319 A   0   0   0   4   0   0   0   0   6  20  20   6   4   0   4  20   4  10   2   2    51    0    0   2.182     72  0.23
   88  320 A   0   2   0   4   2   0  10  10   0   0   0   0   0  28   2  16   4   2  16   4    50    0    0   2.103     70  0.19
   89  321 A   2   0   0   0   0   0   0  94   0   0   0   0   0   0   0   0   2   0   2   0    51    0    0   0.288      9  0.91
   90  322 A   0   2   0   0   2   0   0   4   4   2  25   0   6   0   0   6   0   0  22  27    51    0    0   1.853     61  0.30
   91  323 A   0  90   0   2   0   0   0   0   0   0   0   0   0   0   2   2   0   4   0   0    51    0    0   0.451     15  0.81
   92  324 A   4  41   0   0   0   0   2   2   4   0   2   2   2   4   4   8   8   2  14   2    51    0    0   2.085     69  0.13
   93  325 A   0   0   0   2   2   2   0  12   4   0  14   2   0   2   0  14   4  10  12  22    51    0    0   2.247     74  0.27
   94  326 A   4   4   0   0  45   2  37   0   0   0   0   4   0   0   0   0   0   0   2   2    51    0    0   1.339     44  0.67
   95  327 A   0  86   0   2   0   0   0   4   0   0   0   2   2   0   2   0   2   0   0   0    51    0    0   0.640     21  0.72
   96  328 A   0   2   2   2   0   4   0   0   0   0   2   0   0   2  61  12  12   0   2   0    51    0    0   1.396     46  0.56
   97  329 A   0   2   0   0   0   0   0  10  18   0   0   8   0   0  14  14   8  12   6  10    51    0    0   2.201     73  0.24
   98  330 A   0   4   4   0   6   0   0   6   4   6  10   0  12  12  10  10   0   4   8   6    51    0    0   2.561     85  0.07
   99  331 A   0   0   0   0   0   0   0  20   4  25   4   0   0   2   4  10   8   6   6  12    51    0    0   2.138     71  0.29
  100  332 A   2   0   2   2   0   6   2  31   2   2   4   4   0   0  20  18   2   0   2   2    51    0    0   2.104     70  0.18
  101  333 A   0   2  10   0   0   0   0  12  10  10   5  10   0   0   7  15   5  10   5   0    41    0    0   2.397     80  0.16
  102  334 A   4  15   2   0   0   0   2   4   2   2   9   2   0   2   2   9   2  28   2  11    46    0    0   2.331     77  0.18
  103  335 A  13  45  11   2   2   0   4   4   0   2   2   4   2   2   2   2   0   0   2   0    47    0    0   2.001     66  0.34
  104  336 A   0  10   0   0   0   0   0  13   6   4  10  23   2   0   2  13   4   4   6   2    48    0    0   2.314     77  0.18
  105  337 A   6  22   8  10   2   2   4   6   8   4   6   4   2   0   2   0   4   4   4   0    49    0    0   2.591     86  0.14
  106  338 A   8   6   4   4   0   0   2   4   0  16   8   0   8   2  12   4  10   2  10   2    51    0    0   2.580     86  0.09
  107  339 A  14  10   4   0   2   0   0   2   6   0   0   2   0   2   0   6  27   4   2  20    51    0    0   2.147     71  0.21
  108  340 A   2  67   0   9   4   0   0   0   2   2   0   4   0   0   4   4   0   0   0   0    45    0    0   1.293     43  0.57
  109  341 A  10  51  22   2   4   0   2   0   0   0   2   6   0   0   0   0   0   0   0   2    51    0    0   1.504     50  0.56
  110  342 A   0   0   0   6   4   0  12   8   0   0  16   2   0   8   6   6   6   6   0  22    51    0    0   2.310     77  0.10
  111  343 A   6   2  16  35  22   2   6   0   6   6   0   0   0   0   0   0   0   0   0   0    51    0    0   1.810     60  0.35
  112  344 A   0   2   0   8   0   0   0   2  63   4  10   2  10   0   0   0   0   0   0   0    51    0    0   1.306     43  0.49
  113  345 A  10   6   6   2   6   2   4   0  22   4   6  12   0   6   8   0   6   0   0   2    51    0    0   2.495     83  0.08
  114  346 A   0   0   0   0   0   0   0   2   0   0   0   0   0  10   0   0  73   0   0  16    51    0    0   0.828     27  0.73
  115  347 A  29   2  65   0   0   0   0   0   2   0   0   0   0   0   0   0   2   0   0   0    51    0    0   0.873     29  0.79
