Complet list of 1pex hssp fileClick here to see the 3D structure Complete list of 1pex.hssp file
THRESHOLD  according to: t(L)=(290.15 * L ** -0.562) + 5
REFERENCE  Sander C., Schneider R. : Database of homology-derived protein structures. Proteins, 9:56-68 (1991).
CONTACT    Maintained at by Maarten L. Hekkelman 
DATE       file generated on 2014-05-05
HEADER     METALLOPROTEASE                         24-MAY-96   1PEX
DBREF      1PEX A  259   466  UNP    P45452   MMP13_HUMAN    265    471
NCHAIN        1 chain(s) in 1PEX data set
NALIGN      655
NOTATION : ID: EMBL/SWISSPROT identifier of the aligned (homologous) protein
NOTATION : STRID: if the 3-D structure of the aligned protein is known, then STRID is the Protein Data Bank identifier as taken
NOTATION : from the database reference or DR-line of the EMBL/SWISSPROT entry
NOTATION : %IDE: percentage of residue identity of the alignment
NOTATION : %SIM (%WSIM):  (weighted) similarity of the alignment
NOTATION : IFIR/ILAS: first and last residue of the alignment in the test sequence
NOTATION : JFIR/JLAS: first and last residue of the alignment in the alignend protein
NOTATION : LALI: length of the alignment excluding insertions and deletions
NOTATION : NGAP: number of insertions and deletions in the alignment
NOTATION : LGAP: total length of all insertions and deletions
NOTATION : LSEQ2: length of the entire sequence of the aligned protein
NOTATION : ACCNUM: SwissProt accession number
NOTATION : PROTEIN: one-line description of aligned protein
NOTATION : SeqNo,PDBNo,AA,STRUCTURE,BP1,BP2,ACC: sequential and PDB residue numbers, amino acid (lower case = Cys), secondary
NOTATION : structure, bridge partners, solvent exposure as in DSSP (Kabsch and Sander, Biopolymers 22, 2577-2637(1983)
NOTATION : VAR: sequence variability on a scale of 0-100 as derived from the NALIGN alignments
NOTATION : pair of lower case characters (AvaK) in the alignend sequence bracket a point of insertion in this sequence
NOTATION : dots (....) in the alignend sequence indicate points of deletion in this sequence
NOTATION : SEQUENCE PROFILE: relative frequency of an amino acid type at each position. Asx and Glx are in their
NOTATION : acid/amide form in proportion to their database frequencies
NOTATION : NOCC: number of aligned sequences spanning this position (including the test sequence)
NOTATION : NDEL: number of sequences with a deletion in the test protein at this position
NOTATION : NINS: number of sequences with an insertion in the test protein at this position
NOTATION : ENTROPY: entropy measure of sequence variability at this position
NOTATION : RELENT: relative entropy, i.e.  entropy normalized to the range 0-100
NOTATION : WEIGHT: conservation weight

## PROTEINS : identifier and alignment statistics
    1 : MMP13_HUMAN         1.00  1.00    1  192  280  471  192    0    0  471  P45452     Collagenase 3 OS=Homo sapiens GN=MMP13 PE=1 SV=1
    2 : Q53H33_HUMAN        1.00  1.00    1  192  280  471  192    0    0  471  Q53H33     Matrix metalloproteinase 13 preproprotein variant (Fragment) OS=Homo sapiens PE=2 SV=1
    3 : Q7Z5M1_HUMAN        1.00  1.00    1  160  280  439  160    0    0  489  Q7Z5M1     Collagenase-3 splice variant COL3-9B-2 OS=Homo sapiens PE=2 SV=1
    4 : F6YQ28_MACMU        0.99  1.00    1  192  280  471  192    0    0  471  F6YQ28     Uncharacterized protein OS=Macaca mulatta GN=MMP13 PE=4 SV=1
    5 : G1R6E4_NOMLE        0.99  1.00    1  192  280  471  192    0    0  471  G1R6E4     Uncharacterized protein OS=Nomascus leucogenys GN=MMP13 PE=4 SV=1
    6 : G3QLR7_GORGO        0.99  0.99    1  192  280  471  192    0    0  471  G3QLR7     Uncharacterized protein OS=Gorilla gorilla gorilla GN=101133827 PE=4 SV=1
    7 : G5E971_HUMAN        0.99  0.99    1  160  280  439  160    0    0  489  G5E971     Collagenase 3 OS=Homo sapiens GN=MMP13 PE=4 SV=1
    8 : H2NF36_PONAB        0.99  1.00    1  192  280  471  192    0    0  471  H2NF36     Uncharacterized protein OS=Pongo abelii GN=MMP13 PE=4 SV=1
    9 : F7I7P8_CALJA        0.96  1.00    1  192  283  474  192    0    0  474  F7I7P8     Uncharacterized protein OS=Callithrix jacchus GN=MMP13 PE=4 SV=1
   10 : Q9TT82_CANFA        0.96  0.99    1  178  272  449  178    0    0  452  Q9TT82     Matrix metalloproteinase-13 (Fragment) OS=Canis familiaris PE=2 SV=1
   11 : F1PVS9_CANFA        0.95  0.99    1  192  305  496  192    0    0  496  F1PVS9     Uncharacterized protein OS=Canis familiaris GN=MMP13 PE=4 SV=2
   12 : G1P6T8_MYOLU        0.95  0.99    1  192  279  470  192    0    0  470  G1P6T8     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
   13 : D2HIH5_AILME        0.94  0.99    1  159  279  437  159    0    0  437  D2HIH5     Putative uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=PANDA_011008 PE=4 SV=1
   14 : F7DYT6_HORSE        0.94  0.99    1  192  281  472  192    0    0  472  F7DYT6     Collagenase 3 OS=Equus caballus GN=MMP13 PE=4 SV=1
   15 : G1LUT6_AILME        0.94  0.99    1  192  279  470  192    0    0  470  G1LUT6     Uncharacterized protein OS=Ailuropoda melanoleuca GN=MMP13 PE=4 SV=1
   16 : G5BUC9_HETGA        0.94  0.98    1  192  280  471  192    0    0  471  G5BUC9     Collagenase 3 OS=Heterocephalus glaber GN=GW7_15561 PE=4 SV=1
   17 : G7PNK8_MACFA        0.94  0.96    1  170  280  445  170    1    4  489  G7PNK8     Putative uncharacterized protein OS=Macaca fascicularis GN=EGM_06166 PE=4 SV=1
   18 : H0X278_OTOGA        0.94  0.98    1  192  283  474  192    0    0  474  H0X278     Uncharacterized protein OS=Otolemur garnettii GN=MMP13 PE=4 SV=1
   19 : L5KYP8_PTEAL        0.94  0.98    1  192  280  471  192    0    0  471  L5KYP8     Collagenase 3 OS=Pteropus alecto GN=PAL_GLEAN10013825 PE=4 SV=1
   20 : L9KR37_TUPCH        0.94  0.98    1  192  306  497  192    0    0  497  L9KR37     Collagenase 3 OS=Tupaia chinensis GN=TREES_T100006570 PE=4 SV=1
   21 : MMP13_HORSE         0.94  0.99    1  192  281  472  192    0    0  472  O18927     Collagenase 3 OS=Equus caballus GN=MMP13 PE=2 SV=1
   22 : F1SV56_PIG          0.93  0.99    1  192  279  470  192    0    0  470  F1SV56     Uncharacterized protein OS=Sus scrofa GN=MMP-13 PE=4 SV=1
   23 : G7NBR3_MACMU        0.93  0.95    1  170  280  445  170    1    4  489  G7NBR3     Putative uncharacterized protein OS=Macaca mulatta GN=EGK_06829 PE=4 SV=1
   24 : M3VU49_FELCA        0.93  0.98    1  192  280  471  192    0    0  471  M3VU49     Uncharacterized protein (Fragment) OS=Felis catus GN=MMP13 PE=4 SV=1
   25 : S9WN66_9CETA        0.93  0.98    1  192  264  455  192    0    0  455  S9WN66     Collagenase 3 OS=Camelus ferus GN=CB1_000877046 PE=4 SV=1
   26 : G1SHN2_RABIT        0.92  0.99    1  192  280  471  192    0    0  471  G1SHN2     Collagenase 3 OS=Oryctolagus cuniculus GN=MMP13 PE=4 SV=1
   27 : G3SXB4_LOXAF        0.92  0.99    1  192  280  471  192    0    0  471  G3SXB4     Uncharacterized protein OS=Loxodonta africana GN=MMP13 PE=4 SV=1
   28 : C8BKE3_SHEEP        0.91  0.98    1  192  280  471  192    0    0  471  C8BKE3     Matrix metallopeptidase 13 OS=Ovis aries GN=MMP13 PE=2 SV=1
   29 : F1MW26_BOVIN        0.91  0.98    1  192  280  471  192    0    0  471  F1MW26     Collagenase 3 OS=Bos taurus GN=MMP13 PE=4 SV=2
   30 : MMP13_BOVIN         0.91  0.97    1  192  280  471  192    0    0  471  O77656     Collagenase 3 OS=Bos taurus GN=MMP13 PE=2 SV=1
   31 : MMP13_RABIT         0.91  0.98    1  192  280  471  192    0    0  471  O62806     Collagenase 3 OS=Oryctolagus cuniculus GN=MMP13 PE=2 SV=1
   32 : H0UTG1_CAVPO        0.90  0.98    1  192  264  455  192    0    0  455  H0UTG1     Uncharacterized protein (Fragment) OS=Cavia porcellus GN=MMP13 PE=4 SV=1
   33 : H2Q4N4_PANTR        0.89  0.92    1  178  280  452  178    1    5  489  H2Q4N4     Uncharacterized protein OS=Pan troglodytes GN=MMP13 PE=4 SV=1
   34 : L8J0J1_9CETA        0.89  0.96    1  192  280  469  192    1    2  469  L8J0J1     Collagenase 3 OS=Bos mutus GN=M91_17715 PE=4 SV=1
   35 : M3Y635_MUSPF        0.89  0.98    1  192  320  511  192    0    0  511  M3Y635     Uncharacterized protein OS=Mustela putorius furo GN=MMP13 PE=4 SV=1
   36 : G3V742_RAT          0.88  0.99    1  192  281  472  192    0    0  472  G3V742     Collagenase 3 OS=Rattus norvegicus GN=Mmp13 PE=4 SV=1
   37 : MMP13_MOUSE         0.88  0.98    1  192  281  472  192    0    0  472  P33435     Collagenase 3 OS=Mus musculus GN=Mmp13 PE=1 SV=1
   38 : MMP13_RAT           0.88  0.99    1  192  275  466  192    0    0  466  P23097     Collagenase 3 (Fragment) OS=Rattus norvegicus GN=Mmp13 PE=1 SV=1
   39 : Q3U5R7_MOUSE        0.88  0.98    1  192  281  472  192    0    0  472  Q3U5R7     Putative uncharacterized protein OS=Mus musculus GN=Mmp13 PE=2 SV=1
   40 : Q3U9V5_MOUSE        0.88  0.98    1  192  281  472  192    0    0  472  Q3U9V5     Matrix metallopeptidase 13 OS=Mus musculus GN=Mmp13 PE=2 SV=1
   41 : Q3U2N6_MOUSE        0.87  0.98    1  192  281  472  192    0    0  472  Q3U2N6     Putative uncharacterized protein OS=Mus musculus GN=Mmp13 PE=2 SV=1
   42 : W5P3Y4_SHEEP        0.86  0.95    1  171  280  449  171    1    1  489  W5P3Y4     Uncharacterized protein OS=Ovis aries GN=MMP13 PE=4 SV=1
   43 : F6SS23_MONDO        0.79  0.94    1  192  284  475  192    0    0  475  F6SS23     Uncharacterized protein OS=Monodelphis domestica GN=MMP13 PE=4 SV=2
   44 : G3WPX6_SARHA        0.78  0.95    1  192  283  474  192    0    0  474  G3WPX6     Uncharacterized protein (Fragment) OS=Sarcophilus harrisii GN=MMP13 PE=4 SV=1
   45 : I3MBY3_SPETR        0.78  0.84    1  192  280  470  195    3    7  470  I3MBY3     Uncharacterized protein OS=Spermophilus tridecemlineatus GN=MMP13 PE=4 SV=1
   46 : K7GBY7_PELSI        0.74  0.91    1  192  281  472  192    0    0  472  K7GBY7     Uncharacterized protein OS=Pelodiscus sinensis GN=MMP13 PE=4 SV=1
   47 : F7B3E4_ORNAN        0.73  0.90    1  192  281  474  194    1    2  474  F7B3E4     Uncharacterized protein OS=Ornithorhynchus anatinus GN=MMP13 PE=4 SV=1
   48 : U3JCA5_FICAL        0.72  0.90    1  192  281  472  192    0    0  472  U3JCA5     Uncharacterized protein OS=Ficedula albicollis GN=MMP13 PE=4 SV=1
   49 : G1KMI9_ANOCA        0.71  0.89    1  192  282  473  192    0    0  473  G1KMI9     Uncharacterized protein OS=Anolis carolinensis GN=MMP13 PE=4 SV=2
   50 : H0ZR64_TAEGU        0.71  0.90   28  192  302  466  165    0    0  466  H0ZR64     Uncharacterized protein OS=Taeniopygia guttata GN=MMP13 PE=4 SV=1
   51 : H3AYT2_LATCH        0.71  0.86    1  192  276  467  192    0    0  467  H3AYT2     Uncharacterized protein OS=Latimeria chalumnae PE=4 SV=1
   52 : H9GK65_ANOCA        0.70  0.89    1  192   15  206  192    0    0  206  H9GK65     Uncharacterized protein (Fragment) OS=Anolis carolinensis GN=LOC100562591 PE=4 SV=1
   53 : R0KDC0_ANAPL        0.70  0.90    1  192  280  471  192    0    0  471  R0KDC0     Collagenase 3 (Fragment) OS=Anas platyrhynchos GN=Anapl_05639 PE=4 SV=1
   54 : U3IIS5_ANAPL        0.70  0.89    1  192  281  474  194    1    2  474  U3IIS5     Uncharacterized protein OS=Anas platyrhynchos GN=MMP13 PE=4 SV=1
   55 : G1NQJ3_MELGA        0.68  0.90    1  192  187  378  192    0    0  378  G1NQJ3     Uncharacterized protein (Fragment) OS=Meleagris gallopavo GN=MMP13 PE=4 SV=2
   56 : O93363_CHICK        0.68  0.90    1  192  187  378  192    0    0  378  O93363     Matrix metalloproteinase-13 (Fragment) OS=Gallus gallus GN=MMP-13 PE=2 SV=1
   57 : Q10833_XENLA        0.68  0.84    1  192  281  472  192    0    0  472  Q10833     Collagenase-3 OS=Xenopus laevis GN=mmp13l PE=2 SV=1
   58 : F1NZ56_CHICK        0.67  0.90    1  192  280  471  192    0    0  471  F1NZ56     Uncharacterized protein OS=Gallus gallus GN=MMP13 PE=4 SV=1
   59 : MMP13_XENLA         0.67  0.85    1  192  278  469  192    0    0  469  Q10835     Collagenase 3 (Fragment) OS=Xenopus laevis GN=mmp13 PE=2 SV=1
   60 : F6SRT1_XENTR        0.66  0.84    1  192  281  472  192    0    0  472  F6SRT1     Uncharacterized protein OS=Xenopus tropicalis GN=mmp13l PE=4 SV=1
   61 : G3UUS8_MELGA        0.66  0.88    1  192  403  599  197    2    5  599  G3UUS8     Uncharacterized protein (Fragment) OS=Meleagris gallopavo GN=MMP13 PE=4 SV=1
   62 : Q98859_CYNPY        0.65  0.84    1  192  280  471  192    0    0  471  Q98859     Collagenase 3 OS=Cynops pyrrhogaster PE=2 SV=1
   63 : G1Q151_MYOLU        0.63  0.75    1  192  278  458  193    4   13  458  G1Q151     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
   64 : M7BQH2_CHEMY        0.61  0.75    1  164  280  445  166    1    2  446  M7BQH2     Collagenase 3 OS=Chelonia mydas GN=UY3_04723 PE=4 SV=1
   65 : Q9I956_SALSA        0.60  0.78    1  192  271  462  192    0    0  462  Q9I956     Matrix metalloproteinase 13 OS=Salmo salar PE=2 SV=1
   66 : H2MHK3_ORYLA        0.59  0.79    1  192  225  416  192    0    0  416  H2MHK3     Uncharacterized protein (Fragment) OS=Oryzias latipes GN=LOC101156669 PE=4 SV=1
   67 : H2MHK5_ORYLA        0.59  0.79    1  192  282  473  192    0    0  473  H2MHK5     Uncharacterized protein (Fragment) OS=Oryzias latipes GN=LOC101156669 PE=4 SV=1
   68 : I3JCK2_ORENI        0.59  0.79    1  192  269  460  192    0    0  460  I3JCK2     Uncharacterized protein OS=Oreochromis niloticus GN=LOC100707792 PE=4 SV=1
   69 : W5LYS5_LEPOC        0.59  0.82    1  192  287  478  192    0    0  478  W5LYS5     Uncharacterized protein (Fragment) OS=Lepisosteus oculatus PE=4 SV=1
   70 : F1QFZ8_DANRE        0.58  0.78    1  192  275  466  192    0    0  466  F1QFZ8     Uncharacterized protein (Fragment) OS=Danio rerio GN=mmp13b PE=4 SV=2
   71 : H3CJP8_TETNG        0.58  0.77    1  192  255  446  192    0    0  446  H3CJP8     Uncharacterized protein (Fragment) OS=Tetraodon nigroviridis PE=4 SV=1
   72 : Q4SY27_TETNG        0.58  0.77    1  192  143  334  192    0    0  334  Q4SY27     Chromosome undetermined SCAF12212, whole genome shotgun sequence. (Fragment) OS=Tetraodon nigroviridis GN=GSTENG00010534001 PE=4 SV=1
   73 : H3B0M2_LATCH        0.56  0.76    1  165  285  448  165    1    1  472  H3B0M2     Uncharacterized protein (Fragment) OS=Latimeria chalumnae PE=4 SV=1
   74 : M3ZHI0_XIPMA        0.56  0.79    1  192  281  472  192    0    0  473  M3ZHI0     Uncharacterized protein (Fragment) OS=Xiphophorus maculatus PE=4 SV=1
   75 : H2S9U2_TAKRU        0.55  0.77    1  184  257  440  184    0    0  446  H2S9U2     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=LOC101066804 PE=4 SV=1
   76 : H2S9U3_TAKRU        0.55  0.78    1  192  279  470  192    0    0  470  H2S9U3     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=LOC101066804 PE=4 SV=1
   77 : I2ALK6_TAKRU        0.55  0.78    1  192  268  459  192    0    0  459  I2ALK6     Matrix metalloproteinase OS=Takifugu rubripes GN=MMPF13L PE=2 SV=1
   78 : Q5D712_NOTVI        0.55  0.80    1  192  275  466  192    0    0  469  Q5D712     Collagenase OS=Notophthalmus viridescens GN=Col PE=2 SV=1
   79 : W5KW61_ASTMX        0.55  0.76    1  192  271  462  192    0    0  462  W5KW61     Uncharacterized protein OS=Astyanax mexicanus PE=4 SV=1
   80 : F7F710_ORNAN        0.53  0.77    1  192  114  305  192    0    0  305  F7F710     Uncharacterized protein OS=Ornithorhynchus anatinus GN=LOC100078875 PE=4 SV=1
   81 : G3NT72_GASAC        0.53  0.76    1  192  284  475  192    0    0  475  G3NT72     Uncharacterized protein (Fragment) OS=Gasterosteus aculeatus PE=4 SV=1
   82 : H2S9U1_TAKRU        0.53  0.74    1  192  270  461  192    0    0  464  H2S9U1     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=LOC101066804 PE=4 SV=1
   83 : H3B0B6_LATCH        0.52  0.74    1  192  284  475  192    0    0  475  H3B0B6     Uncharacterized protein (Fragment) OS=Latimeria chalumnae PE=4 SV=1
   84 : M3XJA2_LATCH        0.52  0.74    1  192  275  466  192    0    0  466  M3XJA2     Uncharacterized protein OS=Latimeria chalumnae PE=4 SV=1
   85 : W5LYY3_LEPOC        0.52  0.72    1  174  284  457  174    0    0  474  W5LYY3     Uncharacterized protein (Fragment) OS=Lepisosteus oculatus PE=4 SV=1
   86 : B1WAR8_XENTR        0.51  0.78    1  192  190  381  192    0    0  381  B1WAR8     Mmp1 protein OS=Xenopus tropicalis GN=mmp1 PE=2 SV=1
   87 : F6ST94_XENTR        0.51  0.78    1  192  276  467  192    0    0  467  F6ST94     Uncharacterized protein OS=Xenopus tropicalis GN=mmp1 PE=4 SV=1
   88 : F7EFJ1_XENTR        0.51  0.78    1  192  288  479  192    0    0  479  F7EFJ1     Uncharacterized protein (Fragment) OS=Xenopus tropicalis GN=mmp1 PE=4 SV=1
   89 : MMP18_XENLA         0.51  0.77    1  192  276  467  192    0    0  467  O13065     Matrix metalloproteinase-18 OS=Xenopus laevis GN=mmp18 PE=2 SV=1
   90 : Q28IS0_XENTR        0.51  0.78    1  192  276  467  192    0    0  467  Q28IS0     Matrix metalloproteinase 1 (Interstitial collagenase) OS=Xenopus tropicalis GN=mmp1 PE=2 SV=1
   91 : Q4FZN1_XENLA        0.51  0.77    1  192  286  477  192    0    0  477  Q4FZN1     Mmp18 protein (Fragment) OS=Xenopus laevis GN=mmp18 PE=2 SV=1
   92 : Q5D714_NOTVI        0.51  0.73    2  192  294  484  191    0    0  484  Q5D714     Matrix metalloproteinase 3/10a OS=Notophthalmus viridescens GN=MMP3/10a PE=2 SV=1
   93 : Q98857_CYNPY        0.51  0.72    2  192  293  483  191    0    0  483  Q98857     Stromelysin-1/2-a OS=Cynops pyrrhogaster PE=2 SV=1
   94 : Q9TT73_PIG          0.51  0.77    9  163   20  175  156    1    1  175  Q9TT73     Matrix metalloproteinase 1 (Fragment) OS=Sus scrofa PE=2 SV=1
   95 : A2VD61_XENLA        0.50  0.77    1  192  276  467  192    0    0  467  A2VD61     Mmp18 protein OS=Xenopus laevis GN=mmp1 PE=2 SV=1
   96 : F6UAA1_XENTR        0.50  0.73    2  192  284  474  191    0    0  474  F6UAA1     Uncharacterized protein (Fragment) OS=Xenopus tropicalis GN=mmp8 PE=4 SV=1
   97 : F6WTM6_HORSE        0.50  0.76    1  192  274  466  193    1    1  469  F6WTM6     Interstitial collagenase OS=Equus caballus GN=MMP1 PE=4 SV=1
   98 : G1KMJ5_ANOCA        0.50  0.72    1  192  278  468  192    1    1  468  G1KMJ5     Uncharacterized protein (Fragment) OS=Anolis carolinensis GN=LOC100552848 PE=4 SV=1
   99 : G3SNY5_LOXAF        0.50  0.75    1  192  273  465  193    1    1  465  G3SNY5     Uncharacterized protein OS=Loxodonta africana GN=MMP1 PE=4 SV=1
  100 : K9KB04_HORSE        0.50  0.76    1  192   32  224  193    1    1  227  K9KB04     Interstitial collagenase-like protein (Fragment) OS=Equus caballus PE=2 SV=1
  101 : MMP1_HORSE          0.50  0.76    1  192  274  466  193    1    1  469  Q9XSZ5     Interstitial collagenase OS=Equus caballus GN=MMP1 PE=2 SV=1
  102 : Q5XG17_XENLA        0.50  0.77    1  192  275  466  192    0    0  466  Q5XG17     Mmp18 protein (Fragment) OS=Xenopus laevis GN=mmp18 PE=2 SV=1
  103 : Q7SYX1_XENLA        0.50  0.76    2  192  276  466  191    0    0  466  Q7SYX1     Mmp1-prov protein OS=Xenopus laevis PE=2 SV=1
  104 : W5KG82_ASTMX        0.50  0.76    1  174  282  455  174    0    0  471  W5KG82     Uncharacterized protein OS=Astyanax mexicanus PE=4 SV=1
  105 : W5P5K5_SHEEP        0.50  0.75    1  192  271  464  194    2    2  467  W5P5K5     Uncharacterized protein OS=Ovis aries GN=MMP1 PE=4 SV=1
  106 : E3SW75_ICTPU        0.49  0.73    2  174  285  455  173    1    2  471  E3SW75     Matrix metalloproteinase 13 OS=Ictalurus punctatus PE=4 SV=1
  107 : E3SW76_ICTPU        0.49  0.73    2  174  285  455  173    1    2  471  E3SW76     Matrix metalloproteinase 13 OS=Ictalurus punctatus PE=2 SV=1
  108 : F1MT97_BOVIN        0.49  0.75    1  192  274  466  193    1    1  469  F1MT97     Interstitial collagenase OS=Bos taurus GN=MMP1 PE=4 SV=2
  109 : F6VC12_CALJA        0.49  0.75    1  192  278  470  193    1    1  473  F6VC12     Uncharacterized protein OS=Callithrix jacchus GN=MMP1 PE=4 SV=1
  110 : MMP1_BOVIN          0.49  0.75    1  192  274  466  193    1    1  469  P28053     Interstitial collagenase OS=Bos taurus GN=MMP1 PE=1 SV=1
  111 : MMP1_RABIT          0.49  0.74    1  192  273  465  193    1    1  468  P13943     Interstitial collagenase OS=Oryctolagus cuniculus GN=MMP1 PE=2 SV=1
  112 : Q5U548_XENLA        0.49  0.74    2  192  276  466  191    0    0  466  Q5U548     LOC495372 protein OS=Xenopus laevis GN=mmp8 PE=2 SV=1
  113 : Q71G59_DANRE        0.49  0.72    1  174  284  457  174    0    0  475  Q71G59     Matrix metalloproteinase 13 OS=Danio rerio GN=mmp13a PE=2 SV=1
  114 : Q8MI18_FELCA        0.49  0.73    1  171  223  393  171    0    0  393  Q8MI18     Stromelysin-1 (Fragment) OS=Felis catus PE=2 SV=1
  115 : A1L3D0_MOUSE        0.48  0.72    1  192  285  476  192    0    0  476  A1L3D0     MCG9885 OS=Mus musculus GN=Mmp10 PE=2 SV=1
  116 : B4DN15_HUMAN        0.48  0.75    1  192  208  400  193    1    1  403  B4DN15     cDNA FLJ55228, highly similar to Interstitial collagenase (EC OS=Homo sapiens PE=2 SV=1
  117 : B4DW26_HUMAN        0.48  0.75    1  192  203  395  193    1    1  398  B4DW26     cDNA FLJ54761, highly similar to Interstitial collagenase (EC OS=Homo sapiens PE=2 SV=1
  118 : C9VZX3_PIG          0.48  0.76    1  192  274  466  193    1    1  469  C9VZX3     Matrix metallopeptidase 1 OS=Sus scrofa GN=MMP1 PE=2 SV=1
  119 : C9VZX5_PIG          0.48  0.71    1  192  286  477  192    0    0  477  C9VZX5     Matrix metallopeptidase 10 OS=Sus scrofa GN=MMP10 PE=2 SV=1
  120 : F1MM68_BOVIN        0.48  0.75    1  192  203  395  193    1    1  398  F1MM68     Interstitial collagenase (Fragment) OS=Bos taurus GN=MMP1 PE=4 SV=2
  121 : F1QCX8_DANRE        0.48  0.72    1  178  285  462  178    0    0  476  F1QCX8     Uncharacterized protein OS=Danio rerio GN=mmp13a PE=4 SV=1
  122 : F1SV58_PIG          0.48  0.71    1  192  286  477  192    0    0  477  F1SV58     Uncharacterized protein OS=Sus scrofa GN=MMP3 PE=4 SV=2
  123 : F7B3D4_ORNAN        0.48  0.71    2  192  286  476  191    0    0  476  F7B3D4     Uncharacterized protein OS=Ornithorhynchus anatinus GN=LOC100077197 PE=4 SV=2
  124 : G1NUJ6_MYOLU        0.48  0.74    1  192  285  476  192    0    0  476  G1NUJ6     Uncharacterized protein (Fragment) OS=Myotis lucifugus GN=MMP3 PE=4 SV=1
  125 : G3R0I7_GORGO        0.48  0.74    1  192  274  466  193    1    1  469  G3R0I7     Uncharacterized protein OS=Gorilla gorilla gorilla GN=101131051 PE=4 SV=1
  126 : G3V788_RAT          0.48  0.71    1  192  285  476  192    0    0  476  G3V788     RCG31835 OS=Rattus norvegicus GN=Mmp10 PE=4 SV=1
  127 : G3WNV3_SARHA        0.48  0.69    2  192  283  473  191    0    0  473  G3WNV3     Uncharacterized protein (Fragment) OS=Sarcophilus harrisii GN=MMP12 PE=4 SV=1
  128 : H0X272_OTOGA        0.48  0.75    1  192  273  465  193    1    1  468  H0X272     Uncharacterized protein OS=Otolemur garnettii GN=MMP1 PE=4 SV=1
  129 : H2NF34_PONAB        0.48  0.75    1  192  274  466  193    1    1  469  H2NF34     Uncharacterized protein OS=Pongo abelii GN=MMP1 PE=4 SV=1
  130 : H2Q4N3_PANTR        0.48  0.75    1  192  274  466  193    1    1  469  H2Q4N3     Matrix metallopeptidase 1 (Interstitial collagenase) OS=Pan troglodytes GN=MMP1 PE=2 SV=1
  131 : H3B288_LATCH        0.48  0.72    1  192  283  475  193    1    1  475  H3B288     Uncharacterized protein OS=Latimeria chalumnae PE=4 SV=1
  132 : I3MBV7_SPETR        0.48  0.73    1  192  274  465  193    2    2  468  I3MBV7     Uncharacterized protein OS=Spermophilus tridecemlineatus GN=MMP1 PE=4 SV=1
  133 : K7GD19_PELSI        0.48  0.73    1  192  279  470  192    0    0  470  K7GD19     Uncharacterized protein OS=Pelodiscus sinensis PE=4 SV=1
  134 : M3WNA1_FELCA        0.48  0.73    1  192  278  470  193    1    1  473  M3WNA1     Uncharacterized protein OS=Felis catus GN=MMP1 PE=4 SV=1
  135 : MMP10_MOUSE         0.48  0.72    1  192  285  476  192    0    0  476  O55123     Stromelysin-2 OS=Mus musculus GN=Mmp10 PE=2 SV=1
  136 : MMP10_RAT           0.48  0.71    1  192  285  476  192    0    0  476  P07152     Stromelysin-2 OS=Rattus norvegicus GN=Mmp10 PE=2 SV=1
  137 : MMP1_HUMAN          0.48  0.75    1  192  274  466  193    1    1  469  P03956     Interstitial collagenase OS=Homo sapiens GN=MMP1 PE=1 SV=3
  138 : MMP1_PIG            0.48  0.76    1  192  274  466  193    1    1  469  P21692     Interstitial collagenase OS=Sus scrofa GN=MMP1 PE=1 SV=2
  139 : Q53FK3_HUMAN        0.48  0.75    1  192  274  466  193    1    1  469  Q53FK3     Matrix metalloproteinase 1 preproprotein variant (Fragment) OS=Homo sapiens PE=2 SV=1
  140 : Q53G75_HUMAN        0.48  0.75    1  192  210  402  193    1    1  405  Q53G75     Matrix metalloproteinase 1 preproprotein variant (Fragment) OS=Homo sapiens PE=2 SV=1
  141 : Q53G95_HUMAN        0.48  0.75    1  192  143  335  193    1    1  338  Q53G95     Matrix metalloproteinase 1 preproprotein variant (Fragment) OS=Homo sapiens PE=2 SV=1
  142 : Q53G97_HUMAN        0.48  0.75    1  192  195  387  193    1    1  390  Q53G97     Matrix metalloproteinase 1 preproprotein variant (Fragment) OS=Homo sapiens PE=2 SV=1
  143 : Q5TZP0_HUMAN        0.48  0.75    1  192  274  466  193    1    1  469  Q5TZP0     Matrix metalloproteinase 1 (Interstitial collagenase) OS=Homo sapiens PE=2 SV=1
  144 : Q6P0J8_DANRE        0.48  0.71    1  192  195  385  192    1    1  386  Q6P0J8     Mmp13 protein OS=Danio rerio GN=mmp13a PE=2 SV=1
  145 : Q96DZ4_HUMAN        0.48  0.75    1  192   37  229  193    1    1  232  Q96DZ4     MMP1 protein (Fragment) OS=Homo sapiens GN=MMP1 PE=2 SV=1
  146 : U3CMY2_CALJA        0.48  0.75    1  192  276  468  193    1    1  471  U3CMY2     Interstitial collagenase isoform 1 preproprotein OS=Callithrix jacchus GN=MMP1 PE=2 SV=1
  147 : W5KG83_ASTMX        0.48  0.75    1  174  282  455  174    0    0  471  W5KG83     Uncharacterized protein OS=Astyanax mexicanus PE=4 SV=1
  148 : A5HC56_RABIT        0.47  0.72    2  174  106  278  173    0    0  281  A5HC56     Matrix metalloproteinase 10 (Fragment) OS=Oryctolagus cuniculus PE=2 SV=1
  149 : A5PJJ3_BOVIN        0.47  0.69    2  192  274  463  191    1    1  510  A5PJJ3     MMP27 protein OS=Bos taurus GN=MMP27 PE=2 SV=1
  150 : B0JZI6_DANRE        0.47  0.71    1  178  285  462  178    0    0  476  B0JZI6     Mmp13 protein OS=Danio rerio GN=mmp13a PE=2 SV=1
  151 : B1H2C5_XENTR        0.47  0.71    1  178  285  462  178    0    0  476  B1H2C5     LOC100145387 protein OS=Xenopus tropicalis GN=LOC100145387 PE=2 SV=1
  152 : B4E0I2_HUMAN        0.47  0.70    1  175  252  424  175    1    2  426  B4E0I2     cDNA FLJ51588, highly similar to Neutrophil collagenase (EC OS=Homo sapiens PE=2 SV=1
  153 : C1BJT2_OSMMO        0.47  0.76    1  192  279  470  192    0    0  470  C1BJT2     Collagenase 3 OS=Osmerus mordax GN=MMP13 PE=2 SV=1
  154 : C9VZX4_PIG          0.47  0.75    1  192  274  466  193    1    1  469  C9VZX4     Matrix metallopeptidase 1 OS=Sus scrofa GN=MMP1 PE=4 SV=1
  155 : F1MY91_BOVIN        0.47  0.69    2  192  274  463  191    1    1  510  F1MY91     Uncharacterized protein OS=Bos taurus GN=MMP27 PE=4 SV=2
  156 : F1R3P5_DANRE        0.47  0.71    1  178  285  462  178    0    0  476  F1R3P5     Uncharacterized protein OS=Danio rerio GN=mmp13a PE=4 SV=1
  157 : F6SSU7_MONDO        0.47  0.70    2  192  282  472  191    0    0  472  F6SSU7     Uncharacterized protein OS=Monodelphis domestica GN=LOC100012514 PE=4 SV=1
  158 : F6WL75_MONDO        0.47  0.69    1  192  274  466  193    1    1  469  F6WL75     Uncharacterized protein OS=Monodelphis domestica GN=MMP1 PE=4 SV=2
  159 : F6WYF2_MACMU        0.47  0.74    1  192  274  466  193    1    1  469  F6WYF2     Uncharacterized protein OS=Macaca mulatta GN=MMP1 PE=4 SV=1
  160 : G1LUG7_AILME        0.47  0.73    1  192  277  469  193    1    1  469  G1LUG7     Uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=MMP1 PE=4 SV=1
  161 : G1PD04_MYOLU        0.47  0.75    1  192  273  465  193    1    1  468  G1PD04     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
  162 : G1QCH0_MYOLU        0.47  0.74    1  192  240  431  193    2    2  434  G1QCH0     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  163 : G1R6C9_NOMLE        0.47  0.75    1  192  275  467  193    1    1  470  G1R6C9     Uncharacterized protein OS=Nomascus leucogenys GN=MMP1 PE=4 SV=1
  164 : G3R051_GORGO        0.47  0.69    1  192  275  464  192    1    2  467  G3R051     Uncharacterized protein OS=Gorilla gorilla gorilla GN=101130698 PE=4 SV=1
  165 : G3WLF4_SARHA        0.47  0.73    2  192  277  466  191    1    1  512  G3WLF4     Uncharacterized protein OS=Sarcophilus harrisii GN=MMP27 PE=4 SV=1
  166 : G5BUC1_HETGA        0.47  0.72    2  192  277  466  191    1    1  511  G5BUC1     Matrix metalloproteinase-27 OS=Heterocephalus glaber GN=GW7_15553 PE=4 SV=1
  167 : G5BUC3_HETGA        0.47  0.75    1  190  286  475  190    0    0  475  G5BUC3     Stromelysin-2 (Fragment) OS=Heterocephalus glaber GN=GW7_15555 PE=4 SV=1
  168 : G7NB35_MACMU        0.47  0.74    1  192  274  466  193    1    1  469  G7NB35     Putative uncharacterized protein OS=Macaca mulatta GN=EGK_05760 PE=4 SV=1
  169 : G7PNK5_MACFA        0.47  0.74    1  192  274  466  193    1    1  469  G7PNK5     Putative uncharacterized protein OS=Macaca fascicularis GN=EGM_06163 PE=4 SV=1
  170 : H2Q4N2_PANTR        0.47  0.73    1  192  286  477  192    0    0  477  H2Q4N2     Matrix metallopeptidase 3 (Stromelysin 1, progelatinase) OS=Pan troglodytes GN=MMP3 PE=2 SV=1
  171 : I3KFV5_ORENI        0.47  0.72    1  192  282  473  192    0    0  476  I3KFV5     Uncharacterized protein (Fragment) OS=Oreochromis niloticus GN=LOC100711450 PE=4 SV=1
  172 : I3KFV6_ORENI        0.47  0.72    1  192  215  406  192    0    0  409  I3KFV6     Uncharacterized protein OS=Oreochromis niloticus GN=LOC100711450 PE=4 SV=1
  173 : J9NZI8_CANFA        0.47  0.75    1  192  273  465  193    1    1  465  J9NZI8     Uncharacterized protein OS=Canis familiaris GN=MMP1 PE=4 SV=1
  174 : K7D0F3_PANTR        0.47  0.74    1  192  286  477  192    0    0  477  K7D0F3     Matrix metallopeptidase 3 (Stromelysin 1, progelatinase) OS=Pan troglodytes GN=MMP3 PE=2 SV=1
  175 : K7DE67_PANTR        0.47  0.73    1  192  286  477  192    0    0  477  K7DE67     Matrix metallopeptidase 3 (Stromelysin 1, progelatinase) OS=Pan troglodytes GN=MMP3 PE=2 SV=1
  176 : K7DHU7_PANTR        0.47  0.73    1  192  285  476  192    0    0  476  K7DHU7     Matrix metallopeptidase 3 (Stromelysin 1, progelatinase) OS=Pan troglodytes GN=MMP3 PE=2 SV=1
  177 : L5KYH7_PTEAL        0.47  0.76    1  192  275  467  193    1    1  470  L5KYH7     Interstitial collagenase OS=Pteropus alecto GN=PAL_GLEAN10013822 PE=4 SV=1
  178 : L8IDR8_9CETA        0.47  0.69    2  192  275  464  191    1    1  511  L8IDR8     Matrix metalloproteinase-27 OS=Bos mutus GN=M91_02021 PE=4 SV=1
  179 : M3Y6W1_MUSPF        0.47  0.69    2  192  276  465  191    1    1  510  M3Y6W1     Uncharacterized protein OS=Mustela putorius furo GN=MMP27 PE=4 SV=1
  180 : MMP3_CANFA          0.47  0.72    1  192  287  478  192    0    0  478  Q6Y4Q5     Stromelysin-1 OS=Canis familiaris GN=MMP3 PE=2 SV=1
  181 : Q53G96_HUMAN        0.47  0.74    1  192  274  466  193    1    1  469  Q53G96     Matrix metalloproteinase 1 preproprotein variant (Fragment) OS=Homo sapiens PE=2 SV=1
  182 : Q9DEE0_ONCMY        0.47  0.73    1  192  284  475  192    0    0  475  Q9DEE0     Matrix metalloproteinase OS=Oncorhynchus mykiss GN=mmp PE=2 SV=1
  183 : S7MNY7_MYOBR        0.47  0.73    1  192  284  475  192    0    0  475  S7MNY7     Stromelysin-1 OS=Myotis brandtii GN=D623_10002004 PE=4 SV=1