  116  348 A   0   0   0   0   0   0   0   0  78   0  16   2   2   0   0   0   0   2   0   0    51    0    0   0.712     23  0.72
  117  349 A   0   0   0   2   2   0   2   0  29   0  20   0   4   2  18   6   0  12   2   2    51    0    0   1.994     66  0.19
  118  350 A   0   0   0   0   0   0   0  78  20   0   2   0   0   0   0   0   0   0   0   0    51    0    0   0.587     19  0.80
  119  351 A   0  12   0  82   0   0   0   0   0   0   2   0   4   0   0   0   0   0   0   0    51    0    0   0.616     20  0.81
  120  352 A   6   4   0   2   0   0   0   2  27   0  12   0   0   0   2   6  10  25   0   4    51    0    0   2.001     66  0.26
  121  353 A   0   2   0   0  16   0  69   0   0   0   0   0   0   8   0   0   0   6   0   0    51    0    0   0.992     33  0.67
  122  354 A   2  80  18   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    51    0    0   0.559     18  0.85
  123  355 A   0   0   0   0   0   0   0   0  27   0   8   2   0   4   0   2   0  53   2   2    51    0    0   1.327     44  0.45
  124  356 A   0   2   0   0   0   0   0   2   4   0  33   2   0   0  20   6   4  16   8   4    51    0    0   1.955     65  0.28
  125  357 A   0   8   0  14   0   0   0   0   0   4   2   0   0   6  14  27  16   2   8   0    51    0    0   2.038     68  0.26
  126  358 A   0   0   0   0   0   0   0   4   0   2   0   0   4  14  14  18   6   0  39   0    51    0    0   1.716     57  0.33
  127  359 A   6   2  20   0  37   0  27   0   0   0   0   0   8   0   0   0   0   0   0   0    51    0    0   1.486     49  0.56
  128  360 A  37   2  55   0   0   0   0   0   2   0   2   2   0   0   0   0   0   0   0   0    51    0    0   1.005     33  0.75
  129  361 A   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0    51    0    0   0.000      0  1.00
  130  362 A   0   0   0   0   0   0   0   6   0   0   0   0   0   0  94   0   0   0   0   0    51    0    0   0.224      7  0.85
  131  363 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100    51    0    0   0.000      0  1.00
  132  364 A  10  86   4   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    51    0    0   0.482     16  0.88
  133  365 A   0   0   0   0   0   0   0   0  84   0   0   0   0   0  12   4   0   0   0   0    51    0    0   0.523     17  0.68
  134  366 A   0   0   0   0   0   0   0   0  82   0   4  14   0   0   0   0   0   0   0   0    51    0    0   0.559     18  0.76
  135  367 A   0   0   0   0   0   0   0   0  12   0   0   0   0   0  84   0   0   2   0   2    51    0    0   0.550     18  0.68
  136  368 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0    51    0    0   0.000      0  1.00
  137  369 A  31   2  35   0   2   0   0   0   0   0   0   0  29   0   0   0   0   0   0   0    51    0    0   1.245     41  0.51
  138  370 A   2  96   0   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    51    0    0   0.193      6  0.97
  139  371 A  69  14  16   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    51    0    0   0.899     29  0.80
  140  372 A   2   0   0   0   0   0   0  47  12   0  10  18   2   2   0   0   0   0   6   2    51    0    0   1.615     53  0.45
  141  373 A   4   0   0   2   0   0   0   0  12   2  12   2   2   4   0   0   0  27   8  25    51    0    0   1.969     65  0.33
  142  374 A   0   2   0   0   0   0   0   4   0   2   6   8   2   2   4   4   2   6  33  25    51    0    0   2.014     67  0.36
  143  375 A   0  31   0   4   4   0   6   8   0   0   0   2   2  10   8   2   2   0  16   6    51    0    0   2.177     72  0.10
  144  376 A  31  18  12   2   2   0   0   0   2   0   6  14   4   0   2   2   0   4   2   0    51    0    0   2.077     69  0.30
  145  377 A  51   4   0   4   0   0   0   0  22   0   0   0  20   0   0   0   0   0   0   0    51    0    0   1.248     41  0.42
  146  378 A   0   0   0   0   0   0   0   0   0   0   0   0   2   0   0  98   0   0   0   0    51    0    0   0.097      3  0.94