  184 : S7MRI7_MYOBR        0.47  0.74    1  192  274  466  193    1    1  469  S7MRI7     Interstitial collagenase OS=Myotis brandtii GN=D623_10002005 PE=4 SV=1
  185 : U3IED6_ANAPL        0.47  0.72    1  192  277  468  193    2    2  468  U3IED6     Uncharacterized protein (Fragment) OS=Anas platyrhynchos PE=4 SV=1
  186 : A8K9E4_HUMAN        0.46  0.69    1  192  275  464  192    1    2  467  A8K9E4     cDNA FLJ76459, highly similar to Homo sapiens matrix metallopeptidase 8 (neutrophil collagenase) (MMP8), mRNA OS=Homo sapiens PE=2 SV=1
  187 : B5X4P7_SALSA        0.46  0.74    1  192  282  473  192    0    0  473  B5X4P7     Collagenase 3 OS=Salmo salar GN=MMP13 PE=2 SV=1
  188 : D2HIG9_AILME        0.46  0.70    2  192  243  432  191    1    1  479  D2HIG9     Putative uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=PANDA_011001 PE=4 SV=1
  189 : D2HIH3_AILME        0.46  0.70    1  192  251  442  192    0    0  442  D2HIH3     Putative uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=PANDA_011006 PE=4 SV=1
  190 : D3YV89_MOUSE        0.46  0.73    2  192  317  506  191    1    1  551  D3YV89     Protein Mmp27 OS=Mus musculus GN=Mmp27 PE=4 SV=1
  191 : D3Z6I1_MOUSE        0.46  0.73    2  192  291  480  191    1    1  525  D3Z6I1     Protein Mmp27 OS=Mus musculus GN=Mmp27 PE=4 SV=1
  192 : E2RBI3_CANFA        0.46  0.70    5  192  279  465  188    1    1  512  E2RBI3     Uncharacterized protein OS=Canis familiaris GN=MMP27 PE=4 SV=1
  193 : F1CG30_9SAUR        0.46  0.70    1  192  289  480  192    0    0  481  F1CG30     Matrix metalloproteinase 3 OS=Mauremys mutica GN=MMP3 PE=2 SV=1
  194 : F1SV70_PIG          0.46  0.70    2  192  274  463  191    1    1  510  F1SV70     Uncharacterized protein OS=Sus scrofa GN=MMP27 PE=4 SV=2
  195 : F6QKX8_MOUSE        0.46  0.72    2  192  236  425  191    1    1  470  F6QKX8     Protein Mmp27 (Fragment) OS=Mus musculus GN=Mmp27 PE=4 SV=1
  196 : F6T9W9_HORSE        0.46  0.71    5  192  291  478  188    0    0  478  F6T9W9     Stromelysin-1 (Fragment) OS=Equus caballus GN=MMP3 PE=4 SV=1
  197 : F6UI50_HORSE        0.46  0.71    2  192  276  465  191    1    1  511  F6UI50     Uncharacterized protein OS=Equus caballus GN=MMP27 PE=4 SV=1
  198 : F6X261_MONDO        0.46  0.71    2  192  276  465  191    1    1  481  F6X261     Uncharacterized protein OS=Monodelphis domestica GN=MMP27 PE=4 SV=1
  199 : F7IPB7_CALJA        0.46  0.72    1  192  286  477  192    0    0  477  F7IPB7     Uncharacterized protein OS=Callithrix jacchus GN=MMP3 PE=4 SV=1
  200 : G1KXX7_ANOCA        0.46  0.74    2  192  315  504  191    1    1  504  G1KXX7     Uncharacterized protein OS=Anolis carolinensis GN=MMP27 PE=4 SV=2
  201 : G1LU59_AILME        0.46  0.70    2  192  277  466  191    1    1  514  G1LU59     Uncharacterized protein OS=Ailuropoda melanoleuca GN=MMP27 PE=4 SV=1
  202 : G1LUK6_AILME        0.46  0.69    1  192  287  481  195    1    3  481  G1LUK6     Uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=LOC100478420 PE=4 SV=1
  203 : G1NQJ4_MELGA        0.46  0.71    2  192  314  504  191    0    0  504  G1NQJ4     Uncharacterized protein (Fragment) OS=Meleagris gallopavo GN=LOC100544485 PE=4 SV=2
  204 : G1NQJ5_MELGA        0.46  0.71    2  192  307  497  191    0    0  497  G1NQJ5     Uncharacterized protein (Fragment) OS=Meleagris gallopavo GN=LOC100544485 PE=4 SV=2
  205 : G1R6D5_NOMLE        0.46  0.73    1  192  286  477  192    0    0  477  G1R6D5     Uncharacterized protein OS=Nomascus leucogenys GN=MMP3 PE=4 SV=1
  206 : G1TEU2_RABIT        0.46  0.71    2  192  287  477  191    0    0  477  G1TEU2     Uncharacterized protein OS=Oryctolagus cuniculus GN=MMP10 PE=4 SV=2
  207 : G3R469_GORGO        0.46  0.72    1  192  291  482  192    0    0  482  G3R469     Uncharacterized protein (Fragment) OS=Gorilla gorilla gorilla GN=101131989 PE=4 SV=1
  208 : G3RUD4_GORGO        0.46  0.72    2  192  286  476  191    0    0  476  G3RUD4     Uncharacterized protein OS=Gorilla gorilla gorilla GN=101131626 PE=4 SV=1
  209 : G3TAT7_LOXAF        0.46  0.70    2  192  276  465  191    1    1  512  G3TAT7     Uncharacterized protein OS=Loxodonta africana GN=MMP27 PE=4 SV=1
  210 : G3TPE1_LOXAF        0.46  0.71    1  192  285  476  192    0    0  476  G3TPE1     Uncharacterized protein OS=Loxodonta africana GN=MMP10 PE=4 SV=1
  211 : G3WLP3_SARHA        0.46  0.73    1  192  289  480  192    0    0  480  G3WLP3     Uncharacterized protein OS=Sarcophilus harrisii GN=MMP8 PE=4 SV=1
  212 : G7PNK4_MACFA        0.46  0.71    1  192  285  476  192    0    0  476  G7PNK4     Putative uncharacterized protein OS=Macaca fascicularis GN=EGM_06162 PE=4 SV=1
  213 : H2NF33_PONAB        0.46  0.70    1  192  275  464  192    1    2  465  H2NF33     Uncharacterized protein OS=Pongo abelii GN=MMP8 PE=4 SV=1
  214 : H2NF35_PONAB        0.46  0.72    1  192  286  477  192    0    0  477  H2NF35     Uncharacterized protein OS=Pongo abelii GN=MMP3 PE=4 SV=1
  215 : H2Q4N0_PANTR        0.46  0.69    1  192  275  464  192    1    2  467  H2Q4N0     Uncharacterized protein OS=Pan troglodytes GN=MMP8 PE=4 SV=1
  216 : H2Q4N1_PANTR        0.46  0.72    2  192  286  476  191    0    0  476  H2Q4N1     Uncharacterized protein OS=Pan troglodytes GN=MMP10 PE=4 SV=1
  217 : H9H491_MACMU        0.46  0.72    1  192  285  476  192    0    0  476  H9H491     Uncharacterized protein OS=Macaca mulatta GN=MMP10 PE=4 SV=1
  218 : I3LUE9_PIG          0.46  0.70    2  192  274  463  191    1    1  513  I3LUE9     Uncharacterized protein OS=Sus scrofa GN=MMP27 PE=4 SV=1
  219 : L5KYP3_PTEAL        0.46  0.69    2  192  743  932  192    3    3  980  L5KYP3     Matrix metalloproteinase-27 OS=Pteropus alecto GN=PAL_GLEAN10013820 PE=4 SV=1
  220 : L9KQ81_TUPCH        0.46  0.72    2  192  718  907  191    1    1  954  L9KQ81     Matrix metalloproteinase-27 OS=Tupaia chinensis GN=TREES_T100006577 PE=4 SV=1
  221 : M3WN99_FELCA        0.46  0.70    2  192  276  465  191    1    1  513  M3WN99     Uncharacterized protein OS=Felis catus GN=MMP27 PE=4 SV=1
  222 : M3WNA6_FELCA        0.46  0.72    1  192  287  478  192    0    0  478  M3WNA6     Uncharacterized protein OS=Felis catus GN=MMP10 PE=4 SV=1
  223 : M3Y665_MUSPF        0.46  0.76    1  192  278  470  193    1    1  470  M3Y665     Uncharacterized protein OS=Mustela putorius furo GN=MMP1 PE=4 SV=1
  224 : MMP10_HUMAN         0.46  0.73    2  192  286  476  191    0    0  476  P09238     Stromelysin-2 OS=Homo sapiens GN=MMP10 PE=1 SV=1
  225 : MMP27_TUPBE         0.46  0.72    2  192  276  465  191    1    1  512  Q9GKE1     Matrix metalloproteinase-27 OS=Tupaia belangeri GN=MMP27 PE=2 SV=1
  226 : MMP3_HORSE          0.46  0.71    5  192  290  477  188    0    0  477  Q28397     Stromelysin-1 OS=Equus caballus GN=MMP3 PE=2 SV=1
  227 : MMP3_HUMAN          0.46  0.72    1  192  286  477  192    0    0  477  P08254     Stromelysin-1 OS=Homo sapiens GN=MMP3 PE=1 SV=2
  228 : MMP8_HUMAN          0.46  0.69    1  192  275  464  192    1    2  467  P22894     Neutrophil collagenase OS=Homo sapiens GN=MMP8 PE=1 SV=1
  229 : Q3U1P0_MOUSE        0.46  0.69    1  192  275  464  192    1    2  465  Q3U1P0     Putative uncharacterized protein OS=Mus musculus GN=Mmp8 PE=2 SV=1
  230 : R0KC93_ANAPL        0.46  0.71    1  192  244  434  192    1    1  434  R0KC93     Interstitial collagenase (Fragment) OS=Anas platyrhynchos GN=Anapl_05636 PE=4 SV=1
  231 : R0KCA4_ANAPL        0.46  0.70    2  192  285  475  191    0    0  475  R0KCA4     Stromelysin-2 (Fragment) OS=Anas platyrhynchos GN=Anapl_05638 PE=4 SV=1
  232 : U3IGR3_ANAPL        0.46  0.70    2  192  297  487  191    0    0  487  U3IGR3     Uncharacterized protein OS=Anas platyrhynchos PE=4 SV=1
  233 : W5P4V3_SHEEP        0.46  0.70    1  192  288  479  192    0    0  479  W5P4V3     Uncharacterized protein (Fragment) OS=Ovis aries GN=MMP3 PE=4 SV=1
  234 : W5P629_SHEEP        0.46  0.67    1  192  286  475  192    1    2  476  W5P629     Uncharacterized protein (Fragment) OS=Ovis aries GN=MMP8 PE=4 SV=1
  235 : W5P6G5_SHEEP        0.46  0.69    2  192  275  464  191    1    1  511  W5P6G5     Uncharacterized protein OS=Ovis aries GN=MMP27 PE=4 SV=1
  236 : E1C9E0_CHICK        0.45  0.70    2  192  306  496  191    0    0  496  E1C9E0     Uncharacterized protein OS=Gallus gallus GN=MMP10 PE=4 SV=2
  237 : F1LPL9_RAT          0.45  0.72    5  192  283  470  188    0    0  470  F1LPL9     Stromelysin-1 OS=Rattus norvegicus GN=Mmp3 PE=4 SV=2
  238 : F1NZ61_CHICK        0.45  0.75    1  192  295  485  192    1    1  485  F1NZ61     Uncharacterized protein OS=Gallus gallus GN=MMP27 PE=4 SV=2
  239 : F1SV69_PIG          0.45  0.68    1  192  278  467  192    1    2  468  F1SV69     Uncharacterized protein OS=Sus scrofa GN=MMP8 PE=4 SV=2
  240 : F6R7B4_HORSE        0.45  0.69    1  192  279  468  192    1    2  471  F6R7B4     Uncharacterized protein OS=Equus caballus GN=MMP8 PE=4 SV=1
  241 : F6V381_CALJA        0.45  0.74    1  192  286  477  192    0    0  477  F6V381     Uncharacterized protein OS=Callithrix jacchus GN=MMP10 PE=4 SV=1
  242 : F6W5H0_MONDO        0.45  0.71    2  192  300  490  191    0    0  490  F6W5H0     Uncharacterized protein OS=Monodelphis domestica GN=MMP3 PE=4 SV=2
  243 : F6WLV8_MONDO        0.45  0.73    1  192  280  471  192    0    0  472  F6WLV8     Uncharacterized protein OS=Monodelphis domestica GN=MMP8 PE=4 SV=1
  244 : F6YVN6_MACMU        0.45  0.72    1  192  286  477  192    0    0  477  F6YVN6     Uncharacterized protein OS=Macaca mulatta GN=MMP3 PE=4 SV=1
  245 : F7B2W9_ORNAN        0.45  0.70    1  192  379  573  196    3    5  573  F7B2W9     Uncharacterized protein (Fragment) OS=Ornithorhynchus anatinus GN=MMP8 PE=4 SV=1
  246 : F7DG83_CALJA        0.45  0.69    2  192  276  465  191    1    1  513  F7DG83     Uncharacterized protein OS=Callithrix jacchus GN=MMP27 PE=4 SV=1
  247 : F7DGR3_CALJA        0.45  0.69    1  192  275  464  192    1    2  465  F7DGR3     Uncharacterized protein OS=Callithrix jacchus GN=MMP8 PE=4 SV=1
  248 : F7DGW0_CALJA        0.45  0.69    1  192  289  478  192    1    2  479  F7DGW0     Uncharacterized protein OS=Callithrix jacchus GN=MMP8 PE=4 SV=1
  249 : F7HUL0_CALJA        0.45  0.69    2  192  277  466  191    1    1  511  F7HUL0     Uncharacterized protein OS=Callithrix jacchus GN=MMP27 PE=4 SV=1
  250 : G1LUC1_AILME        0.45  0.69    1  192  278  468  192    1    1  468  G1LUC1     Uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=MMP8 PE=4 SV=1
  251 : G1NQJ6_MELGA        0.45  0.68    1  192  283  473  192    1    1  473  G1NQJ6     Uncharacterized protein (Fragment) OS=Meleagris gallopavo GN=LOC100543241 PE=4 SV=1
  252 : G1PAW8_MYOLU        0.45  0.69    2  192  275  464  191    1    1  495  G1PAW8     Uncharacterized protein OS=Myotis lucifugus GN=MMP27 PE=4 SV=1
  253 : G1R6B5_NOMLE        0.45  0.69    2  192  276  465  191    1    1  513  G1R6B5     Uncharacterized protein OS=Nomascus leucogenys GN=MMP27 PE=4 SV=1
  254 : G1R6D1_NOMLE        0.45  0.71    2  192  283  473  191    0    0  473  G1R6D1     Uncharacterized protein OS=Nomascus leucogenys GN=MMP10 PE=4 SV=1
  255 : G1T8Z9_RABIT        0.45  0.71    1  192  289  480  192    0    0  480  G1T8Z9     Stromelysin-1 OS=Oryctolagus cuniculus GN=MMP3 PE=4 SV=1
  256 : G3WMF5_SARHA        0.45  0.68    1  192  278  470  193    1    1  473  G3WMF5     Uncharacterized protein (Fragment) OS=Sarcophilus harrisii GN=MMP1 PE=4 SV=1
  257 : G5BUC2_HETGA        0.45  0.68    1  192  278  467  192    1    2  470  G5BUC2     Neutrophil collagenase OS=Heterocephalus glaber GN=GW7_15554 PE=4 SV=1
  258 : G7NB36_MACMU        0.45  0.71    1  192  285  476  192    0    0  476  G7NB36     Putative uncharacterized protein OS=Macaca mulatta GN=EGK_05761 PE=4 SV=1
  259 : G7NBR1_MACMU        0.45  0.72    1  192  286  477  192    0    0  477  G7NBR1     Putative uncharacterized protein OS=Macaca mulatta GN=EGK_06827 PE=4 SV=1
  260 : G7PNK6_MACFA        0.45  0.72    1  192  286  477  192    0    0  477  G7PNK6     Putative uncharacterized protein OS=Macaca fascicularis GN=EGM_06164 PE=4 SV=1
  261 : H0X268_OTOGA        0.45  0.70    1  192  286  478  193    1    1  478  H0X268     Uncharacterized protein OS=Otolemur garnettii GN=MMP10 PE=4 SV=1
  262 : H0ZR75_TAEGU        0.45  0.68    1  192  278  468  192    1    1  468  H0ZR75     Uncharacterized protein OS=Taeniopygia guttata GN=MMP8 PE=4 SV=1
  263 : H2Q4M9_PANTR        0.45  0.70    2  192  276  465  191    1    1  513  H2Q4M9     Uncharacterized protein OS=Pan troglodytes GN=MMP27 PE=4 SV=1
  264 : I3KFV7_ORENI        0.45  0.72    1  192  285  476  192    0    0  476  I3KFV7     Uncharacterized protein (Fragment) OS=Oreochromis niloticus GN=LOC100711450 PE=4 SV=1
  265 : I3MBS7_SPETR        0.45  0.73    2  192  277  466  191    1    1  507  I3MBS7     Uncharacterized protein OS=Spermophilus tridecemlineatus GN=MMP27 PE=4 SV=1
  266 : K7DQP5_PANTR        0.45  0.71    2  192  287  477  191    0    0  477  K7DQP5     Matrix metallopeptidase 3 (Stromelysin 1, progelatinase) OS=Pan troglodytes GN=MMP3 PE=2 SV=1
  267 : K7GCD9_PELSI        0.45  0.70    1  192  285  476  192    0    0  476  K7GCD9     Uncharacterized protein OS=Pelodiscus sinensis PE=4 SV=1
  268 : M3WNA0_FELCA        0.45  0.68    1  192  278  467  192    1    2  468  M3WNA0     Uncharacterized protein OS=Felis catus GN=MMP8 PE=4 SV=1
  269 : M3WNA2_FELCA        0.45  0.70    1  192  290  481  192    0    0  481  M3WNA2     Uncharacterized protein (Fragment) OS=Felis catus GN=MMP3 PE=4 SV=1
  270 : MMP3_RABIT          0.45  0.71    1  192  287  478  192    0    0  478  P28863     Stromelysin-1 OS=Oryctolagus cuniculus GN=MMP3 PE=2 SV=1
  271 : MMP3_RAT            0.45  0.72    5  192  288  475  188    0    0  475  P03957     Stromelysin-1 OS=Rattus norvegicus GN=Mmp3 PE=1 SV=1
  272 : O93342_CHICK        0.45  0.76    1  192  282  472  192    1    1  472  O93342     Matrix metalloproteinase OS=Gallus gallus PE=2 SV=1
  273 : R0LQI5_ANAPL        0.45  0.75    2  192  283  472  191    1    1  472  R0LQI5     Matrix metalloproteinase-27 (Fragment) OS=Anas platyrhynchos GN=MMP27 PE=4 SV=1
  274 : U3JC80_FICAL        0.45  0.77    1  192  320  510  192    1    1  510  U3JC80     Uncharacterized protein OS=Ficedula albicollis GN=MMP27 PE=4 SV=1
  275 : U3JC98_FICAL        0.45  0.69    1  192  281  471  192    1    1  471  U3JC98     Uncharacterized protein (Fragment) OS=Ficedula albicollis PE=4 SV=1
  276 : U3JCA3_FICAL        0.45  0.69    2  192  312  502  191    0    0  502  U3JCA3     Uncharacterized protein OS=Ficedula albicollis PE=4 SV=1
  277 : D2HIH1_AILME        0.44  0.72    1  192  286  477  192    0    0  477  D2HIH1     Uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=LOC100477912 PE=4 SV=1
  278 : D2HIH2_AILME        0.44  0.69    1  192  240  442  203    2   11  442  D2HIH2     Putative uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=PANDA_011005 PE=4 SV=1
  279 : D3ZQ07_RAT          0.44  0.72    2  192  277  466  192    3    3  511  D3ZQ07     Matrix metalloproteinase 27 (Predicted) OS=Rattus norvegicus GN=Mmp27 PE=4 SV=1
  280 : E1C9D9_CHICK        0.44  0.69    1  192  276  466  192    1    1  466  E1C9D9     Uncharacterized protein OS=Gallus gallus GN=MMP1 PE=4 SV=1
  281 : F1PVR0_CANFA        0.44  0.67    1  192  286  475  192    1    2  476  F1PVR0     Uncharacterized protein OS=Canis familiaris GN=MMP8 PE=4 SV=2
  282 : F7B3A2_ORNAN        0.44  0.73    1  192  277  469  193    1    1  469  F7B3A2     Uncharacterized protein (Fragment) OS=Ornithorhynchus anatinus GN=MMP1 PE=4 SV=1
  283 : F7GG37_MACMU        0.44  0.68    1  192  275  464  192    1    2  467  F7GG37     Uncharacterized protein OS=Macaca mulatta GN=MMP8 PE=4 SV=1
  284 : G1PAZ7_MYOLU        0.44  0.68    1  192  278  467  192    1    2  468  G1PAZ7     Uncharacterized protein OS=Myotis lucifugus GN=MMP8 PE=4 SV=1
  285 : G1SEQ5_RABIT        0.44  0.72    2  192  276  465  191    1    1  527  G1SEQ5     Uncharacterized protein OS=Oryctolagus cuniculus GN=MMP27 PE=4 SV=2
  286 : G1SEQ6_RABIT        0.44  0.69    1  192  160  349  192    1    2  350  G1SEQ6     Uncharacterized protein (Fragment) OS=Oryctolagus cuniculus GN=MMP8 PE=4 SV=1
  287 : G3N0J0_BOVIN        0.44  0.67    1  192  278  467  192    1    2  468  G3N0J0     Uncharacterized protein OS=Bos taurus GN=MMP8 PE=4 SV=1
  288 : G3R045_GORGO        0.44  0.70    2  192  276  465  191    1    1  513  G3R045     Uncharacterized protein OS=Gorilla gorilla gorilla GN=101130319 PE=4 SV=1
  289 : G3T4X3_LOXAF        0.44  0.68    1  192  289  480  192    0    0  480  G3T4X3     Uncharacterized protein (Fragment) OS=Loxodonta africana GN=LOC100660303 PE=4 SV=1
  290 : G3TAU0_LOXAF        0.44  0.68    1  192  278  467  192    1    2  468  G3TAU0     Uncharacterized protein OS=Loxodonta africana GN=MMP8 PE=4 SV=1
  291 : G3V7D0_RAT          0.44  0.69    1  192  276  465  192    1    2  466  G3V7D0     Matrix metallopeptidase 8 OS=Rattus norvegicus GN=Mmp8 PE=4 SV=1
  292 : G3WNE3_SARHA        0.44  0.71    2  192  284  474  191    0    0  474  G3WNE3     Uncharacterized protein OS=Sarcophilus harrisii GN=MMP3 PE=4 SV=1
  293 : G5BUC4_HETGA        0.44  0.74    1  192  254  445  193    2    2  446  G5BUC4     Interstitial collagenase (Fragment) OS=Heterocephalus glaber GN=GW7_15556 PE=4 SV=1
  294 : G7NB38_MACMU        0.44  0.68    1  192  275  464  192    1    2  467  G7NB38     Putative uncharacterized protein OS=Macaca mulatta GN=EGK_05763 PE=4 SV=1
  295 : G7PNK2_MACFA        0.44  0.68    1  192  275  464  192    1    2  467  G7PNK2     Putative uncharacterized protein OS=Macaca fascicularis GN=EGM_06160 PE=4 SV=1
  296 : H0VPL5_CAVPO        0.44  0.68    1  192  278  467  192    1    2  468  H0VPL5     Uncharacterized protein OS=Cavia porcellus GN=MMP8 PE=4 SV=1
  297 : H0X273_OTOGA        0.44  0.71    1  192  288  479  192    0    0  479  H0X273     Uncharacterized protein OS=Otolemur garnettii GN=MMP3 PE=4 SV=1
  298 : H0X275_OTOGA        0.44  0.67    2  192  277  468  192    1    1  468  H0X275     Uncharacterized protein OS=Otolemur garnettii PE=4 SV=1
  299 : H0XCW8_OTOGA        0.44  0.69    1  192  275  464  192    1    2  465  H0XCW8     Uncharacterized protein OS=Otolemur garnettii GN=MMP8 PE=4 SV=1
  300 : H2S6Q9_TAKRU        0.44  0.70    1  192  287  478  192    0    0  478  H2S6Q9     Uncharacterized protein OS=Takifugu rubripes GN=LOC101074218 PE=4 SV=1
  301 : I2ALK3_TAKRU        0.44  0.70    1  192  280  471  192    0    0  474  I2ALK3     Matrix metalloproteinase OS=Takifugu rubripes GN=MMPF1 PE=2 SV=1
  302 : L8IBW9_9CETA        0.44  0.67    1  192  278  467  192    1    2  470  L8IBW9     Neutrophil collagenase OS=Bos mutus GN=M91_02020 PE=4 SV=1
  303 : M3Y658_MUSPF        0.44  0.70    1  192  285  476  192    0    0  476  M3Y658     Uncharacterized protein OS=Mustela putorius furo GN=MMP3 PE=4 SV=1
  304 : M4AHS9_XIPMA        0.44  0.71    1  192  394  583  193    3    4  583  M4AHS9     Uncharacterized protein (Fragment) OS=Xiphophorus maculatus PE=4 SV=1
  305 : MMP27_HUMAN         0.44  0.70    2  192  276  465  191    1    1  513  Q9H306     Matrix metalloproteinase-27 OS=Homo sapiens GN=MMP27 PE=2 SV=2
  306 : MMP3_MOUSE          0.44  0.72    1  192  286  477  192    0    0  477  P28862     Stromelysin-1 OS=Mus musculus GN=Mmp3 PE=2 SV=2
  307 : MMP8_MOUSE          0.44  0.70    1  192  275  464  192    1    2  465  O70138     Neutrophil collagenase OS=Mus musculus GN=Mmp8 PE=2 SV=2
  308 : MMP8_RAT            0.44  0.69    1  192  276  465  192    1    2  466  O88766     Neutrophil collagenase OS=Rattus norvegicus GN=Mmp8 PE=2 SV=1
  309 : Q3TAV4_MOUSE        0.44  0.70    1  192  275  464  192    1    2  465  Q3TAV4     Putative uncharacterized protein OS=Mus musculus GN=Mmp8 PE=2 SV=1
  310 : Q3TCE6_MOUSE        0.44  0.69    1  192  275  464  192    1    2  465  Q3TCE6     Putative uncharacterized protein OS=Mus musculus GN=Mmp8 PE=2 SV=1
  311 : Q3TD42_MOUSE        0.44  0.70    1  192  275  464  192    1    2  465  Q3TD42     Putative uncharacterized protein OS=Mus musculus GN=Mmp8 PE=2 SV=1
  312 : Q3UFJ0_MOUSE        0.44  0.72    1  192  288  479  192    0    0  479  Q3UFJ0     Putative uncharacterized protein OS=Mus musculus GN=Mmp3 PE=2 SV=1
  313 : Q8C209_MOUSE        0.44  0.70    1  192  275  464  192    1    2  465  Q8C209     Putative uncharacterized protein OS=Mus musculus GN=Mmp8 PE=2 SV=1
  314 : Q8C230_MOUSE        0.44  0.70    1  192  275  464  192    1    2  465  Q8C230     Putative uncharacterized protein OS=Mus musculus GN=Mmp8 PE=2 SV=1
  315 : Q922W6_MOUSE        0.44  0.72    1  192  288  479  192    0    0  479  Q922W6     MCG9886 OS=Mus musculus GN=Mmp3 PE=2 SV=1
  316 : S9WV44_9CETA        0.44  0.70    2  192  519  708  191    1    1  751  S9WV44     Matrix metalloproteinase-27 OS=Camelus ferus GN=CB1_000877051 PE=4 SV=1
  317 : U6D953_NEOVI        0.44  0.70   22  192    1  169  171    1    2  169  U6D953     Neutrophil collagenase (Fragment) OS=Neovison vison GN=MMP8 PE=2 SV=1
  318 : A2VD32_DANRE        0.43  0.64    1  192  285  474  195    5    8  475  A2VD32     Zgc:136396 protein OS=Danio rerio GN=mmp30 PE=2 SV=1
  319 : B5DFD5_RAT          0.43  0.66    1  192  272  464  193    1    1  464  B5DFD5     Interstitial collagenase OS=Rattus norvegicus GN=Mmp1 PE=2 SV=1
  320 : D2HIH0_AILME        0.43  0.69    2  192  243  434  192    1    1  435  D2HIH0     Putative uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=PANDA_011003 PE=4 SV=1
  321 : D3ZRZ2_RAT          0.43  0.69    1  192  217  409  193    1    1  409  D3ZRZ2     Protein Mmp1b (Fragment) OS=Rattus norvegicus GN=Mmp1b PE=4 SV=2
  322 : F1MTX6_BOVIN        0.43  0.67    1  192  477  672  196    2    4  672  F1MTX6     Uncharacterized protein (Fragment) OS=Bos taurus GN=MMP3 PE=4 SV=2
  323 : F1PVQ8_CANFA        0.43  0.70    1  192  314  505  193    2    2  505  F1PVQ8     Uncharacterized protein (Fragment) OS=Canis familiaris GN=MMP1 PE=4 SV=2
  324 : F1RBI6_DANRE        0.43  0.64    1  192  289  478  195    5    8  479  F1RBI6     Uncharacterized protein (Fragment) OS=Danio rerio GN=mmp30 PE=4 SV=1
  325 : F7EJ90_XENTR        0.43  0.68    5  192  251  438  188    0    0  438  F7EJ90     Uncharacterized protein (Fragment) OS=Xenopus tropicalis GN=LOC100494588 PE=4 SV=1
  326 : F7GQW5_MACMU        0.43  0.70    2  192  276  465  191    1    1  513  F7GQW5     Uncharacterized protein OS=Macaca mulatta GN=MMP27 PE=4 SV=1
  327 : F7IH65_CALJA        0.43  0.66    2  192  279  469  191    0    0  469  F7IH65     Uncharacterized protein OS=Callithrix jacchus GN=MMP12 PE=4 SV=1
  328 : G1KMJ3_ANOCA        0.43  0.66    2  192  299  488  192    3    3  488  G1KMJ3     Uncharacterized protein OS=Anolis carolinensis GN=LOC100561433 PE=4 SV=2
  329 : G1NQJ7_MELGA        0.43  0.74    1  192  283  474  193    2    2  474  G1NQJ7     Uncharacterized protein OS=Meleagris gallopavo GN=MMP27 PE=4 SV=2
  330 : G1SUW9_RABIT        0.43  0.64    2  192  274  464  191    0    0  464  G1SUW9     Macrophage metalloelastase OS=Oryctolagus cuniculus GN=MMP12 PE=4 SV=2
  331 : G3Q9Q5_GASAC        0.43  0.71    1  192  278  469  192    0    0  472  G3Q9Q5     Uncharacterized protein OS=Gasterosteus aculeatus PE=4 SV=1
  332 : G3T4Y0_LOXAF        0.43  0.64    2  192  284  474  191    0    0  474  G3T4Y0     Uncharacterized protein OS=Loxodonta africana GN=MMP12 PE=4 SV=1
  333 : G7NB39_MACMU        0.43  0.70    2  192  276  465  191    1    1  513  G7NB39     Putative uncharacterized protein OS=Macaca mulatta GN=EGK_05764 PE=4 SV=1
  334 : G7PNK1_MACFA        0.43  0.70    2  192  276  465  191    1    1  513  G7PNK1     Putative uncharacterized protein OS=Macaca fascicularis GN=EGM_06159 PE=4 SV=1
  335 : H0XCW4_OTOGA        0.43  0.72    2  192  245  434  191    1    1  481  H0XCW4     Uncharacterized protein (Fragment) OS=Otolemur garnettii GN=MMP27 PE=4 SV=1
  336 : H2S6Q8_TAKRU        0.43  0.68    1  192  315  512  198    1    6  512  H2S6Q8     Uncharacterized protein OS=Takifugu rubripes GN=LOC101074218 PE=4 SV=1
  337 : H3CC98_TETNG        0.43  0.71    1  192  277  468  192    0    0  471  H3CC98     Uncharacterized protein (Fragment) OS=Tetraodon nigroviridis PE=4 SV=1
  338 : I3MBW6_SPETR        0.43  0.70    1  192  289  480  193    2    2  480  I3MBW6     Uncharacterized protein OS=Spermophilus tridecemlineatus GN=MMP3 PE=4 SV=1
  339 : L9KUT2_TUPCH        0.43  0.70    1  192  285  476  192    0    0  476  L9KUT2     Stromelysin-1 OS=Tupaia chinensis GN=TREES_T100006573 PE=4 SV=1
  340 : M3Y678_MUSPF        0.43  0.69    1  192  283  473  193    2    3  473  M3Y678     Uncharacterized protein OS=Mustela putorius furo GN=MMP8 PE=4 SV=1
  341 : MMP12_RABIT         0.43  0.64    2  192  274  464  191    0    0  464  P79227     Macrophage metalloelastase OS=Oryctolagus cuniculus GN=MMP12 PE=2 SV=1
  342 : Q1RM69_DANRE        0.43  0.64    1  192  285  474  195    5    8  475  Q1RM69     Zgc:136396 OS=Danio rerio GN=mmp30 PE=2 SV=1
  343 : Q4T946_TETNG        0.43  0.71    1  192  322  513  192    0    0  514  Q4T946     Chromosome undetermined SCAF7642, whole genome shotgun sequence. (Fragment) OS=Tetraodon nigroviridis GN=GSTENG00004922001 PE=4 SV=1
  344 : Q566U1_DANRE        0.43  0.64    1  192  289  478  195    5    8  479  Q566U1     LOC553390 protein (Fragment) OS=Danio rerio GN=mmp30 PE=2 SV=1
  345 : Q5D711_NOTVI        0.43  0.67    1  192  278  469  192    0    0  469  Q5D711     Matrix metalloproteinase 3/10b OS=Notophthalmus viridescens GN=MMP3/10b PE=2 SV=1
  346 : Q98858_CYNPY        0.43  0.68    5  192  282  469  188    0    0  469  Q98858     Stromelysin-1/2-b OS=Cynops pyrrhogaster PE=2 SV=1
  347 : Q9TV75_RABIT        0.43  0.64    2  192  274  464  191    0    0  464  Q9TV75     Matrix metalloproteinase-12 (Precursor) OS=Oryctolagus cuniculus PE=2 SV=1
  348 : U3JCA0_FICAL        0.43  0.63    2  192  288  477  192    3    3  477  U3JCA0     Uncharacterized protein OS=Ficedula albicollis PE=4 SV=1
  349 : A6H560_PIG          0.42  0.65    2  192  276  466  191    0    0  466  A6H560     Mmp12 protein OS=Sus scrofa GN=MMP12 PE=2 SV=1
  350 : F1PFP6_CANFA        0.42  0.64    2  190  290  476  189    1    2  479  F1PFP6     Uncharacterized protein (Fragment) OS=Canis familiaris GN=MMP12 PE=4 SV=2
  351 : F1SV57_PIG          0.42  0.65    2  192  276  466  191    0    0  466  F1SV57     Uncharacterized protein OS=Sus scrofa GN=MMP12 PE=4 SV=2
  352 : G1KYQ0_ANOCA        0.42  0.66    2  192  281  469  191    1    2  470  G1KYQ0     Uncharacterized protein OS=Anolis carolinensis GN=LOC100552454 PE=4 SV=2
  353 : G1LUN4_AILME        0.42  0.65    2  192  281  471  191    0    0  471  G1LUN4     Uncharacterized protein OS=Ailuropoda melanoleuca GN=LOC100481430 PE=4 SV=1
  354 : G3Q9P8_GASAC        0.42  0.70    2  192  292  482  194    2    6  485  G3Q9P8     Uncharacterized protein (Fragment) OS=Gasterosteus aculeatus PE=4 SV=1
  355 : I3MBT4_SPETR        0.42  0.67    1  192  273  463  193    2    3  466  I3MBT4     Uncharacterized protein OS=Spermophilus tridecemlineatus GN=MMP8 PE=4 SV=1
  356 : L9KPS3_TUPCH        0.42  0.69    1  192  273  466  194    2    2  466  L9KPS3     Interstitial collagenase OS=Tupaia chinensis GN=TREES_T100006576 PE=4 SV=1
  357 : M3WEA4_FELCA        0.42  0.65    2  192  280  470  191    0    0  470  M3WEA4     Uncharacterized protein OS=Felis catus GN=MMP12 PE=4 SV=1
  358 : MMP12_HUMAN         0.42  0.66    2  192  279  470  192    1    1  470  P39900     Macrophage metalloelastase OS=Homo sapiens GN=MMP12 PE=1 SV=1
  359 : Q4AED4_ORYLA        0.42  0.73    1  192  276  467  192    0    0  470  Q4AED4     Collagenase OS=Oryzias latipes GN=coll PE=2 SV=1
  360 : Q99745_HUMAN        0.42  0.66    2  192   49  240  192    1    1  240  Q99745     Metalloelastase (Fragment) OS=Homo sapiens PE=4 SV=1
  361 : U6CUQ2_NEOVI        0.42  0.65    5  192  303  490  188    0    0  490  U6CUQ2     Macrophage metalloelastase OS=Neovison vison GN=MMP12 PE=2 SV=1
  362 : V9KV80_CALMI        0.42  0.71    1  192  297  487  194    4    5  488  V9KV80     Matrix metalloproteinase-18-like protein OS=Callorhynchus milii PE=2 SV=1
  363 : E9QPT8_MOUSE        0.41  0.67    1  192  271  463  194    3    3  463  E9QPT8     Interstitial collagenase A OS=Mus musculus GN=Mmp1a PE=4 SV=1
  364 : F6YVM2_MACMU        0.41  0.67    2  192  279  470  192    1    1  470  F6YVM2     Uncharacterized protein OS=Macaca mulatta GN=MMP12 PE=4 SV=1
  365 : F7DLE7_XENTR        0.41  0.66    1  192  271  462  192    0    0  462  F7DLE7     Uncharacterized protein OS=Xenopus tropicalis GN=LOC100489735 PE=4 SV=1
  366 : G1R6D8_NOMLE        0.41  0.66    2  192  279  470  192    1    1  470  G1R6D8     Uncharacterized protein OS=Nomascus leucogenys GN=MMP12 PE=4 SV=1
  367 : G3RHJ9_GORGO        0.41  0.66    2  192  279  470  192    1    1  470  G3RHJ9     Uncharacterized protein OS=Gorilla gorilla gorilla GN=101133109 PE=4 SV=1
  368 : G3RMX3_GORGO        0.41  0.66    2  192  280  471  192    1    1  471  G3RMX3     Uncharacterized protein OS=Gorilla gorilla gorilla GN=101133109 PE=4 SV=1
  369 : G3UQI2_MELGA        0.41  0.65    2  192  465  654  192    3    3  654  G3UQI2     Uncharacterized protein OS=Meleagris gallopavo GN=LOC100544485 PE=4 SV=1
  370 : G3UQN9_MELGA        0.41  0.65    2  192  439  628  192    3    3  628  G3UQN9     Uncharacterized protein OS=Meleagris gallopavo GN=LOC100544485 PE=4 SV=1
  371 : G3UTJ3_MELGA        0.41  0.65    2  186  403  586  186    3    3  586  G3UTJ3     Uncharacterized protein OS=Meleagris gallopavo GN=LOC100544485 PE=4 SV=1
  372 : G5BUC5_HETGA        0.41  0.69    1  192  281  471  192    1    1  471  G5BUC5     Stromelysin-1 OS=Heterocephalus glaber GN=GW7_15557 PE=4 SV=1
  373 : G5E8A9_MOUSE        0.41  0.69    3  192  273  463  192    3    3  463  G5E8A9     Interstitial collagenase B OS=Mus musculus GN=Mmp1b PE=4 SV=1
  374 : G7NBR2_MACMU        0.41  0.67    2  192  279  470  192    1    1  470  G7NBR2     Putative uncharacterized protein OS=Macaca mulatta GN=EGK_06828 PE=4 SV=1
  375 : G7PNK7_MACFA        0.41  0.67    2  192  279  470  192    1    1  470  G7PNK7     Putative uncharacterized protein OS=Macaca fascicularis GN=EGM_06165 PE=4 SV=1
  376 : G9KAW9_MUSPF        0.41  0.65    2  190  292  478  189    1    2  481  G9KAW9     Matrix metallopeptidase 12 (Fragment) OS=Mustela putorius furo PE=2 SV=1
  377 : H9YWJ6_MACMU        0.41  0.67    2  192  279  470  192    1    1  470  H9YWJ6     Macrophage metalloelastase preproprotein OS=Macaca mulatta GN=MMP12 PE=2 SV=1
  378 : K7GCP5_PELSI        0.41  0.66    1  192  304  494  193    3    3  494  K7GCP5     Uncharacterized protein OS=Pelodiscus sinensis PE=4 SV=1
  379 : M3Y643_MUSPF        0.41  0.64    2  192  303  493  191    0    0  493  M3Y643     Uncharacterized protein OS=Mustela putorius furo GN=Mmp12 PE=4 SV=1
  380 : M3ZBJ8_NOMLE        0.41  0.66    2  192  235  426  192    1    1  426  M3ZBJ8     Uncharacterized protein OS=Nomascus leucogenys GN=MMP12 PE=4 SV=1
  381 : MMP1A_MOUSE         0.41  0.67    1  192  272  464  194    3    3  464  Q9EPL5     Interstitial collagenase A OS=Mus musculus GN=Mmp1a PE=2 SV=1
  382 : MMP1B_MOUSE         0.41  0.69    3  192  273  463  192    3    3  463  Q9EPL6     Interstitial collagenase B OS=Mus musculus GN=Mmp1b PE=2 SV=1
  383 : R4GGH6_CHICK        0.41  0.66    2  192  290  479  192    3    3  479  R4GGH6     Uncharacterized protein (Fragment) OS=Gallus gallus GN=LOC428086 PE=4 SV=1