  147  379 A  35   8  57   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    51    0    0   0.888     29  0.81
  148  380 A   0   0   0   0   0   0   0  16  59   0  20   2   4   0   0   0   0   0   0   0    51    0    0   1.126     37  0.58
  149  381 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100    51    0    0   0.000      0  1.00
  150  382 A   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    51    0    0   0.000      0  1.00
  151  383 A   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0    51    0    0   0.000      0  1.00
  152  384 A   2  73   0  20   6   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    51    0    0   0.796     26  0.90
  153  385 A   0   0   0   0   0   0   0   0  61   0  35   2   2   0   0   0   0   0   0   0    51    0    0   0.824     27  0.61
  154  386 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0  88   8   2   2   0   0    51    0    0   0.464     15  0.87
  155  387 A  17  38  21   2   2   2  13   2   0   0   0   0   0   0   0   0   0   0   2   2    48    0    0   1.737     57  0.43
  156  388 A   6   6  24  10   0   0  31   0   2   0   0   4   2   2   4   4   0   0   2   2    49    0    0   2.071     69  0.18
  157  389 A   4   4   0   0   0   0   2   4   2   2  16  16   0   0   8  10   6  18   4   4    50    0    0   2.375     79  0.18
  158  390 A   0   0   0   0   2   0   2  12  10   2  10  10   0   0   2   2   0  18  10  20    50    0    0   2.197     73  0.29
  159  391 A   4   0   0   0   0   0   0   4   8   0   4   0   2   4   0   2   6   4  12  51    51    0    0   1.751     58  0.45
  160  392 A   2   4   6   0   0   0  25   2   4   2   2  10   0   0   2   0   4  25   4   8    51    0    0   2.184     72  0.09
  161  393 A   2   2   2   0   0   0  78   0   4   2   0   0   2   2   6   0   0   0   0   0    51    0    0   0.947     31  0.56
  162  394 A   8   0   4   0   2   0   0   2   0   2   6  18   2   0  18  12   0  22   6   0    51    0    0   2.163     72  0.16
  163  395 A   6   0   2   0   2   0   0   6  37   6  12   4   0   2  10   4   6   0   0   2    49    0    0   2.121     70  0.22
  164  396 A   4   2   0   0   0   0   0   8   0   6   6  12   0  10  22  20   4   2   2   4    51    0    0   2.275     75  0.21
  165  397 A   6   0   2   0   0   0   0  31  10   4  12   8   2   0   2   0   6  14   2   2    51    0    0   2.161     72  0.31
  166  398 A   0   2   0   0   0   0   0  46   4   0   4   0   0  11   4   9   0   7   9   4    46    0    0   1.831     61  0.29
  167  399 A   2   0   0   0   0   0   0  16  39   0  12  14   0   0   4   0   4   4   0   4    49    0    0   1.800     60  0.36
  168  400 A   2  10   2  10   2   0   0   0   2   4   2   0   0   2  22  41   2   0   0   0    51    0    0   1.818     60  0.30
  169  401 A   0  43   8   2  41   2   0   4   0   0   0   0   0   0   0   0   0   0   0   0    51    0    0   1.209     40  0.70
  170  402 A   0   0   0   0   0   0   0   0   0  96   0   4   0   0   0   0   0   0   0   0    51    0    0   0.165      5  0.93
  171  403 A  22  14  59   0   0   0   4   0   0   2   0   0   0   0   0   0   0   0   0   0    51    0    0   1.120     37  0.69
  172  404 A   0   0   0   0   0   0   0   2   0   0   0   0   0   0  25  73   0   0   0   0    51    0    0   0.658     21  0.77
  173  405 A   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0    51    0    0   0.000      0  1.00
  174  406 A   0   4   0  49   0   0   2   0   2   0   2  41   0   0   0   0   0   0   0   0    51    0    0   1.073     35  0.40
  175  407 A   0   0   0   0   0   0   0   0  78  18   4   0   0   0   0   0   0   0   0   0    51    0    0   0.624     20  0.74
  176  408 A   0  12   6   0   0   0   2   0   0  78   0   2   0   0   0   0   0   0   0   0    51    0    0   0.763     25  0.55