  384 : C0PU91_SALSA        0.40  0.64    5  183   60  241  182    2    3  252  C0PU91     72 kDa type IV collagenase (Fragment) OS=Salmo salar GN=MMP2 PE=2 SV=1
  385 : F6SUU6_MONDO        0.40  0.68    2  192  293  483  192    2    2  483  F6SUU6     Uncharacterized protein OS=Monodelphis domestica GN=MMP20 PE=4 SV=1
  386 : F7E2V0_HORSE        0.40  0.67    2  192  244  434  191    0    0  434  F7E2V0     Uncharacterized protein (Fragment) OS=Equus caballus GN=MMP12 PE=4 SV=1
  387 : G3WJ99_SARHA        0.40  0.67    2  192  296  486  192    2    2  486  G3WJ99     Uncharacterized protein OS=Sarcophilus harrisii GN=MMP20 PE=4 SV=1
  388 : H0ZR67_TAEGU        0.40  0.63    2  192  254  443  191    1    1  443  H0ZR67     Uncharacterized protein (Fragment) OS=Taeniopygia guttata GN=MMP12 PE=4 SV=1
  389 : H2SI69_TAKRU        0.40  0.64   11  192  289  471  186    4    7  472  H2SI69     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=LOC101068697 PE=4 SV=1
  390 : H3B3S8_LATCH        0.40  0.72    1  192  257  447  192    1    1  447  H3B3S8     Uncharacterized protein (Fragment) OS=Latimeria chalumnae PE=4 SV=1
  391 : I3MBX4_SPETR        0.40  0.64    2  192  289  479  191    0    0  479  I3MBX4     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  392 : L5KZS7_PTEAL        0.40  0.67    2  192  293  483  192    2    2  483  L5KZS7     Matrix metalloproteinase-20 OS=Pteropus alecto GN=PAL_GLEAN10013819 PE=4 SV=1
  393 : L8J133_9CETA        0.40  0.66    1  192  283  474  192    0    0  474  L8J133     Macrophage metalloelastase (Fragment) OS=Bos mutus GN=M91_17716 PE=4 SV=1
  394 : MMP20_PIG           0.40  0.68    2  192  293  483  192    2    2  483  P79287     Matrix metalloproteinase-20 OS=Sus scrofa GN=MMP20 PE=2 SV=1
  395 : Q6DCN8_XENLA        0.40  0.65    2  192  269  457  193    3    6  458  Q6DCN8     Mmp13-prov protein OS=Xenopus laevis GN=mmp3 PE=2 SV=1
  396 : Q90YB4_PAROL        0.40  0.61    3  192  465  658  196    5    8  658  Q90YB4     Gelatinase OS=Paralichthys olivaceus GN=MMP2 PE=2 SV=1
  397 : Q9W635_ONCMY        0.40  0.62    3  192  461  654  197    7   10  655  Q9W635     Matrix metalloproteinase-2 OS=Oncorhynchus mykiss PE=2 SV=1
  398 : V8NB18_OPHHA        0.40  0.63    2  178  225  414  190    2   13  414  V8NB18     Interstitial collagenase (Fragment) OS=Ophiophagus hannah GN=MMP1 PE=4 SV=1
  399 : W5P4C9_SHEEP        0.40  0.65    1  192  279  470  192    0    0  470  W5P4C9     Uncharacterized protein OS=Ovis aries GN=MMP12 PE=4 SV=1
  400 : A4UAU8_XENLA        0.39  0.68    1  192  288  478  192    1    1  478  A4UAU8     Matrix metalloproteinase 20 OS=Xenopus laevis GN=mmp20 PE=2 SV=1
  401 : B5X1J1_SALSA        0.39  0.62    3  192  465  658  197    7   10  659  B5X1J1     72 kDa type IV collagenase OS=Salmo salar GN=MMP2 PE=2 SV=1
  402 : D3ZXD9_RAT          0.39  0.67    2  192  292  482  192    2    2  482  D3ZXD9     Matrix metalloproteinase 20 (Enamelysin) (Predicted) OS=Rattus norvegicus GN=Mmp20 PE=4 SV=1
  403 : F6UAM2_XENTR        0.39  0.65    2  192  308  496  193    3    6  497  F6UAM2     Uncharacterized protein OS=Xenopus tropicalis GN=mmp3 PE=4 SV=1
  404 : F6UAN1_XENTR        0.39  0.65    2  192  454  645  196    5    9  646  F6UAN1     Uncharacterized protein OS=Xenopus tropicalis GN=mmp3 PE=4 SV=1
  405 : G1R6B1_NOMLE        0.39  0.67    1  192  292  483  193    2    2  483  G1R6B1     Uncharacterized protein OS=Nomascus leucogenys GN=MMP20 PE=4 SV=1
  406 : G1SIN0_RABIT        0.39  0.66    2  192  293  483  192    2    2  483  G1SIN0     Uncharacterized protein OS=Oryctolagus cuniculus GN=MMP20 PE=4 SV=1
  407 : H2NF32_PONAB        0.39  0.67    1  192  292  483  193    2    2  483  H2NF32     Uncharacterized protein OS=Pongo abelii GN=MMP20 PE=4 SV=1
  408 : H2SI64_TAKRU        0.39  0.62    2  192  279  472  197    5    9  472  H2SI64     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=LOC101068697 PE=4 SV=1
  409 : H2SI66_TAKRU        0.39  0.63    1  192  291  483  196    4    7  483  H2SI66     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=LOC101068697 PE=4 SV=1
  410 : H2SI67_TAKRU        0.39  0.63    2  192  278  469  195    4    7  469  H2SI67     Uncharacterized protein OS=Takifugu rubripes GN=LOC101068697 PE=4 SV=1
  411 : H2SI71_TAKRU        0.39  0.62    2  192  249  442  197    5    9  442  H2SI71     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=LOC101068697 PE=4 SV=1
  412 : H2SI72_TAKRU        0.39  0.63    1  192  246  438  196    4    7  438  H2SI72     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=LOC101068697 PE=4 SV=1
  413 : H2TLN5_TAKRU        0.39  0.59    3  192  463  656  197    7   10  656  H2TLN5     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=mmp-2 PE=4 SV=1
  414 : H2TLN6_TAKRU        0.39  0.59    3  192  472  665  197    7   10  665  H2TLN6     Uncharacterized protein OS=Takifugu rubripes GN=mmp-2 PE=4 SV=1
  415 : H2TLP1_TAKRU        0.39  0.59    3  192  484  677  197    7   10  677  H2TLP1     Uncharacterized protein OS=Takifugu rubripes GN=mmp-2 PE=4 SV=1
  416 : H2TLP2_TAKRU        0.39  0.59    5  192  228  419  193    5    6  419  H2TLP2     Uncharacterized protein OS=Takifugu rubripes GN=mmp-2 PE=4 SV=1
  417 : H3CCT4_TETNG        0.39  0.63    3  192  311  502  195    5    8  503  H3CCT4     Uncharacterized protein (Fragment) OS=Tetraodon nigroviridis PE=4 SV=1
  418 : I2ALK5_TAKRU        0.39  0.63    2  192  300  491  196    6    9  492  I2ALK5     Matrix metalloproteinase OS=Takifugu rubripes GN=MMPF3 PE=2 SV=1
  419 : MMP20_MOUSE         0.39  0.66    2  192  292  482  192    2    2  482  P57748     Matrix metalloproteinase-20 OS=Mus musculus GN=Mmp20 PE=2 SV=1
  420 : Q28J86_XENTR        0.39  0.65    2  192  308  496  193    3    6  497  Q28J86     Matrix metalloproteinase 3 (Stromelysin 1, progelatinase) OS=Xenopus tropicalis GN=mmp3 PE=2 SV=1
  421 : Q4JF84_TAKRU        0.39  0.59    3  192  465  658  197    7   10  658  Q4JF84     Matrix metalloproteinase-2 OS=Takifugu rubripes GN=fgMMP-2 PE=2 SV=1
  422 : Q4T8E3_TETNG        0.39  0.63    3  192  279  470  195    5    8  470  Q4T8E3     Chromosome undetermined SCAF7823, whole genome shotgun sequence. (Fragment) OS=Tetraodon nigroviridis GN=GSTENG00005277001 PE=4 SV=1
  423 : R9ZVV2_SALAL        0.39  0.62    3  192  465  658  197    7   10  659  R9ZVV2     Matrix metalloproteinase-2 OS=Salvelinus alpinus GN=mmp2 PE=2 SV=1
  424 : W5KG79_ASTMX        0.39  0.64    1  192  306  495  193    4    4  496  W5KG79     Uncharacterized protein OS=Astyanax mexicanus PE=4 SV=1
  425 : W5LZ00_LEPOC        0.39  0.65    2  192  307  496  191    1    1  496  W5LZ00     Uncharacterized protein OS=Lepisosteus oculatus GN=MMP20 PE=4 SV=1
  426 : W5LZ22_LEPOC        0.39  0.65    2  192  256  445  191    1    1  445  W5LZ22     Uncharacterized protein (Fragment) OS=Lepisosteus oculatus GN=MMP20 PE=4 SV=1
  427 : D2HIG8_AILME        0.38  0.67    1  192  292  483  193    2    2  483  D2HIG8     Uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=LOC100477655 PE=4 SV=1
  428 : E2RMU9_CANFA        0.38  0.67    2  192  293  483  192    2    2  483  E2RMU9     Uncharacterized protein OS=Canis familiaris GN=MMP20 PE=4 SV=1
  429 : E7F875_DANRE        0.38  0.65    1  192   41  226  193    2    8  226  E7F875     Uncharacterized protein OS=Danio rerio PE=4 SV=1
  430 : F1ML54_BOVIN        0.38  0.68    2  192  291  481  192    2    2  481  F1ML54     Matrix metalloproteinase-20 OS=Bos taurus GN=MMP20 PE=4 SV=1
  431 : F7BFH0_HORSE        0.38  0.68    2  192  293  483  192    2    2  483  F7BFH0     Uncharacterized protein OS=Equus caballus GN=MMP20 PE=4 SV=1
  432 : F7CXH1_CALJA        0.38  0.67    2  192  293  483  192    2    2  483  F7CXH1     Uncharacterized protein OS=Callithrix jacchus GN=MMP20 PE=4 SV=1
  433 : F7E8W8_XENTR        0.38  0.62    1  192  468  663  199    7   10  663  F7E8W8     Uncharacterized protein (Fragment) OS=Xenopus tropicalis GN=mmp2 PE=4 SV=1
  434 : F7GQW6_MACMU        0.38  0.67    1  192  292  483  193    2    2  483  F7GQW6     Uncharacterized protein OS=Macaca mulatta GN=MMP20 PE=4 SV=1
  435 : G1KUQ8_ANOCA        0.38  0.70    2  192  294  484  192    2    2  484  G1KUQ8     Uncharacterized protein (Fragment) OS=Anolis carolinensis GN=MMP20 PE=4 SV=1
  436 : G1PAV5_MYOLU        0.38  0.67    1  192  290  481  193    2    2  481  G1PAV5     Uncharacterized protein (Fragment) OS=Myotis lucifugus GN=MMP20 PE=4 SV=1
  437 : G3GUV3_CRIGR        0.38  0.63    1  192  272  462  192    1    1  464  G3GUV3     Macrophage metalloelastase OS=Cricetulus griseus GN=I79_001477 PE=4 SV=1
  438 : G3QLA8_GORGO        0.38  0.67    2  192  293  483  192    2    2  483  G3QLA8     Uncharacterized protein OS=Gorilla gorilla gorilla GN=101129612 PE=4 SV=1
  439 : G3T6M9_LOXAF        0.38  0.67    1  192  292  483  193    2    2  483  G3T6M9     Uncharacterized protein OS=Loxodonta africana GN=MMP20 PE=4 SV=1
  440 : G5BUC0_HETGA        0.38  0.66    2  192  293  483  192    2    2  483  G5BUC0     Matrix metalloproteinase-20 OS=Heterocephalus glaber GN=GW7_15552 PE=4 SV=1
  441 : G7PNK0_MACFA        0.38  0.67    1  192  292  483  193    2    2  483  G7PNK0     Putative uncharacterized protein OS=Macaca fascicularis GN=EGM_06158 PE=4 SV=1
  442 : H0XCV9_OTOGA        0.38  0.67    1  192  292  483  193    2    2  483  H0XCV9     Uncharacterized protein OS=Otolemur garnettii GN=MMP20 PE=4 SV=1
  443 : H2MF06_ORYLA        0.38  0.62    3  192  468  661  197    7   10  661  H2MF06     Uncharacterized protein OS=Oryzias latipes GN=gel-a PE=4 SV=1
  444 : H2Q4M8_PANTR        0.38  0.66    2  192  293  483  192    2    2  483  H2Q4M8     Uncharacterized protein OS=Pan troglodytes GN=MMP20 PE=4 SV=1
  445 : H2SI65_TAKRU        0.38  0.62    2  192  288  481  198    7   11  481  H2SI65     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=LOC101068697 PE=4 SV=1
  446 : H2SI68_TAKRU        0.38  0.62    2  192  287  480  198    7   11  481  H2SI68     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=LOC101068697 PE=4 SV=1
  447 : H2SI73_TAKRU        0.38  0.62    2  192  301  494  198    7   11  495  H2SI73     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=LOC101068697 PE=4 SV=1
  448 : H2TLN4_TAKRU        0.38  0.60    5  192  278  469  194    6    8  469  H2TLN4     Uncharacterized protein (Fragment) OS=Takifugu rubripes GN=mmp-2 PE=4 SV=1
  449 : H2TLP0_TAKRU        0.38  0.58    3  192  483  679  200    8   13  679  H2TLP0     Uncharacterized protein OS=Takifugu rubripes GN=mmp-2 PE=4 SV=1
  450 : H3C4X0_TETNG        0.38  0.60    3  192  464  657  197    7   10  657  H3C4X0     Uncharacterized protein (Fragment) OS=Tetraodon nigroviridis PE=4 SV=1
  451 : H3CCT5_TETNG        0.38  0.62    3  164  113  271  164    5    7  333  H3CCT5     Uncharacterized protein (Fragment) OS=Tetraodon nigroviridis PE=4 SV=1
  452 : H3CM99_TETNG        0.38  0.60    3  192  463  656  197    7   10  656  H3CM99     Uncharacterized protein OS=Tetraodon nigroviridis PE=4 SV=1
  453 : I3J3R2_ORENI        0.38  0.62    3  192  464  656  197    8   11  656  I3J3R2     Uncharacterized protein OS=Oreochromis niloticus GN=mmp2 PE=4 SV=1
  454 : L5KZT0_PTEAL        0.38  0.65    2  192  270  460  191    0    0  460  L5KZT0     Macrophage metalloelastase OS=Pteropus alecto GN=PAL_GLEAN10013824 PE=4 SV=1
  455 : L8IB25_9CETA        0.38  0.68    2  192  293  483  192    2    2  483  L8IB25     Matrix metalloproteinase-20 OS=Bos mutus GN=M91_02022 PE=4 SV=1
  456 : L9KQE4_TUPCH        0.38  0.57    1  171  273  417  182    7   48  433  L9KQE4     Interstitial collagenase OS=Tupaia chinensis GN=TREES_T100006574 PE=4 SV=1
  457 : M3WN98_FELCA        0.38  0.66    1  192  292  483  193    2    2  483  M3WN98     Uncharacterized protein OS=Felis catus GN=MMP20 PE=4 SV=1
  458 : M4A040_XIPMA        0.38  0.62    5  192  466  657  195    7   10  657  M4A040     Uncharacterized protein OS=Xiphophorus maculatus PE=4 SV=1
  459 : MMP20_HUMAN         0.38  0.67    2  192  293  483  192    2    2  483  O60882     Matrix metalloproteinase-20 OS=Homo sapiens GN=MMP20 PE=1 SV=3
  460 : Q4SU81_TETNG        0.38  0.60    3  192  436  629  197    7   10  629  Q4SU81     Chromosome 5 SCAF13976, whole genome shotgun sequence. (Fragment) OS=Tetraodon nigroviridis GN=GSTENG00012583001 PE=4 SV=1
  461 : Q5FVW8_XENTR        0.38  0.62    1  192  460  655  199    7   10  655  Q5FVW8     Matrix metallopeptidase 2 (Gelatinase A, 72kDa gelatinase, 72kDa type 4 collagenase) OS=Xenopus tropicalis GN=mmp2 PE=2 SV=1
  462 : Q9PTU7_ORYLA        0.38  0.62    3  192  464  657  197    7   10  657  Q9PTU7     Gelatinase A OS=Oryzias latipes GN=gel-a PE=2 SV=1
  463 : S7PKS4_MYOBR        0.38  0.67    1  192  313  504  193    2    2  504  S7PKS4     Matrix metalloproteinase-20 OS=Myotis brandtii GN=D623_10023419 PE=4 SV=1
  464 : W5LZ41_LEPOC        0.38  0.63    3  192  227  415  190    1    1  415  W5LZ41     Uncharacterized protein OS=Lepisosteus oculatus PE=4 SV=1
  465 : W5P7K9_SHEEP        0.38  0.68    2  192  293  483  192    2    2  483  W5P7K9     Uncharacterized protein OS=Ovis aries GN=MMP20 PE=4 SV=1
  466 : A4UAU7_CAICA        0.37  0.66    1  192  246  437  193    2    2  437  A4UAU7     Matrix metalloproteinase 20 (Fragment) OS=Caiman crocodilus apaporiensis GN=MMP20 PE=2 SV=1
  467 : F6RF54_XENTR        0.37  0.67    2  192  246  439  195    3    5  439  F6RF54     Uncharacterized protein (Fragment) OS=Xenopus tropicalis GN=mmp20 PE=4 SV=1
  468 : G1NUK1_MYOLU        0.37  0.61    2  192  277  467  191    0    0  467  G1NUK1     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
  469 : G3PWM8_GASAC        0.37  0.61    3  192  463  656  197    7   10  656  G3PWM8     Uncharacterized protein OS=Gasterosteus aculeatus PE=4 SV=1
  470 : G3PWN0_GASAC        0.37  0.61    3  192  445  638  197    7   10  638  G3PWN0     Uncharacterized protein (Fragment) OS=Gasterosteus aculeatus PE=4 SV=1
  471 : G5BUC6_HETGA        0.37  0.64    1  192  212  403  192    0    0  403  G5BUC6     Macrophage metalloelastase OS=Heterocephalus glaber GN=GW7_15558 PE=4 SV=1
  472 : H0V812_CAVPO        0.37  0.64    1  192  277  469  195    4    5  469  H0V812     Uncharacterized protein (Fragment) OS=Cavia porcellus GN=MMP1 PE=4 SV=1
  473 : H2TLN9_TAKRU        0.37  0.59    3  192  488  684  199    7   11  684  H2TLN9     Uncharacterized protein OS=Takifugu rubripes GN=mmp-2 PE=4 SV=1
  474 : H3B4I7_LATCH        0.37  0.65    3  192  259  448  191    2    2  448  H3B4I7     Uncharacterized protein (Fragment) OS=Latimeria chalumnae PE=4 SV=1
  475 : H9F954_MACMU        0.37  0.64    1  168  139  309  171    2    3  334  H9F954     72 kDa type IV collagenase isoform a preproprotein (Fragment) OS=Macaca mulatta GN=MMP2 PE=2 SV=1
  476 : MMP12_MOUSE         0.37  0.62    5  192  286  473  188    0    0  473  P34960     Macrophage metalloelastase OS=Mus musculus GN=Mmp12 PE=1 SV=3
  477 : MMP12_RAT           0.37  0.62    1  192  274  465  192    0    0  465  Q63341     Macrophage metalloelastase OS=Rattus norvegicus GN=Mmp12 PE=2 SV=1
  478 : MMP20_BOVIN         0.37  0.67    2  192  291  481  192    2    2  481  O18767     Matrix metalloproteinase-20 OS=Bos taurus GN=MMP20 PE=1 SV=1
  479 : Q3TCW6_MOUSE        0.37  0.62    5  192  216  403  188    0    0  403  Q3TCW6     Macrophage metalloelastase OS=Mus musculus GN=Mmp12 PE=2 SV=1
  480 : Q8UUZ3_XENLA        0.37  0.62    1  192  461  656  199    7   10  656  Q8UUZ3     Matrix metalloproteinase OS=Xenopus laevis GN=mmp2 PE=2 SV=1
  481 : R9PXT7_RAT          0.37  0.62    1  192  286  477  192    0    0  477  R9PXT7     Macrophage metalloelastase OS=Rattus norvegicus GN=Mmp12 PE=4 SV=1
  482 : V8N990_OPHHA        0.37  0.67    1  192  260  451  193    2    2  451  V8N990     Matrix metalloproteinase-20 (Fragment) OS=Ophiophagus hannah GN=MMP20 PE=4 SV=1
  483 : W5KME3_ASTMX        0.37  0.64    3  192  304  492  191    3    3  492  W5KME3     Uncharacterized protein OS=Astyanax mexicanus GN=MMP20 PE=4 SV=1
  484 : F7FCH2_ORNAN        0.36  0.59    1  192  461  656  199    7   10  656  F7FCH2     Uncharacterized protein OS=Ornithorhynchus anatinus GN=MMP2 PE=4 SV=2
  485 : G1P1F6_MYOLU        0.36  0.58    1  192  466  661  199    7   10  661  G1P1F6     Uncharacterized protein OS=Myotis lucifugus GN=MMP2 PE=4 SV=1
  486 : G3WFR8_SARHA        0.36  0.59    1  192  468  665  201    8   12  665  G3WFR8     Uncharacterized protein (Fragment) OS=Sarcophilus harrisii GN=MMP2 PE=4 SV=1
  487 : G3WFR9_SARHA        0.36  0.59    1  192  467  664  201    8   12  664  G3WFR9     Uncharacterized protein OS=Sarcophilus harrisii GN=MMP2 PE=4 SV=1
  488 : H3BS34_HUMAN        0.36  0.62    1  167   90  251  168    2    7  252  H3BS34     PEX (Fragment) OS=Homo sapiens GN=MMP2 PE=2 SV=2
  489 : M7C9G5_CHEMY        0.36  0.61    1  192  463  658  199    7   10  658  M7C9G5     72 kDa type IV collagenase OS=Chelonia mydas GN=UY3_01508 PE=4 SV=1
  490 : S7MUQ9_MYOBR        0.36  0.58    1  192  444  639  199    7   10  639  S7MUQ9     72 kDa type IV collagenase OS=Myotis brandtii GN=D623_10004754 PE=4 SV=1
  491 : W5LZ57_LEPOC        0.36  0.63    1  192  279  472  195    3    4  472  W5LZ57     Uncharacterized protein OS=Lepisosteus oculatus PE=4 SV=1
  492 : W5ULL1_ICTPU        0.36  0.58    3  192  465  657  195    5    7  657  W5ULL1     72 kDa type IV collagenase OS=Ictalurus punctatus GN=MMP2 PE=2 SV=1
  493 : A6QPN5_BOVIN        0.35  0.60    1  192  466  661  199    7   10  661  A6QPN5     Matrix metallopeptidase 2 (Gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) OS=Bos taurus GN=MMP2 PE=2 SV=1
  494 : C8BKE4_SHEEP        0.35  0.60    1  192  466  661  199    7   10  661  C8BKE4     Matrix metallopeptidase 2 OS=Ovis aries GN=MMP2 PE=2 SV=1
  495 : E7F3C3_DANRE        0.35  0.59    3  192  302  490  191    3    3  490  E7F3C3     Uncharacterized protein OS=Danio rerio GN=CR848664.1 PE=4 SV=1
  496 : F1MKH8_BOVIN        0.35  0.60    1  192  466  661  199    7   10  661  F1MKH8     72 kDa type IV collagenase OS=Bos taurus GN=MMP2 PE=4 SV=1
  497 : F1RF11_PIG          0.35  0.60    1  192  465  660  199    7   10  660  F1RF11     Uncharacterized protein OS=Sus scrofa GN=MMP2 PE=4 SV=2
  498 : F7EVX9_MONDO        0.35  0.60    1  192  467  662  199    7   10  662  F7EVX9     Uncharacterized protein OS=Monodelphis domestica GN=MMP2 PE=4 SV=1
  499 : G1SRJ7_RABIT        0.35  0.59    1  192  467  662  199    7   10  662  G1SRJ7     72 kDa type IV collagenase OS=Oryctolagus cuniculus GN=MMP2 PE=4 SV=2
  500 : G3H0R8_CRIGR        0.35  0.59    1  192  467  662  199    7   10  662  G3H0R8     72 kDa type IV collagenase OS=Cricetulus griseus GN=I79_003736 PE=4 SV=1
  501 : G3NT76_GASAC        0.35  0.62    3  192  288  476  191    3    3  476  G3NT76     Uncharacterized protein (Fragment) OS=Gasterosteus aculeatus GN=MMP20 PE=4 SV=1
  502 : G5BSD7_HETGA        0.35  0.60    1  192  467  662  199    7   10  662  G5BSD7     72 kDa type IV collagenase OS=Heterocephalus glaber GN=GW7_06029 PE=4 SV=1
  503 : H3AZ36_LATCH        0.35  0.61    5  192  462  653  195    7   10  653  H3AZ36     Uncharacterized protein OS=Latimeria chalumnae PE=4 SV=1
  504 : H3B561_LATCH        0.35  0.62    2  192  245  434  191    1    1  434  H3B561     Uncharacterized protein (Fragment) OS=Latimeria chalumnae PE=4 SV=1
  505 : I3MWU8_SPETR        0.35  0.61    1  192  467  662  199    7   10  662  I3MWU8     Uncharacterized protein OS=Spermophilus tridecemlineatus GN=MMP2 PE=4 SV=1
  506 : K7GIX4_PELSI        0.35  0.61    1  192  387  582  199    7   10  582  K7GIX4     Uncharacterized protein OS=Pelodiscus sinensis GN=MMP2 PE=4 SV=1
  507 : K9J3G9_DESRO        0.35  0.59    1  192  466  661  199    7   10  661  K9J3G9     Putative 72 kDa type iv collagenase (Fragment) OS=Desmodus rotundus PE=2 SV=1
  508 : L8IXH8_9CETA        0.35  0.60    1  192  466  661  199    7   10  661  L8IXH8     72 kDa type IV collagenase OS=Bos mutus GN=M91_16267 PE=4 SV=1
  509 : M3XWA7_MUSPF        0.35  0.60    1  192  466  661  199    7   10  661  M3XWA7     Uncharacterized protein OS=Mustela putorius furo GN=MMP2 PE=4 SV=1
  510 : MMP2_BOVIN          0.35  0.60    1  192  466  661  199    7   10  661  Q9GLE5     72 kDa type IV collagenase OS=Bos taurus GN=MMP2 PE=2 SV=1
  511 : MMP2_RABIT          0.35  0.59    1  192  467  662  199    7   10  662  P50757     72 kDa type IV collagenase OS=Oryctolagus cuniculus GN=MMP2 PE=2 SV=1
  512 : MMP2_RAT            0.35  0.60    1  192  467  662  199    7   10  662  P33436     72 kDa type IV collagenase OS=Rattus norvegicus GN=Mmp2 PE=2 SV=2
  513 : Q5IY21_TUPBE        0.35  0.60    1  192  465  660  199    7   10  660  Q5IY21     Matrix metalloproteinase 2 OS=Tupaia belangeri PE=2 SV=1
  514 : S9XYF7_9CETA        0.35  0.60    1  192  428  623  199    7   10  623  S9XYF7     Type IV collagenase isoform a preproprotein OS=Camelus ferus GN=CB1_000856001 PE=4 SV=1
  515 : W5KMF4_ASTMX        0.35  0.60    2  192   43  235  196    3    8  235  W5KMF4     Uncharacterized protein OS=Astyanax mexicanus GN=MMP26 PE=4 SV=1
  516 : W5LZ75_LEPOC        0.35  0.56    5  192  292  476  191    6    9  476  W5LZ75     Uncharacterized protein OS=Lepisosteus oculatus PE=4 SV=1
  517 : W5MJL2_LEPOC        0.35  0.62    5  192  467  658  195    7   10  658  W5MJL2     Uncharacterized protein OS=Lepisosteus oculatus PE=4 SV=1
  518 : W5Q9H0_SHEEP        0.35  0.60    1  192  426  621  199    7   10  621  W5Q9H0     Uncharacterized protein (Fragment) OS=Ovis aries GN=MMP2 PE=4 SV=1
  519 : B7QD68_IXOSC        0.34  0.61    1  180   73  256  185    4    6  282  B7QD68     Matrix metalloproteinase, putative (Fragment) OS=Ixodes scapularis GN=IscW_ISCW022900 PE=4 SV=1
  520 : D2GTV0_AILME        0.34  0.60    1  192  403  598  199    7   10  598  D2GTV0     Putative uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=PANDA_000009 PE=4 SV=1
  521 : E7D7N7_CTEID        0.34  0.61    3  192  464  657  197    7   10  657  E7D7N7     Matrix metalloproteinase 2 OS=Ctenopharyngodon idella GN=mmp2 PE=2 SV=1
  522 : F1PMK7_CANFA        0.34  0.60    1  192  458  653  199    7   10  653  F1PMK7     Uncharacterized protein (Fragment) OS=Canis familiaris GN=MMP2 PE=4 SV=2
  523 : F7AYK2_HORSE        0.34  0.60    1  192  418  613  199    7   10  613  F7AYK2     Uncharacterized protein (Fragment) OS=Equus caballus GN=MMP2 PE=4 SV=1
  524 : F7FMH3_CALJA        0.34  0.60    1  192  465  660  199    7   10  660  F7FMH3     72 kDa type IV collagenase isoform a preproprotein OS=Callithrix jacchus GN=MMP2 PE=2 SV=1
  525 : F7FZT7_CALJA        0.34  0.60    1  192  389  584  199    7   10  584  F7FZT7     Uncharacterized protein OS=Callithrix jacchus GN=MMP2 PE=4 SV=1
  526 : F7G084_CALJA        0.34  0.60    1  192  415  610  199    7   10  610  F7G084     Uncharacterized protein OS=Callithrix jacchus GN=MMP2 PE=4 SV=1
  527 : F7GIP9_MACMU        0.34  0.60    1  192  465  660  199    7   10  660  F7GIP9     Uncharacterized protein OS=Macaca mulatta GN=MMP2 PE=4 SV=1
  528 : G1MDC1_AILME        0.34  0.60    1  192  456  651  199    7   10  651  G1MDC1     Uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=MMP2 PE=4 SV=1
  529 : G1MDD8_AILME        0.34  0.60    1  192  294  489  199    7   10  489  G1MDD8     Uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=MMP2 PE=4 SV=1
  530 : G1QKN0_NOMLE        0.34  0.59    1  192  464  659  199    7   10  659  G1QKN0     Uncharacterized protein OS=Nomascus leucogenys GN=MMP2 PE=4 SV=1
  531 : G3RRS9_GORGO        0.34  0.60    1  192  466  661  199    7   10  661  G3RRS9     Uncharacterized protein (Fragment) OS=Gorilla gorilla gorilla GN=101147102 PE=4 SV=1
  532 : G7NPB5_MACMU        0.34  0.60    1  192  434  629  199    7   10  629  G7NPB5     72 kDa type IV collagenase OS=Macaca mulatta GN=EGK_12787 PE=4 SV=1
  533 : G7Q151_MACFA        0.34  0.60    1  192  447  642  199    7   10  642  G7Q151     72 kDa type IV collagenase OS=Macaca fascicularis GN=EGM_11742 PE=4 SV=1
  534 : H0WBS8_CAVPO        0.34  0.60    1  192  468  663  199    7   10  663  H0WBS8     Uncharacterized protein (Fragment) OS=Cavia porcellus GN=MMP2 PE=4 SV=1
  535 : H0XZ33_OTOGA        0.34  0.60    1  192  469  664  199    7   10  664  H0XZ33     Uncharacterized protein OS=Otolemur garnettii GN=MMP2 PE=4 SV=1
  536 : H2NQX4_PONAB        0.34  0.60    1  192  364  559  199    7   10  559  H2NQX4     Uncharacterized protein OS=Pongo abelii GN=MMP2 PE=4 SV=1
  537 : H2QB41_PANTR        0.34  0.60    1  192  410  605  199    7   10  605  H2QB41     Uncharacterized protein OS=Pan troglodytes GN=MMP2 PE=4 SV=1
  538 : H9GNC8_ANOCA        0.34  0.62    1  192  480  675  199    7   10  675  H9GNC8     Uncharacterized protein OS=Anolis carolinensis GN=MMP2 PE=4 SV=2
  539 : H9KSW0_APIME        0.34  0.59    2  182   23  203  185    6    8  260  H9KSW0     Uncharacterized protein OS=Apis mellifera GN=LOC412446 PE=4 SV=1
  540 : H9Z1R6_MACMU        0.34  0.60    1  192  465  660  199    7   10  660  H9Z1R6     72 kDa type IV collagenase isoform a preproprotein OS=Macaca mulatta GN=MMP2 PE=2 SV=1
  541 : I3KM92_ORENI        0.34  0.57    1  192  271  463  197    5    9  463  I3KM92     Uncharacterized protein OS=Oreochromis niloticus PE=4 SV=1
  542 : I7GJY7_MACFA        0.34  0.60    1  192  386  581  199    7   10  581  I7GJY7     Macaca fascicularis brain cDNA clone: QorA-10188, similar to human matrix metalloproteinase 2 (gelatinase A, 72kDagelatinase, 72kDa type IV collagenase) (MMP2), mRNA, RefSeq: NM_004530.1 OS=Macaca fascicularis PE=2 SV=1
  543 : J3S937_CROAD        0.34  0.61    1  192  477  672  199    7   10  672  J3S937     Matrix metallopeptidase 2 OS=Crotalus adamanteus PE=2 SV=1
  544 : J9P206_CANFA        0.34  0.60    1  192  389  584  199    7   10  584  J9P206     Uncharacterized protein OS=Canis familiaris GN=MMP2 PE=4 SV=1
  545 : M3W4Z9_FELCA        0.34  0.60    1  192  423  618  199    7   10  618  M3W4Z9     Uncharacterized protein (Fragment) OS=Felis catus GN=MMP2 PE=4 SV=1
  546 : M4VLM9_CYPCA        0.34  0.61    3  192  464  657  197    7   10  657  M4VLM9     Matrix metalloproteinase 2 OS=Cyprinus carpio PE=2 SV=1
  547 : MMP2_HUMAN          0.34  0.60    1  192  465  660  199    7   10  660  P08253     72 kDa type IV collagenase OS=Homo sapiens GN=MMP2 PE=1 SV=2
  548 : MMP2_MOUSE          0.34  0.60    1  192  467  662  199    7   10  662  P33434     72 kDa type IV collagenase OS=Mus musculus GN=Mmp2 PE=2 SV=1
  549 : Q3UG07_MOUSE        0.34  0.60    1  192  467  662  199    7   10  662  Q3UG07     Matrix metallopeptidase 2 OS=Mus musculus GN=Mmp2 PE=2 SV=1
  550 : Q6DG10_DANRE        0.34  0.60    3  192  464  657  197    7   10  657  Q6DG10     Matrix metalloproteinase 2 OS=Danio rerio GN=mmp2 PE=2 SV=1
  551 : Q7SZM5_DANRE        0.34  0.60    3  192  464  657  197    7   10  657  Q7SZM5     Matrix metalloproteinase 2 OS=Danio rerio GN=mmp2 PE=2 SV=1
  552 : Q95JA4_PIG          0.34  0.60    1  192  466  661  198    6    8  661  Q95JA4     Gelatinase A OS=Sus scrofa GN=MMP-2 PE=2 SV=1
  553 : Q9N1P6_CANFA        0.34  0.60    1  192  437  632  199    7   10  632  Q9N1P6     Matrix metalloproteinase-2 (Fragment) OS=Canis familiaris GN=MMP-2 PE=2 SV=1
  554 : R0L6B1_ANAPL        0.34  0.61    1  188  135  325  191    2    3  330  R0L6B1     72 kDa type IV collagenase (Fragment) OS=Anas platyrhynchos GN=Anapl_06517 PE=4 SV=1
  555 : T1E649_CROHD        0.34  0.61    1  192  477  672  199    7   10  672  T1E649     72 kDa type IV collagenase-like protein OS=Crotalus horridus PE=2 SV=1
  556 : U3I7R0_ANAPL        0.34  0.60    1  192  177  372  196    3    4  372  U3I7R0     Uncharacterized protein OS=Anas platyrhynchos PE=4 SV=1
  557 : U3I7R5_ANAPL        0.34  0.61    1  188   97  287  191    2    3  292  U3I7R5     Uncharacterized protein (Fragment) OS=Anas platyrhynchos PE=4 SV=1
  558 : V9LBJ7_CALMI        0.34  0.55   18  174   31  188  159    3    3  271  V9LBJ7     Matrix metalloproteinase-24 (Fragment) OS=Callorhynchus milii PE=2 SV=1
  559 : E7FC41_DANRE        0.33  0.57    2  192  279  470  194    4    5  473  E7FC41     Uncharacterized protein OS=Danio rerio GN=LOC100329766 PE=4 SV=1
  560 : F6XJP4_XENTR        0.33  0.55    3  192  461  648  194    8   10  651  F6XJP4     Uncharacterized protein (Fragment) OS=Xenopus tropicalis PE=4 SV=1
  561 : G3STE1_LOXAF        0.33  0.60    1  192  470  665  199    7   10  665  G3STE1     Uncharacterized protein OS=Loxodonta africana GN=MMP2 PE=4 SV=1
  562 : H0ZAJ9_TAEGU        0.33  0.61    1  192  466  661  198    5    8  661  H0ZAJ9     Uncharacterized protein OS=Taeniopygia guttata GN=MMP2 PE=4 SV=1
  563 : I2ALK4_TAKRU        0.33  0.62    2  192  283  467  191    3    6  467  I2ALK4     Matrix metalloproteinase OS=Takifugu rubripes GN=MMPF20L PE=2 SV=1
  564 : M7BJ95_CHEMY        0.33  0.53    1  192  495  684  196    8   10  687  M7BJ95     Matrix metalloproteinase-9 OS=Chelonia mydas GN=UY3_14616 PE=4 SV=1
  565 : MMP2_CHICK          0.33  0.60    1  192  468  663  198    5    8  663  Q90611     72 kDa type IV collagenase OS=Gallus gallus GN=MMP2 PE=1 SV=1
  566 : Q6U7G9_MELGA        0.33  0.59    1  185  467  654  189    3    5  654  Q6U7G9     Gelatinase A OS=Meleagris gallopavo PE=2 SV=1
  567 : S4RJC9_PETMA        0.33  0.55    1  192  192  382  193    2    3  384  S4RJC9     Uncharacterized protein (Fragment) OS=Petromyzon marinus PE=4 SV=1
  568 : S4RQ22_PETMA        0.33  0.57    2  174  106  277  175    4    5  375  S4RQ22     Uncharacterized protein (Fragment) OS=Petromyzon marinus GN=MMP14 (2 of 2) PE=4 SV=1
  569 : U3JZN6_FICAL        0.33  0.61    1  192  466  661  198    5    8  661  U3JZN6     Uncharacterized protein OS=Ficedula albicollis GN=MMP2 PE=4 SV=1
  570 : V5HR34_IXORI        0.33  0.63   22  180    1  162  164    5    7  170  V5HR34     Putative matrix metalloproteinase 2 (Fragment) OS=Ixodes ricinus PE=2 SV=1
  571 : A1ILK1_XENLA        0.32  0.56    3  192  492  679  194    8   10  683  A1ILK1     Matrix metalloproteinase-9TH OS=Xenopus laevis GN=MMP-9TH PE=2 SV=1
  572 : A2VCV4_XENLA        0.32  0.56    3  192  483  670  194    8   10  674  A2VCV4     Mmp-9th protein OS=Xenopus laevis GN=mmp-9th PE=2 SV=1
  573 : C3XSA5_BRAFL        0.32  0.59    2  192  306  494  198    9   16  494  C3XSA5     Putative uncharacterized protein (Fragment) OS=Branchiostoma floridae GN=BRAFLDRAFT_266228 PE=4 SV=1
  574 : C3YHA8_BRAFL        0.32  0.55    1  187  326  515  195    9   13  524  C3YHA8     Putative uncharacterized protein OS=Branchiostoma floridae GN=BRAFLDRAFT_125272 PE=4 SV=1
  575 : E5SDM2_TRISP        0.32  0.55    2  192  235  430  199    7   11  482  E5SDM2     Matrix metallo protein ase-17 OS=Trichinella spiralis GN=Tsp_01835 PE=4 SV=1
  576 : E9GW38_DAPPU        0.32  0.53    2  192  384  579  201   10   15  637  E9GW38     Putative uncharacterized protein OS=Daphnia pulex GN=DAPPUDRAFT_226103 PE=4 SV=1
  577 : F1N1F5_BOVIN        0.32  0.52    2  192  335  529  199    8   12  582  F1N1F5     Uncharacterized protein (Fragment) OS=Bos taurus GN=MMP25 PE=4 SV=2
  578 : G1MZ17_MELGA        0.32  0.60    1  192  471  666  198    5    8  666  G1MZ17     Uncharacterized protein (Fragment) OS=Meleagris gallopavo GN=MMP2 PE=4 SV=1
  579 : G1NVF0_MYOLU        0.32  0.51    2  192  321  515  199    8   12  574  G1NVF0     Uncharacterized protein (Fragment) OS=Myotis lucifugus GN=MMP25 PE=4 SV=1
  580 : G3WYP0_SARHA        0.32  0.53    2  192  315  510  199    7   11  562  G3WYP0     Uncharacterized protein OS=Sarcophilus harrisii GN=MMP25 PE=4 SV=1