  177  409 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0    51    0    0   0.000      0  1.00
  178  410 A   6   0   0   2   0   0   0   2  41   0  43   0   4   0   2   0   0   0   0   0    51    0    0   1.253     41  0.45
  179  411 A   0  35  33   2   6   0   0   0  24   0   0   0   0   0   0   0   0   0   0   0    51    0    0   1.318     43  0.45
  180  412 A   0  16   0  14  10   0   8   0  10   0   6   8   0   2   2   4   0   8  14   0    51    0    0   2.338     78  0.11
  181  413 A   0   0   0   0  10   0  43   6   0   0   4   6   0  10   0   0   4   2   2  14    51    0    0   1.832     61  0.18
  182  414 A   0   2   0   0   2   0   4  27   0   0   6   2   0   2  20   2   2   2  27   2    51    0    0   1.940     64  0.21
  183  415 A   8   2  10   2   0   0   0   0   0   0   0  10   0   0  12  45   2   8   2   0    51    0    0   1.774     59  0.30
  184  416 A   0   0   0   0  75   0  24   0   0   0   0   0   2   0   0   0   0   0   0   0    51    0    0   0.637     21  0.93
  185  417 A   0   0   0   0   0   0   0   0   0   0  35  61   0   0   0   0   0   0   2   2    51    0    0   0.824     27  0.58
  186  418 A   6   0  31   2   0   0   0   0   4   0  20  22  10   2   0   0   0   4   0   0    51    0    0   1.817     60  0.25
  187  419 A   0   0   0   2   0   0   0   0   6   0   0   0   2   0   0  59  18  14   0   0    51    0    0   1.212     40  0.46
  188  420 A   2   0   0   0   0   0   0   0   0   0  84  12   2   0   0   0   0   0   0   0    51    0    0   0.550     18  0.76
  189  421 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100    51    0    0   0.000      0  1.00
  190  422 A  88   2   8   0   0   0   0   0   0   0   0   2   0   0   0   0   0   0   0   0    51    0    0   0.464     15  0.91
  191  423 A   0   0   0   0   0  96   4   0   0   0   0   0   0   0   0   0   0   0   0   0    51    0    0   0.165      5  0.98
  192  424 A   0   0   0   0   0   0   0   0  20   0  80   0   0   0   0   0   0   0   0   0    51    0    0   0.495     16  0.76
  193  425 A   0   2   0   0  80   0  18   0   0   0   0   0   0   0   0   0   0   0   0   0    51    0    0   0.559     18  0.97
  194  426 A   0   0   0   0   0   0   0  98   2   0   0   0   0   0   0   0   0   0   0   0    51    0    0   0.097      3  0.98
  195  427 A  47   0  53   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    51    0    0   0.691     23  0.86
  196  428 A  16  73   6   0   0   0   0   0   0   0   0   6   0   0   0   0   0   0   0   0    51    0    0   0.857     28  0.71
  197  429 A   2  78   2  16   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    51    0    0   0.712     23  0.92
  198  430 A   6   0   0   0   2  67   4   0   0   0   0  22   0   0   0   0   0   0   0   0    51    0    0   0.972     32  0.38
  199  431 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0    51    0    0   0.000      0  1.00
  200  432 A  10  25  63   0   0   0   0   0   2   0   0   0   0   0   0   0   0   0   0   0    51    0    0   0.946     31  0.75
  201  433 A  37   4   2  10  27   0   0   0  14   0   0   2   2   0   0   0   0   0   2   0    51    0    0   1.658     55  0.33
  202  434 A   0   0   0   0   0   0   0   0   0   0  18  82   0   0   0   0   0   0   0   0    51    0    0   0.466     15  0.75
  203  435 A   2  29   0   4   4   0  37   2   2   0   0   0   2   6   2   8   0   2   0   0    49    0    0   1.839     61  0.25
  204  436 A   0   0   0   0   0   0   0  98   2   0   0   0   0   0   0   0   0   0   0   0    51    0    0   0.097      3  0.98
  205  437 A   0   2   0   8   0   0   2  10   4   0   6   2   2   2  25  22   8   6   2   0    51    0    0   2.229     74  0.19
  206  438 A  12   4  16   8   0   0   2   0   4   0  14  12   2   0   2   4  10   0   2  10    51    0    0   2.411     80  0.12