  581 : G9FZ64_CALMI        0.32  0.60    1  192  467  662  198    5    8  662  G9FZ64     Matrix metallopeptidase 2 OS=Callorhynchus milii GN=Mmp2 PE=4 SV=1
  582 : H2MHS1_ORYLA        0.32  0.62    1  192  294  490  200    6   11  490  H2MHS1     Uncharacterized protein (Fragment) OS=Oryzias latipes GN=LOC101156910 PE=4 SV=1
  583 : I3JCN5_ORENI        0.32  0.63    1  192  278  473  197    4    6  473  I3JCN5     Uncharacterized protein OS=Oreochromis niloticus GN=MMP20 PE=4 SV=1
  584 : I3NC30_SPETR        0.32  0.51    2  192  317  511  199    8   12  564  I3NC30     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus GN=MMP25 PE=4 SV=1
  585 : L7MFG9_9ACAR        0.32  0.57    2  192  399  591  198    9   12  633  L7MFG9     Putative matrix (Fragment) OS=Rhipicephalus pulchellus PE=2 SV=1
  586 : L9KR42_TUPCH        0.32  0.56    1  192  204  384  195    6   17  384  L9KR42     Stromelysin-1 OS=Tupaia chinensis GN=TREES_T100006575 PE=4 SV=1
  587 : M3ZHB2_XIPMA        0.32  0.63    2  192  219  411  194    3    4  411  M3ZHB2     Uncharacterized protein (Fragment) OS=Xiphophorus maculatus GN=MMP20 PE=4 SV=1
  588 : M3ZJX1_XIPMA        0.32  0.58    1  167    3  170  173    6   11  187  M3ZJX1     Uncharacterized protein (Fragment) OS=Xiphophorus maculatus PE=4 SV=1
  589 : M5FK30_BOVIN        0.32  0.52    2  192  427  621  199    8   12  674  M5FK30     Matrix metalloproteinase 25 preproprotein-like OS=Bos taurus GN=MMP25 PE=4 SV=1
  590 : Q9PVM5_ORYLA        0.32  0.51    1  192  494  683  196    8   10  690  Q9PVM5     Gelatinase B OS=Oryzias latipes GN=gel-b PE=2 SV=1
  591 : R7TM96_CAPTE        0.32  0.53    1  180  272  456  187    5    9  518  R7TM96     Uncharacterized protein OS=Capitella teleta GN=CAPTEDRAFT_164703 PE=4 SV=1
  592 : T1J720_STRMM        0.32  0.57    2  192  355  550  200    9   13  592  T1J720     Uncharacterized protein OS=Strigamia maritima PE=4 SV=1
  593 : V9IH00_APICE        0.32  0.59   14  182   33  203  175    6   10  260  V9IH00     Matrix metalloproteinase-17 OS=Apis cerana GN=ACCB08564 PE=2 SV=1
  594 : V9KEA5_CALMI        0.32  0.59    1  192  462  657  198    5    8  657  V9KEA5     Matrix metallopeptidase 2 OS=Callorhynchus milii PE=2 SV=1
  595 : W5JL10_ANODA        0.32  0.49    2  192  258  454  199    5   10  455  W5JL10     Matrix metalloproteinase OS=Anopheles darlingi GN=AND_003176 PE=4 SV=1
  596 : A4UTM2_ICTPU        0.31  0.54    1  192  495  683  195    7    9  686  A4UTM2     Matrix metalloproteinase-9 OS=Ictalurus punctatus PE=4 SV=1
  597 : A5HC60_RABIT        0.31  0.56    2  168   74  241  172    4    9  257  A5HC60     Membrane-type 4 matrix metalloproteinase (Fragment) OS=Oryctolagus cuniculus PE=2 SV=1
  598 : E2BGX7_HARSA        0.31  0.58   17  182   31  198  172    6   10  254  E2BGX7     Matrix metalloproteinase-17 OS=Harpegnathos saltator GN=EAI_14905 PE=4 SV=1
  599 : F4WEP7_ACREC        0.31  0.59   17  182   33  200  172    6   10  263  F4WEP7     Matrix metalloproteinase-17 OS=Acromyrmex echinatior GN=G5I_04054 PE=4 SV=1
  600 : F6ZUV1_HORSE        0.31  0.52    2  192  285  481  201    9   14  535  F6ZUV1     Uncharacterized protein (Fragment) OS=Equus caballus GN=MMP25 PE=4 SV=1
  601 : G1REM2_NOMLE        0.31  0.51    2  192  314  508  199    8   12  562  G1REM2     Uncharacterized protein (Fragment) OS=Nomascus leucogenys GN=MMP25 PE=4 SV=1
  602 : G3X1Q0_SARHA        0.31  0.53    2  192  276  468  196    6    8  544  G3X1Q0     Uncharacterized protein OS=Sarcophilus harrisii GN=MMP24 PE=4 SV=1
  603 : G5B1I9_HETGA        0.31  0.50    2  192  333  527  199    8   12  581  G5B1I9     Matrix metalloproteinase-25 OS=Heterocephalus glaber GN=GW7_03650 PE=4 SV=1
  604 : G9KAX7_MUSPF        0.31  0.50    2  192  246  440  199    7   12  445  G9KAX7     Matrix metallopeptidase 25 (Fragment) OS=Mustela putorius furo PE=2 SV=1
  605 : H0WC28_CAVPO        0.31  0.50    2  192  362  556  200   10   14  610  H0WC28     Uncharacterized protein (Fragment) OS=Cavia porcellus GN=MMP25 PE=4 SV=1
  606 : H0XKJ6_OTOGA        0.31  0.50    2  192  323  517  199    8   12  571  H0XKJ6     Uncharacterized protein (Fragment) OS=Otolemur garnettii GN=MMP25 PE=4 SV=1
  607 : H2LPI4_ORYLA        0.31  0.49    1  192  495  687  199    9   13  694  H2LPI4     Uncharacterized protein (Fragment) OS=Oryzias latipes GN=gel-b PE=4 SV=1
  608 : H2QAF3_PANTR        0.31  0.51    2  192  314  508  199    8   12  562  H2QAF3     Uncharacterized protein OS=Pan troglodytes GN=MMP25 PE=4 SV=1
  609 : H3AYH2_LATCH        0.31  0.57    1  192  490  679  196    8   10  682  H3AYH2     Uncharacterized protein OS=Latimeria chalumnae PE=4 SV=1
  610 : H3CTM8_TETNG        0.31  0.58    2  180  286  463  186   10   15  553  H3CTM8     Uncharacterized protein (Fragment) OS=Tetraodon nigroviridis GN=MMP16 (1 of 2) PE=4 SV=1
  611 : I3JCN4_ORENI        0.31  0.62    1  192  453  651  200    5    9  651  I3JCN4     Uncharacterized protein (Fragment) OS=Oreochromis niloticus GN=MMP20 PE=4 SV=1
  612 : I3LFQ7_PIG          0.31  0.51    2  192  370  564  199    8   12  618  I3LFQ7     Uncharacterized protein (Fragment) OS=Sus scrofa GN=MMP25 PE=4 SV=1
  613 : L7MJ58_9ACAR        0.31  0.54    2  192  170  362  197    7   10  404  L7MJ58     Putative matrix metalloproteinase (Fragment) OS=Rhipicephalus pulchellus PE=2 SV=1
  614 : M3YUT5_MUSPF        0.31  0.50    2  192  367  561  199    8   12  615  M3YUT5     Uncharacterized protein (Fragment) OS=Mustela putorius furo GN=MMP25 PE=4 SV=1
  615 : MMP25_HUMAN         0.31  0.51    2  192  314  508  199    8   12  562  Q9NPA2     Matrix metalloproteinase-25 OS=Homo sapiens GN=MMP25 PE=1 SV=1
  616 : Q1G0Y4_ICTPU        0.31  0.54    1  192  495  683  195    7    9  686  Q1G0Y4     Matrix metalloproteinase 9 OS=Ictalurus punctatus PE=2 SV=1
  617 : Q6DF16_XENTR        0.31  0.54    1  192  478  667  195    6    8  670  Q6DF16     Matrix metallopeptidase 9 (Gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase) OS=Xenopus tropicalis GN=mmp9 PE=2 SV=1
  618 : U4TZE1_DENPD        0.31  0.61    1  182  170  354  188    5    9  413  U4TZE1     Uncharacterized protein OS=Dendroctonus ponderosae GN=D910_00859 PE=4 SV=1
  619 : V8NUV1_OPHHA        0.31  0.48    1  192  218  404  205    8   31  404  V8NUV1     Uncharacterized protein (Fragment) OS=Ophiophagus hannah GN=L345_08366 PE=4 SV=1
  620 : W5JY77_ASTMX        0.31  0.54    2  192  209  401  196    6    8  475  W5JY77     Uncharacterized protein (Fragment) OS=Astyanax mexicanus PE=4 SV=1
  621 : B0W3F6_CULQU        0.30  0.53    2  192  389  585  201    9   14  586  B0W3F6     Matrix metalloproteinase OS=Culex quinquefasciatus GN=CpipJ_CPIJ001700 PE=4 SV=1
  622 : B3RF44_SORAR        0.30  0.52    2  192  228  420  196    6    8  496  B3RF44     Matrix metalloproteinase-24 (Predicted) OS=Sorex araneus GN=MMP24 PE=4 SV=1
  623 : B7NZI4_RABIT        0.30  0.52    2  192  264  456  196    6    8  532  B7NZI4     Matrix metalloproteinase 24 preproprotein (Predicted) OS=Oryctolagus cuniculus GN=MMP24 PE=4 SV=1
  624 : C3YHA9_BRAFL        0.30  0.53    2  192  231  423  197    8   10  423  C3YHA9     Putative uncharacterized protein OS=Branchiostoma floridae GN=BRAFLDRAFT_88624 PE=4 SV=1
  625 : E7FF88_DANRE        0.30  0.56   21  189    1  170  171    3    3  249  E7FF88     Uncharacterized protein OS=Danio rerio GN=mmp16a PE=4 SV=1
  626 : E9QIX9_DANRE        0.30  0.53    2  192  338  530  197    7   10  606  E9QIX9     Uncharacterized protein OS=Danio rerio GN=mmp24 PE=4 SV=1
  627 : F6YUR1_MACMU        0.30  0.51    2  192  314  508  199    8   12  562  F6YUR1     Uncharacterized protein OS=Macaca mulatta GN=MMP25 PE=4 SV=1
  628 : F7CL91_XENTR        0.30  0.53    1  192  480  670  196    7    9  673  F7CL91     Uncharacterized protein OS=Xenopus tropicalis GN=mmp9 PE=4 SV=1
  629 : G3I019_CRIGR        0.30  0.51    2  174  172  345  179    6   11  413  G3I019     Matrix metalloproteinase-25 OS=Cricetulus griseus GN=I79_016722 PE=4 SV=1
  630 : G3NB51_GASAC        0.30  0.52    2  192  294  486  197    7   10  571  G3NB51     Uncharacterized protein (Fragment) OS=Gasterosteus aculeatus PE=4 SV=1
  631 : G5C6J3_HETGA        0.30  0.52    2  192  225  417  196    6    8  492  G5C6J3     Matrix metalloproteinase-24 OS=Heterocephalus glaber GN=GW7_21540 PE=4 SV=1
  632 : H2NT31_PONAB        0.30  0.46    5  174   58  219  183   12   34  414  H2NT31     Uncharacterized protein OS=Pongo abelii GN=VTN PE=4 SV=2
  633 : H2P1R2_PONAB        0.30  0.52    2  192  246  438  196    6    8  514  H2P1R2     Uncharacterized protein (Fragment) OS=Pongo abelii GN=MMP24 PE=4 SV=1
  634 : H2ZQ60_CIOSA        0.30  0.54    3  192  392  585  197    6   10  585  H2ZQ60     Uncharacterized protein (Fragment) OS=Ciona savignyi GN=Csa.1986 PE=4 SV=1
  635 : H3BBN7_LATCH        0.30  0.51    1  192  309  502  201   11   16  579  H3BBN7     Uncharacterized protein (Fragment) OS=Latimeria chalumnae PE=4 SV=1
  636 : H9J718_BOMMO        0.30  0.56    2  192  325  519  200   10   14  572  H9J718     Uncharacterized protein OS=Bombyx mori GN=Bmo.3587 PE=4 SV=1
  637 : I3KQH5_ORENI        0.30  0.52    2  192  300  492  197    7   10  577  I3KQH5     Uncharacterized protein (Fragment) OS=Oreochromis niloticus GN=mmp24 PE=4 SV=1
  638 : J3SET7_CROAD        0.30  0.53    1  192  312  505  198    7   10  574  J3SET7     Matrix metalloproteinase-14 OS=Crotalus adamanteus PE=2 SV=1
  639 : L9L354_TUPCH        0.30  0.52    2  192  264  456  196    6    8  532  L9L354     Matrix metalloproteinase-24 OS=Tupaia chinensis GN=TREES_T100008644 PE=4 SV=1
  640 : M0RCS0_RAT          0.30  0.52    2  192  209  401  196    6    8  477  M0RCS0     Matrix metalloproteinase-24 (Fragment) OS=Rattus norvegicus GN=Mmp24 PE=4 SV=1
  641 : M3XJ12_LATCH        0.30  0.51    1  192  327  520  201   11   16  597  M3XJ12     Uncharacterized protein OS=Latimeria chalumnae PE=4 SV=1
  642 : M3ZJR5_XIPMA        0.30  0.53    1  192  328  523  202   10   16  595  M3ZJR5     Uncharacterized protein OS=Xiphophorus maculatus PE=4 SV=1
  643 : M7AP74_CHEMY        0.30  0.51    1  192  283  479  201    8   13  528  M7AP74     Matrix metalloproteinase-25 OS=Chelonia mydas GN=UY3_18357 PE=4 SV=1
  644 : N6T126_DENPD        0.30  0.59    1  192  208  405  201    7   12  451  N6T126     Uncharacterized protein (Fragment) OS=Dendroctonus ponderosae GN=YQE_12156 PE=4 SV=1
  645 : Q4SKD2_TETNG        0.30  0.56    1  189  307  495  195    8   12  553  Q4SKD2     Chromosome 13 SCAF14566, whole genome shotgun sequence. (Fragment) OS=Tetraodon nigroviridis GN=GSTENG00016785001 PE=4 SV=1
  646 : Q5D713_NOTVI        0.30  0.53    1  192  487  676  195    6    8  679  Q5D713     Matrix metalloproteinase 9 OS=Notophthalmus viridescens GN=MMP9 PE=2 SV=1
  647 : Q6PF33_XENLA        0.30  0.56    1  192  479  668  195    6    8  671  Q6PF33     Mmp9 protein OS=Xenopus laevis GN=mmp9 PE=2 SV=1
  648 : Q98856_CYNPY        0.30  0.53    1  192  487  676  195    6    8  679  Q98856     Gelatinase-b OS=Cynops pyrrhogaster PE=2 SV=1
  649 : Q98TF2_ORYLA        0.30  0.53    2  192  271  463  197    7   10  546  Q98TF2     Membrane type-5 matrix metalloproteinase OS=Oryzias latipes GN=MT5-MMP PE=2 SV=1
  650 : Q9W7L6_XENLA        0.30  0.56    1  192  479  668  195    6    8  671  Q9W7L6     Gelatinase B OS=Xenopus laevis GN=mmp9 PE=2 SV=1
  651 : U3JQ15_FICAL        0.30  0.49    1  192  517  706  196    8   10  709  U3JQ15     Uncharacterized protein (Fragment) OS=Ficedula albicollis GN=MMP9 PE=4 SV=1
  652 : U3K4N9_FICAL        0.30  0.52    2  192  249  443  200    8   14  515  U3K4N9     Uncharacterized protein OS=Ficedula albicollis GN=MMP17 PE=4 SV=1
  653 : U4UEY5_DENPD        0.30  0.59    1  192  244  441  202    9   14  475  U4UEY5     Uncharacterized protein (Fragment) OS=Dendroctonus ponderosae GN=D910_06541 PE=4 SV=1
  654 : V9I5L9_BRAFL        0.30  0.55    3  192  338  528  198   11   15  586  V9I5L9     MT-MMP1 OS=Branchiostoma floridae PE=2 SV=1
  655 : W4WCG9_ATTCE        0.30  0.56    2  182  117  297  187    7   12  360  W4WCG9     Uncharacterized protein OS=Atta cephalotes PE=4 SV=1
## ALIGNMENTS    1 -   70
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....1....:....2....:....3....:....4....:....5....:....6....:....7
## ALIGNMENTS   71 -  140
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....8....:....9....:....0....:....1....:....2....:....3....:....4
    93  366 A E  T 3 5S+     0   0  114  655   71  KKEKKKKTKETKKETSSSSSSKKrSQrStrrSQSrGGrsrsQMTTssrTrMTAIsTSsssKsDkTTsrss
    94  368 A L  T 3 5S-     0   0   12  649   18  LLMLFFFLLLLFMMLLLLLLLLLfLLfLfffLLLf..ffffLFLLfffLfFLLLfLLfffMfLfLLffff
## ALIGNMENTS  141 -  210
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....5....:....6....:....7....:....8....:....9....:....0....:....1
     1  274 A T              0   0  150  406   27  TTTTTTT  TTTTT T TTTTTTT  TTTTTTTTTTT  TTTTTTTT T   T     A  T  T T  T
    62  335 A P  T 345S+     0   0   35  581   73  AAAVAAPN.VVFGA.VETAAAAAF..IAATQQSTTTA..TAQTAIFQ.T...D.PT..T..TDDTNTN.E
    93  366 A E  T 3 5S+     0   0  114  655   71  sssMssSTTMMNSrTMStsrsssNHTTssTSSrTTTrTTTsSTsRNSTTTTTTTTTTNTNTTNNTTTTAT
    94  368 A L  T 3 5S-     0   0   12  649   18  fffFffLLLFFYLfLFLffffffYLLLffLFFfLLLfLLLfLLfLYLLLLLLLLLLLLLFLLLLLLLLLL
## ALIGNMENTS  211 -  280
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....2....:....3....:....4....:....5....:....6....:....7....:....8
     1  274 A T              0   0  150  406   27  TTTTT T    TT   TTTT  TT   STAT TTA TT TT   TTTTTTTT T  ATTT S ST TT T
    62  335 A P  T 345S+     0   0   35  581   73  VNFTFNN....NSN.TTFFIDDTF.DT.SFNTVTK.FF.VI..NIESNTTRV.Q.NESTIT.M.IDTA.I
## ALIGNMENTS  281 -  350
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....9....:....0....:....1....:....2....:....3....:....4....:....5
     1  274 A T              0   0  150  406   27  TTTT TT TTT ATTTT TTTTTT TTTTTTTTTT  PT TTTP    S T    TTPTT PTPP     
   121  395 A N  T 3  S+     0   0   44  620   55  .Q..I..ID..DN...DD.NN.DSID.....D..DIDSNNNDNSDINDDNSNIIINRGD.NSRSDDNDND
   122  396 A Q  E <   -HI 119 140C  57  621   65  .K..W..WK..IK...KQ.MM.KNWK.....K..KWQKMKMKKKRWQKKLEQWWWMMEK.LKMKKKLKQQ
## ALIGNMENTS  351 -  420
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....6....:....7....:....8....:....9....:....0....:....1....:....2
     1  274 A T              0   0  150  406   27      TT  T  TT A      T     P  T        N  N     NN    T T T  T        
     2  275 A P        -     0   0   18  590   14  PASPPPSPPP PPPQPPPPPPP PPTPRTPP P PPPP PPPPPP  PPP PPPPPPGGGGG     GPP
    42  315 A F  E     -C   29   0A  31  652   88  SDSSNlSNTNSVNDHNNNDDDYDDDSDDSNNDDppGpETGSpSpIggESSgpIPpppTTTTTgggpfTpI
    43  316 A L  E  >  -C   28   0A  93  641   58  LPLLFfLLFLF.LLELLLLLLLVLLFLLFLLVLltLtLKFStLtSllPSPltP.tttKKKKKllllkKtP
    49  322 A P  T 3  S+     0   0   84  625   26  APP.PSPPPPPpPPPPPPPPPPPPPPPSPPPPPPPPPP.PPPPP.PPPPPPP..PPP.....PPPP..P.
    54  327 A R  S    S-     0   0  105  656   76  GGGpGNGGSGGiKGDGGGGGGGKGGDGGDGKKGTNGNGiNGNYNvKTGHNTNvvNNNiiiiiKKKKiiNv
    55  328 A I        -     0   0    2  653   23  IIFiILIIVIIaLIIIIIVVVVFIIIIVIILFVIVIVVvIIVIVvIIIIIIVvvVVVvvvvvIIIIvvVv
    81  354 A Y  T 3  S+     0   0  151  516   79  LNLYYDLLYLLF.LYLLL...P.LLLL.LL...DFLFDsILFLFWN.LLL.FWWFFFsssss....ssFW
    82  355 A D    <   -     0   0  103  647   67  KIRDDQRRDRRQqRTRRReeeEqRRRRdRRqqeQQRQTrQRQKQTDdQKQdQTTQQQrrrrrddddrrHT
    83  356 A I        -     0   0   33  585   50  SIPLISPPLPAMvPVPPPiiiVvPPAPlAPvviI.Q.Ii.L.P.ILiMP.i.II...iiiiillllvi.I
   160  434 A G  T 3  S+     0   0   14  655   38  KGRGRGRnGnRGEnGnnnNNNFDnnRnGRnEDNgGRGNGGRGRGYggGRGgGYsGGGGGGGGggggGGGY
   161  435 A Y  E <   -KL 158 174D  78  627   58  HRHFFYHyFyHYNyMyyyFFF.NyyHyFHyNNFyYYYFYSNYHY.yyFHFyY.yYYYYYYYYyyyyYYY.