  207  439 A   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0    51    0    0   0.000      0  1.00
  208  440 A   0   0   0   0   4  10  86   0   0   0   0   0   0   0   0   0   0   0   0   0    51    0    0   0.482     16  0.94
  209  441 A   0   0   0   0   8   2   2  10   4  63   0   0   0   0   2   0   2   2   2   4    51    0    0   1.436     47  0.34
  210  442 A   0   0   0   0   0   0   0  71   0   0   0   0   2   0   2   2  10   4   4   6    51    0    0   1.126     37  0.59
  211  443 A   4  25  16  39   0   0   0   0   0   4   0   2   2   0   0   4   2   0   2   0    51    0    0   1.695     56  0.48
  212  444 A   2   0   0   2   0   0   0   4   8   2  35  24   0   0   0   6   2   4   4   8    51    0    0   1.963     65  0.32
  213  445 A   4  10   0   0   6   0   0   6   8   4   0   6   4   2   0   4   0   0  45   2    51    0    0   1.949     65  0.19
  214  446 A   0   8   0   0   2   0   0   2  24   4   6  10   4   4  10   4   8  10   4   2    51    0    0   2.456     81  0.13
  215  447 A   2   0   0   0   0   0   0   2   0   0   0   0   0   0   2   4  22  59   0  10    51    0    0   1.229     41  0.62
  216  448 A  67  18   8   4   2   0   0   0   2   0   0   0   0   0   0   0   0   0   0   0    51    0    0   1.057     35  0.72
  217  449 A  14  31  18  14   0   0  14   0   0   2   2   2   0   0   0   2   2   0   0   0    51    0    0   1.873     62  0.40
  218  450 A   0   2   0   0   0   0   2   6   4   0   6   2   0   4   8   6  12  31   4  14    51    0    0   2.200     73  0.32
  219  451 A   6  14   8   0   6   0   4   2   8   0   0   4   8   2   6   6  20   0   8   0    51    0    0   2.465     82  0.05
  220  452 A  37  47  16   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    51    0    0   1.013     33  0.73
  221  453 A   0   0   2   0   0   0   0   4   2   2   4  14   0   4  14   4  10  27   2  12    51    0    0   2.196     73  0.26
  222  454 A   0   2   2   0   0   0   0   4   8   0   2   4   0   6  18  16  20   8   8   4    51    0    0   2.294     76  0.25
  223  455 A   0   0   0   2   0   0   0  88   2   0   0   0   0   0   0   0   0   0   2   6    51    0    0   0.508     16  0.84
  224  456 A   0   0  10   0   8   0  55   6   2   0   0   0   0   0  12   0   2   0   4   2    51    0    0   1.533     51  0.24
  225  457 A  10   0   2   0   2   0   0   0   0   0   0   0   0   0  86   0   0   0   0   0    51    0    0   0.509     16  0.69
  226  458 A   0  35   0  57   0   0   0   0   0   2   0   0   0   4   2   0   0   0   0   0    51    0    0   0.970     32  0.77
  227  459 A   6   0   0   0   0   0   2   0   6  29   4   0   0   0   0   6   6  35   0   6    51    0    0   1.765     58  0.31
  228  460 A   4   0   0   2   0   0   0   0   2   4   2   0  20   0  27  24  16   0   0   0    51    0    0   1.791     59  0.21
  229  461 A   0   0   0   0   0   0   0   0   0  98   2   0   0   0   0   0   0   0   0   0    51    0    0   0.097      3  0.97
  230  462 A   4   4   0   0   0   0   0   7   4  26   0   0   0   7  11   4   4  20   0   9    46    0    0   2.161     72  0.23
  231  463 A   6   4   0   0   0   0   0  27   2   0   8   4   0   8   0   0   4   6  22  10    51    0    0   2.104     70  0.28
  232  464 A   0   0   0   0   0   0   0   0   8   0   2   2  88   0   0   0   0   0   0   0    51    0    0   0.464     15  0.83
  233  465 A   0   0   0   0   0   0   0   2   2  75   8   2   0   0   2   2   0   2   2   4    51    0    0   1.086     36  0.64
  234  466 A   4   4   2   2   0   0   0   4   0  22   6   4   0   0   4  10   2  22   4  12    51    0    0   2.301     76  0.21
  235  467 A   0   4   0   0   0   0   0   2  18   4  12   0   0   0   4   6   2  29   2  18    51    0    0   2.003     66  0.32
  236  468 A  27  45  12   6   2   0   6   0   2   0   0   0   0   0   0   0   0   0   0   0    49    0    0   1.470     49  0.61
  237  469 A   0   2   0   0   6   0  84   2   2   0   0   0   0   4   0   0   0   0   0   0    49    0    0   0.689     22  0.78
  238  470 A   2   2   0   0   0   0   0   0   6   0   0   4   0   4  10   0   4  27   6  35    49    0    0   1.845     61  0.39
  239  471 A  16  43  37   2   0   0   0   0   0   0   0   0   0   0   0   2   0   0   0   0    49    0    0   1.186     39  0.68
  240  472 A   2   0   2  96   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    49    0    0   0.199      6  0.95
  241  473 A   2  33   0   6   4   0   4   2   0   0   6   8   0   0  24   6   4   0   0   0    49    0    0   1.978     66  0.16
  242  474 A   0   6   2   2   0   0   4   8   8   0  20   0   0   0   6   6  18   8   2   8    49    0    0   2.336     77  0.16
  243  475 A   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0    49    0    0   0.000      0  1.00
  244  476 A   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0    49    0    0   0.000      0  1.00
  245  477 A   0   0   0   2   0   0   0   0   8   0   8   2   0  10  14  12  20  10  10   2    49    0    0   2.205     73  0.26
  246  478 A   0   0   2   2   0  10   0   0  10   0   2   6   0   8  10  18   8  14   0   8    49    0    0   2.311     77  0.16
  247  479 A   6   4   0   0   0   0   0   2   4   0   8   2   2   0   8   4   2  22  10  24    49    0    0   2.202     73  0.26
  248  480 A   0   0   0   0   0   0   0   0   4  90   2   0   0   0   2   2   0   0   0   0    48    0    0   0.473     15  0.85
  249  481 A   2   2   0   6   0   0   0   0  15   0  10   2   2   0   6   6  10  23   4  10    48    0    0   2.300     76  0.22
  250  482 A   0   4   0   2   0   0   0   2   4   0   2   6   2   2  13  10  15  13   4  21    48    0    0   2.337     78  0.23
  251  483 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0    48    0    0   0.000      0  1.00
  252  484 A   0   6   0   0   0   0   0   0   0  94   0   0   0   0   0   0   0   0   0   0    48    0    0   0.234      7  0.85
  253  485 A   0   0   0   0   0   0   0   4   4   2  23  42   0   2   0   6   2   2   8   4    48    0    0   1.803     60  0.34
  254  486 A   0   0   6   2  85   0   0   0   0   6   0   0   0   0   0   0   0   0   0   0    47    0    0   0.570     19  0.72
  255  487 A   0   0   0   0   0   0   0   4  11   7  11   7   0   2  15   7   2  26   0   9    46    0    0   2.169     72  0.24
  256  488 A   2   0   2   0   0   0  11   2   2   0  11  20   2   0   0   4   7  30   0   7    46    0    0   2.072     69  0.20
  257  489 A   7  57  37   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    46    0    0   0.868     28  0.74
  258  490 A  20   7   0   0   4   0   9   0   2   0   0   0   0  13  11   7  24   4   0   0    46    0    0   2.093     69  0.13
  259  491 A   0   0   2   2   0  13   0   0   4   0  15   0   0   7   0   9  15  22   9   2    46    0    0   2.159     72  0.16
  260  492 A  11   9   9   4   7   0   0   2   7   0   0   9   0   0  17  20   2   2   0   2    46    0    0   2.327     77  0.13
  261  493 A   2  74   9   4  11   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    46    0    0   0.897     29  0.85
  262  494 A   0   5   0   0   0   0   0   5  10   0   0   2   0   7   2   0   0  43   2  24    42    0    0   1.674     55  0.43
  263  495 A   0   3   0   0   0   0   0   0  10   0   3  10   0   0   8  10   8   5  13  32    40    0    0   2.039     68  0.29
  264  496 A   5  32   5  22  22   0   8   0   0   0   3   0   0   0   0   0   3   0   0   0    37    0    0   1.742     58  0.55
  265  497 A   3  31   7   3  45   0   3   0   3   0   0   0   0   3   0   0   0   0   0   0    29    0    0   1.488     49  0.61
  266  498 A   0   0   0   0   0   0   0   0  12   6   0  12   0   6   6   0  29  24   6   0    17    0    0   1.871     62  0.29
  267  499 A   0   0   0   0   0   0   0   0  18   0   9   9   0   0   9   0   9  18   0  27    11    0    0   1.846     61  0.26
  268  500 A   0   0   0   0   0   0   0   0   0  13  50  13   0   0   0   0   0   0  13  13     8    0    0   1.386     46  0.29
 AliNo  IPOS  JPOS   Len Sequence
     7    56    56     2 gKGr
     9   110   110     1 rIl
     9   187   188     3 gPVGc
    11    28    81     3 gLWNn
    12    73    80     1 dLa
    13    94    95     1 gLl
    17   154   208     1 kSl
    18   150   176     4 rLIEPw
    19    98   185     3 gKQCp
    19   149   239     1 rIl
    21    32    32     5 nIAGLEg
    21    49    54     2 kERq
    21    63    70     1 kPh
    21    99   107     6 sRADHYYg
    21   100   114     3 gNLYg
    21   101   118     2 gASs
    21   155   174     1 rDi
    22    88   323    12 gALQAPRSPAPLLd
    22    97   344    17 cSLLMLLPTGSLVDFLKTp
    22    98   362     1 pPg
    22   229   494     1 dNc
    23    23    75     2 rGRk
    23    40    94     2 kQRv
    23   145   201     3 rVLEd
    24    53    56    15 cSSEAGLAASSPPARAp
    24    54    72     3 pTSSg
    24    55    76     2 gSEp
    24    62    85     1 aDk
    24   109   133     1 qSi
    25    29    31     5 qISGNTg
    25    46    53     2 aALt
    25    60    69     1 gTh
    25    96   106    10 sRTHQPYGNLHg
    25    98   118     1 gSk
    26    32    89     2 rGGq
    26    49   108     2 nAEs
    26    98   159     1 aCg
    26   153   215     2 kALg
    27     9    10     2 nIKq
    27    58    61     6 rELASGNs
    27    60    69     2 aDPn
    27   114   125     1 rHl
    27   162   174     1 tLa
    27   189   202     8 sDAITFLSRp
    27   191   212     1 eIc
    28    21    22     3 qEDGs
    28    38    42     3 sSDIe
    28    63    70     6 sLRSRAKg
    28    95   108     1 fTl
    28   142   156     1 rKi
    28   217   232    16 pPECMEDVLTLPLHPSQg
    28   219   250     3 lPRPs
    29    26    46     5 nLCPEQd
    29    43    68     1 aRk
    29    93   119     9 hGPDAVLMAEg
    29    94   129     1 gNr
    29    95   131     1 rPa
    29   149   186     1 rDv
    30    19    20     5 sVAHLTe
    30    36    42     2 qTEi
    30    86    94     3 sRPTp
    30    87    98     1 pSr
    30    88   100     1 rSp
    30   131   144     3 gPSRr
    30   142   158     1 rDi
    31    28    31     5 nLSPTKd
    31    45    53     1 aRk
    31    95   104    13 hGPDAMILVDGQPRq
    31    96   118     1 qTk
    31   151   174     1 rDv
    32    17    17     7 vQHSKNHTe
    32    34    41     2 gEYr
    32    59    68     1 cRs
    32    84    94    15 fRVNWRYSKSSDDDNNp
    32    85   110     2 pDNs
    32   140   167     1 rDv
    33    28    44     5 nLSPTKd
    33    45    66     1 aRk
    33    95   117    13 hGPDAMILVDGQPRq
    33    96   131     1 qVk
    33   151   187     1 rDv
    34    23    23     2 kRGv
    34    40    42     2 rDKe
    34    54    58     1 gRh
    34    90    95    10 nRPEELNQTDIp
    34    91   106     2 pSSg
    34   146   163     1 rDi
    34   222   240     1 aVc
    35    32    46     2 tRKr
    35    49    65     1 sYr
    35    63    80     1 hQq
    35    65    83     7 rNGDGRKSn
    35   100   125     1 kNk
    35   101   127     1 kNe
    35   155   182     2 rDVy
    35   163   192     2 rANr
    35   166   197     1 gVd
    35   208   240     1 pCy
    35   211   244     3 gRTQl
    36    17    18     2 tPEg
    36    34    37     1 sYr
    36    48    52     1 hEd
    36    50    55     7 nDHDVRRSn
    36    84    96     2 fREd
    36    86   100     1 dQa
    36    93   108     1 dRf
    36   140   156     4 rDVHVy
    36   148   168     2 sTSd
    36   151   173     1 eCh
    36   193   216     1 pCy
    36   196   220     3 gRFQl
    37    29    43     2 rDDr
    37    46    62     2 dDKl
    37    60    78     1 gVh
    37    71    90     1 cTv
    37    96   116    12 cREVSQIVVFLRKe
    37    97   129     2 eEHg
    37   148   182     1 eDi
    37   176   211     1 gEv
    38    31   128     6 rCAGGRKe
    38    47   150     3 eKDMl
    38    61   167     1 gKh
    38    97   204    16 nRPSELQYELSTPDSPAp
    38    98   221     1 pPr
    38    99   223     1 rDe
    38   153   278     1 rDi
    38   161   287     2 rKEt
    38   227   355     1 qFa
    39    31    31     2 tTEg
    39    48    50     1 sYr
    39    62    65     1 hQq
    39    64    68     7 rDGDCRESn
    39    99   110     2 gNIn
    39   100   113     1 nEk
    39   153   167     4 rDVYVn
    39   164   182     1 gVd
    39   206   225     1 pCy
    39   209   229     3 gRMQl
    40    10   220     2 nLIi
    40    32   244    19 gIAKGNKNAQSTLGINLMRAe
    40    48   279     3 qLSKs
    40    62   296     1 gYh
    40    89   324     7 gDLLHFLRk
    40    98   340    16 lTEMGIDYDEPNLNEKId
    40   100   358     1 qTl
    40   154   413     2 rYIy
    40   229   490     1 dNc
    41    29    82     5 gMNNDNk
    41    46   104     2 qDEm
    41    96   156     1 nRp
    41    97   158     2 pRAg
    41    98   161     2 gQTs
    41   141   206     3 gPERv
    41   152   220     1 rDi
    41   163   268     1 gGr
    42    32   495     5 dIDGHEg
    42    49   517     2 aERs
    42    63   533     1 ePh
    42    99   570    15 sRVEKYVLALGHYGNTh
    42   100   586     1 hGk
    42   101   588     1 kSk
    42   125   613    27 sRGVSTVGSGSGSFLTSIYNLQLRPFSRp
    42   155   670     1 rDi
    43    32    49    14 gMSAFKPRDKAPEAVk
    43    43    74     1 rKk
    43    49    81     2 sDYk
    43    63    97     1 gEh
    43    99   134    12 rREVFEPTWTKTNp
    43   100   147     1 pDp
    43   101   149     1 pEa
    43   155   204     1 rDi
    43   165   215     1 tTs
    44    31    31     2 lPTg
    44    48    50     1 cYq
    44    62    65     1 hEe
    44    64    68     7 kGYNTRKSn
    44    99   110     1 kNk
    44   150   162     2 rDVy
    44   158   172     2 pVNh
    44   161   177     1 gQe
    44   203   220     1 pMy
    44   206   224     3 nTPQp
    45    28    32     5 nLSPTKd
    45    45    54     1 aRk
    45    95   105    13 hGPDAMILVDGQPRq
    45    96   119     1 qAk
    45   151   175     1 rDv
    45   162   225     1 gGh
    46    40    40     1 rFa
    46    46    47     3 aTDLk
    46    97   101     2 rLTw
    46   117   123     2 nRKp
    46   155   163     2 vATs
    46   212   222     1 gFq
    46   220   231     4 pSRPPp
    47    25    26     2 gKAv
    47    42    45     3 rMVDr
    47    92    98     1 nEp
    47   154   161     1 sVg
    47   173   181     1 kNk
    47   200   209     1 eMq
    48    43   311     1 kEy
    48    49   318     1 eVr
    48    63   333     1 gAh
    48    74   345    13 cSGRRPLIVAEYCSr
    48    90   374    11 vSRRNAKYYNNNn
    48    99   394    16 lFKSKLPDMKFVANRLYd
    48   100   411     3 dIQGv
    48   101   415     2 vCDt
    48   155   471     1 rDv
    49    31    37    15 gIRDFCADETAVVQRRk
    49    48    69     2 aGMd
    49    62    85     1 gSh
    49    73    97     3 cTKQi
    49    98   125    17 hRNKFVNQLDEFGNIKLYd
    49    99   143     3 dPDAt
    49   100   147     2 tLNp
    49   154   203     1 rKm
    49   162   212     2 eKNg
    49   208   260     1 gRn
    49   228   281     1 dNa
    50    30   601     4 gLINSh
    50    45   620     2 dAVq
    50    59   636     1 gPh
    50    86   664    12 gDLVNYLQRNKHTf
    50    95   685    21 kSDNDGGYIDMNKEESAQYVAMk
    50    96   707     3 kELSy
    50    97   711     2 yADi
    50   104   720     1 eTp
    50   121   738    25 dSPLLSLNDLISFSYQIVQAMDFLSSr
    50   151   793     1 rDl
    50   207   850     1 dLp