## ALIGNMENTS  421 -  490
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....3....:....4....:....5....:....6....:....7....:....8....:....9
     1  274 A T              0   0  150  406   27     P  N T   TT NA T TT             TT   T N  N    TT  T P  TPN TTTTTTT
     2  275 A P        -     0   0   18  590   14     PPPPPPPPPPPPPAPPPPP PGGG      SPPP P P P PPPP  PP  P SP PSP PPPPPPP
    41  314 A L  E     +C   30   0A  54  556   74  .H.IPPRRIRRR.RQRTRRRRR.RFFFM..F..TR.R.R...RARWPI..VVTEGIIRI.IQ.....G..
    42  315 A F  E     -C   29   0A  31  652   88  gfgRGGppTpppgpppSpppppgpTTTnggTggGpSpgpgggpGplSGggSNgGpTTpTgTpeggggpgg
    43  316 A L  E  >  -C   28   0A  93  641   58  lkl.YYttLtmtltst.tttttltKKKnllKllLt.tltllltLttPLllLLlIlSStSlSsplllllll
    81  354 A Y  T 3  S+     0   0  151  516   79  .s.YFFFFlFFF.FFFLFFFFF.Fsss......LFQF.F...F.FFLL..LL.LSLLFL.LFS....S..
    82  355 A D    <   -     0   0  103  647   67  drdVQQQQKQQQsQQHVQQQQQdQrrrdddTddRQDQdQdsdHSQQQRddRKdKTVVQVsVHQssssTss
    83  356 A I        -     0   0   33  585   50  lviS....V...l...A.....l.iiilllVllL.V.l.lll.R...PllPAl.LPP.PlP..llllLll
   160  434 A G  T 3  S+     0   0   14  655   38  gGgGGGGGGGGGgGGGGGGGGGgGGGGggggggKGgGgGgggGGGEGKggRLgGgRRGRgRGGgaggGga
   161  435 A Y  E <   -KL 158 174D  78  627   58  yYyYFFYY.YYYyYFYHYYYYYyYYYYyyykyyHYsYyYyyyYFYFFHyyH.yFhHHYHyHFFhyhh.yy
   188  462 A S  G X  S+     0   0   34  489   62  .S..SSSSTSSS.SSSSSSSSS.S...... ..VS S.S...SSSSSA..S..T SSSS.SSS.... ..
## ALIGNMENTS  491 -  560
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....0....:....1....:....2....:....3....:....4....:....5....:....6
     1  274 A T              0   0  150  406   27  P TT TTTTT T  TTTTTTTTTT   TAT TTTTTTTTTTTTTTTTT TTTTTT TTT  TTTTTT   
     2  275 A P        -     0   0   18  590   14  P PP PPPPP P PPPPPPPPPPPS  PPP PPPPPPPPPPPPPPPPPPPPPPPP PPP  PPPPPP P 
    41  314 A L  E     +C   30   0A  54  556   74  l............E..........L...Y...................Y............V.G.GGYlQ
    42  315 A F  E     -C   29   0A  31  652   88  rgggegggggeggGggggggggggMeggpgggggggggggggggggggpg.ggggggggggagpgpppks
    43  316 A L  E  >  -C   28   0A  93  641   58  llllplllllpllFllllllllll.lllelllllllllllllllllllillllllllllllalllllqpn
    81  354 A Y  T 3  S+     0   0  151  516   79  LS..S........L...........G..N...................N.Y............S.SSVL.
    82  355 A D    <   -     0   0  103  647   67  NNssQsssssSssNssssssssssLDssRsssssssssssssssssssNsAssssssssssssNsNNTEK
    83  356 A I        -     0   0   33  585   50  .Lll.lllllLll.llllllllllGKllPlllllllllllllllllllLlLllllllllllllLlLLVS.
   160  434 A G  T 3  S+     0   0   14  655   38  GgggGgggggGggGggggggggggGGggGgsgggggggggggggggggngvggggsgggggggdgddgGG
   161  435 A Y  E <   -KL 158 174D  78  627   58  YyhhYhhhhhFhhFhfhhhhhhhhAKyhQhhhhhhhhhhhhhhhhhhhkhfhhhhhhhhhhhhyhyyyR.
   188  462 A S  G X  S+     0   0   34  489   62  A...S.....S..A..........DA.. ................... ..............S.dS A.
## ALIGNMENTS  561 -  630
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....7....:....8....:....9....:....0....:....1....:....2....:....3
     1  274 A T              0   0  150  406   27  TT STTA T    A   T  PAA  T A TP  P S          T T A    SAPA        A  
    11  284 A L        -     0   0    2  598   21  FFL.FFVTF ..A.A..F..FFf..LFF..A. FA.A  ....A.....lf.A....ALT.TTD ...A.
    12  285 A D  S    S-     0   0   31  591    1  DDNDDDD.D DD.D...D..DDD..VDD.D.. D.D.  .......D.D.D....DD....... ..D..
    13  286 A A  E     -A   24   0A   1  626   16  GGAAGGA.G AA.A.AAGAASAAAAAAAAT.A S.V.  AATA.AATAA.AA.AAVA...A..A TAA.T
    40  313 A E  E     -C   31   0A 107  655   71  MTSITTGGTNPPWSENsTssTnnsGLnSsLGGGTERSGGssGsSssLsIGnsGssRPSSGeGGSGGsPSG
    41  314 A L  E     +C   30   0A  54  556   74  ...Q..LY.YQQL.NYr.qr.llrYMlLrEYYY.GKLYYrrYrPrrErEYlrYrrKQGYYyYYGYYrQPY
    42  315 A F  E     -C   29   0A  31  652   88  gg.gggppgpssTgpppgppgttppyrrpspppgygqpppppprppspgptppppgnyTppppppppnrp
    43  316 A L  E  >  -C   28   0A  93  641   58  ll.rlllllekk.plerlrkllhrelhhrleeilkiqiirrqrrrrlrvlhrerrireAliqqpllrrrq
    54  327 A R  S    S-     0   0  105  656   76  KKHSKKRKKnKKhKnnqKqhTRQhnfPnqVddeTtEhdgqqRyeyqVqVKQqneqERtnRnRRKKRqRhH
    55  328 A I        -     0   0    2  653   23  IIVIIIIIIiIIiLiiiIivFIIiiaVviIvivFiLvvvivIiiivIvIIIiiivLIviIiIIIIIvIiI
    62  335 A P  T 345S+     0   0   35  581   73  PP.VPPAPPPPP.VPsHPHPPPPR..PPHIEPPPLPTLPPH.HHHHIHH.PH.HHPP...E..I..HPP.
    81  354 A Y  T 3  S+     0   0  151  516   79  .SI.SSFASN.....N.SRRV.LR.TLN..N.NVLQNNN.RVRRRR.R..L..RRQ.V.VLVVlTVR.RV
    82  355 A D    <   -     0   0  103  647   67  sNKSNNEGNRKKNtneRNQQD.KQnEKNRKQnNDNDNINRQTQQQQKQEtKRnQQD.S.TNTTPMTQ.QT
    83  356 A I        -     0   0   33  585   50  lL..LLVPLP..IpagLL.LL...pV.VL.LpLLH.VLLR.V.......l.Rp...TLMVYVV.LA.T.A
    98  372 A K  T 3  S+     0   0  180  628   75  PPSKPPPLPAKK..ET.P..ASS.APSL.DEAEAEVLAA..L....D.K.S.A..VKNRLDLL.ML.KpL
   160  434 A G  T 3  S+     0   0   14  655   38  gdGGddEgddGGdtGnGdGGgGGGdGGdGGGdngGGGdnGGgGGGGGGGalGGGGGGdGgsggdneGGGe
   161  435 A Y  E <   -KL 158 174D  78  627   58  hyN.yyFyyq..yhVkDyADhSSDqFSsD.RnkhK.AkkDDyDDDD.D.fsDQDD.NkYykyyhfyDNDy
   187  461 A N  G >  S+     0   0    9  607   56  DDKDD T D DDaKsagDggDNKgGSN gD a DgE   gglggggDgD KgvggED slgllsSlgD l
   188  462 A S  G X  S+     0   0   34  489   62  ..A.. S . ..n fyk.qe.SSkETS k. f .i.   kndekek.n. Skekn.. sdiddgIdn. d
   190  464 A L  G <  S-     0   0    1  602   18  LLQLL L L LLF NLLLLLLLLLFLL LL M LLL   LLMLLLLLLL LLFLLLL LMLMMM MLL M
   191  465 A W    <         0   0  108  599   75  GGRNG G G HHG HSDGDDGGGDGYG DK K GGN   DDGDDDDKDK GDGDDNH NGGGGG GDH G
   192  466 A a              0   0   90  599    0  CCCCC C C CCC CCCCCCCCCCCCC CC C CCC   CCCCCCCCCC CCCCCCC CCCCCC CCC C
## ALIGNMENTS  631 -  655
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....4....:....5....:....6....:....7....:....8....:....9....:....0
     1  274 A T              0   0  150  406   27      G  G  GTAPPTAT AS P  
     2  275 A P        -     0   0   18  590   14  P P PPPPPPPPPPPTQTPQRPP P
     3  276 A D    >   -     0   0  107  628   61  N NENNNNNNNDDDDDDDNDDNDDD
     4  277 A K  T 3  S+     0   0   73  628   83  I IKITIIIIIRRTIAAAVAARTTK
     5  278 A a  T 3  S+     0   0   55  646    0  CCCCCCCCCCCCCCCCCCCCCCCCC
     6  279 A D    X   -     0   0   70  646   43  DKDGEDDDDDETQDDKNKDNMNDFD
     7  280 A P  T 3  S+     0   0  110  645   64  GPGGGTGGGGGTATGVVVGVETTST
     8  281 A S  T 3  S+     0   0   75  645   71  NQNDNNNRNNNHHSDKEKNEKHSSS
     9  282 A L    <   -     0   0    9  647   36  FVFFFYFFFFFFFYFAMAFMNFYIY
    10  283 A S        -     0   0   38  647   76  NtNFDDNDNNDDDDDFFFNFFDDDD
    11  284 A L        -     0   0    2  598   21  TgTV....TT...A........A.A
    12  285 A D  S    S-     0   0   31  591    1  .D.D...........DDD.DD....
    13  286 A A  E     -A   24   0A   1  626   16  .V.ATATT..TAA.TAAATAAA.A.
    14  287 A I  E     +A   23   0A   2  648   24  VFVMIVVIVVIVIVVIIIVIIVVVI
    15  288 A T  E     -A   22   0A   5  649   45  ATALTAAAAATAAATTATAATAAAS
    16  289 A S  E     -A   21   0A  23  648   76  LMLYVLFVLLVQNVLEDEFDEQVVI
    17  290 A L  E >  S-A   20   0A  20  650   30  FPFFLIFLFFLIIILILIFLIIIII
    18  291 A R  T 3  S-     0   0  119  652   34  RERGRRRRRRRRRRREQERQNRRRR
    19  292 A G  T 3  S+     0   0   49  652   41  GDGTGGRGGGGGGRGGGGRGGGRSR
    20  293 A E  E <   -A   17   0A  60  652   16  EEEEEEEEEEEEEEEQAQEAEEEEE
    21  294 A T  E     -AB  16  32A  16  653   54  MYMIMLMMMMMAVLMLLLMLLALLV
    22  295 A M  E     -AB  15  31A   1  655   38  FSFFFFFFFFFFFFFHHHFHYFFFF
    23  296 A I  E     -AB  14  30A   0  655   24  VVVIVIVVVVVFFIVFFFVFFFIVI
    24  297 A F  E     +AB  13  29A   2  655    1  FYFFFFFFFFFFFFFFFFFFFFFFF
    25  298 A K  E >   - B   0  28A  39  655    8  KDKQKKKKKKKKKKKKKKKKKKKKK
    26  299 A D  T 3  S-     0   0   53  655   27  DDDEEDDDDDEGKDGDDDDDNGDDG
    27  300 A R  T 3  S+     0   0  126  651   38  R.RDRRRKRRRKKKRGGGRGGKKRR
    28  301 A F  E <   -BC  25  43A  35  652   43  W.WKWYWWWWWYHYWKLKWLKYYHY
    29  302 A F  E     -BC  24  42A   0  652   29  F.FFFHFFFFFFFFFYYYFYYFFFL
    30  303 A W  E     -BC  23  41A  11  652   21  W.WWWWWWWWWWWWWWWWWWWWWYW
    31  304 A R  E     -BC  22  40A  63  652   15  R.RRRRRRRRRRRRRKTKRTTRRRR
    32  305 A L  E     -B   21   0A  10  653   83  LGLWVILVLLVLMIVALALLYLIYI
    33  306 A H        -     0   0  111  653   88  RRRNRGRRRRRTQGRSTSRTSTGHG
    34  307 A P  S    S+     0   0  100  653   78  NPNTHANNNNHRPDSSPSNPSRDDD
    35  308 A Q  S    S-     0   0  119  654   86  NQNANHNNNNNEANNARANRFNNKH
    36  309 A Q  S    S+     0   0  138  654   93  RPRPQGKRRRQKRGRRSRKSWKGGG
    37  310 A V  S    S+     0   0   96  653   85  VPVPVRVVVVVHNQVPKPVKKHQLI
    38  311 A D        -     0   0  114  654   75  QAQGMYQIQQMLLVLGNGQNSLVYY
    39  312 A A        -     0   0   13  655   72  EEEPDPEDEEDVVTDASAESGVTPE
    40  313 A E  E     -C   31   0A 107  655   71  GEGYGGGGGGGSSSNIPIGPISsGG
    41  314 A L  E     +C   30   0A  54  556   74  Y.Y.YYYYYYYLLGYKQKYQQLyYY
    42  315 A F  E     -C   29   0A  31  652   88  p.p.pppppppreypgsgpsgqppp
    43  316 A L  E  >  -C   28   0A  93  641   58  q.qPpeqpqqpqqepkrkqrsqimi
    44  317 A T  H >> S+     0   0    3  652   28  I.IIIIIIIIIITIIIIIIIVINTT
    45  318 A K  H 34 S+     0   0   78  654   67  E.ESGTDGEEGHQNSSSSDSAHRSR
    46  319 A S  H 34 S+     0   0   76  654   77  Q.QSHRQQQQHRRRVDDDQDDRLRL
    47  320 A F  H << S+     0   0   28  654   39  F.FQFMFFFFFFFLFTTTFTTFFFF
    48  321 A W    ><  +     0   0    7  654   10  W.WWWWWWWWWWWFWWWWWWWWRWN
    49  322 A P  T 3  S+     0   0   84  625   26  K.KPRSKVKKRRMRVPPPKPPR.R.
    50  323 A E  T 3  S+     0   0  131  629   70  GEGDGSGGGGGGGGGAAAGAGGGS.
    51  324 A L  S <  S-     0   0    9  634   14  LLLLLLLLLLLLLFLLLLLLLLFLL
    52  325 A P        -     0   0   24  656   21  PCPPPPPPPPPPPPPPPPPPPPPPP
    53  326 A N  S    S+     0   0   55  656   69  ASASAKPSAAANLKSSSAPSDLKRS
    54  327 A R  S    S-     0   0  105  656   76  RgRSSnRSRRSndtDVKIRKTntgs
    55  328 A I        -     0   0    2  653   23  IfIIIvIIIIIvivIIIIIIIlvvv
    56  329 A D        -     0   0   21  655   25  DDDDNDDNDDNDDDDDDDDDDDDDD
    57  330 A A  E     -D   70   0B   0  655    4  AAAAAAATAAAAAAATTSATAAAAA
    58  331 A A  E     +D   69   0B   2  655   27  AFAVAVAAAAAVVVAAAAAAVVVVV
    59  332 A Y  E     -D   68   0B  12  655    3  YTYYYYYYYYYYYFYFFFYFFYFYY
    60  333 A E  E     -D   67   0B  45  656   13  EDEQEEEEEEEEEEEEQEEQQEEEE
    61  334 A H  E >>> -D   66   0B  10  656   87  RLRKRRRRRRRRRRRDDDRDDRRRR
    62  335 A P  T 345S+     0   0   35  581   73  ...P.......PS..LPL.PLT..P
    63  336 A S  T 345S+     0   0  104  650   78  AKANKPTKAAKGNAHLTLSTLSAYD
    64  337 A H  T <45S-     0   0  132  654   67  DNDDDDDDDDDDDDDTSTDSTDDDK
    65  338 A D  T  <5 +     0   0   49  654   41  GGGGGKGGGGGHSGGKKKGKKHGGK
    66  339 A L  E   < -D   61   0B  15  655   83  RSRPKHKKRRKKKNKKSKKSRKNKI
    67  340 A I  E     -DE  60  78B   6  654   53  FLFLFIFFFFFIIIFIIIFIVIIIV
    68  341 A F  E     -DE  59  77B  18  655   55  VFVVVAVVVVVVVVVFFFVFFVVVF
    69  342 A I  E     -DE  58  76B   1  655   32  FAFFFIFFFFFFFFFFFFFFFFFFF
    70  343 A F  E     +DE  57  75B   1  656    6  FFFFFFFFFFFFFFFFFFFFFFFFI
    71  344 A R  E >   - E   0  74B  79  656   56  KRKKKIKKKKKKIVKSSSKSAKVKG
    72  345 A G  T 3  S-     0   0   11  656   20  GGGGGGGGGGGGGDDGGGGGGGDGH
    73  346 A R  T 3  S+     0   0  117  643   69  DQDSDKDDDDDLQDDRSRDSRDDS.
    74  347 A K  E <   -EF  71  90B  79  654   57  KYKKKEKKKKKKHKQRKRKKQRKEE
    75  348 A F  E     -EF  70  89B   9  655   27  YCYYYLYHYYYYFFFFFFFFFYFYY
    76  349 A W  E     -E   69   0B   9  655    5  WYWWWYWWWWWWWYWWWWWWWWYWY
    77  350 A A  E     -E   68   0B   0  655   60  VEVMVLVVVVVVVLLVQVVQVVLVV
    78  351 A L  E     +E   67   0B   5  655   57  FLFFFFFFFFFFFFFYYYFYFFFFF
    79  352 A N  S >  S-     0   0   67  656   72  KDKNTNRNKKTKTSRTTTKTSKSDN
    80  353 A G  T 3  S-     0   0   25  656   38  EEEGESEEEEEDDGEGGGEGGDGGA
    81  354 A Y  T 3  S+     0   0  151  516   79  V.VA..VAVV..TVA...V...V.N
    82  355 A D    <   -     0   0  103  647   67  TkTRaqTNTTanRSD...S.KnSnN
    83  356 A I        -     0   0   33  585   50  VvVIllALVVlvVLVTTTAT.vLlL
    84  357 A L    >   -     0   0   45  653   75  EREMELEEEEEEDVLTSTESNEVEE
    85  358 A E  T 3  S+     0   0  168  656   78  PPPELPPPPPLEPPPVAVPAVEPSP
    86  359 A G  T 3  S+     0   0   58  656   31  GGGGGGGGGGGGGGGLILGILGGRG
    87  360 A Y    <   +     0   0   46  656   38  YYYYYYYYYYYYSYYGGGYGGYYYY
    88  361 A P  S    S-     0   0   55  656    8  PPPPPPPPPPPPPPPPPPPPPPPPP
    89  362 A K  E     -F   75   0B  62  656   34  HKHKKKHKHHKRHKQRRRQRRRKRK
    90  363 A K  E     -F   74   0B 115  656   75  SLSHNPSHSSNPPPPGSGSSGPPPP
    91  364 A I  S   >S+     0   0    4  656   23  LILVlLLILLlIILlLILLIIILIL
    92  365 A S  T > 5S+     0   0   57  654   86  GRGSmTVKGGmSTTyEEELEESTRT
    93  366 A E  T 3 5S+     0   0  114  655   71  EdETGKEEEEGDDEGKKKEKKDEDY
    94  368 A L  T 3 5S-     0   0   12  649   18  LwLLSLLLLLSFLLNLLLLLLFLYL
    95  369 A G  T < 5 +     0   0   51  649    4  GGGGGGGGGGGGGGGGGGGGGGGGG
    96  370 A L      < -     0   0    9  655   18  SISLLLSRSSLLLLVILIRLILLLL
    97  371 A P    >   -     0   0   40  655   14  CECpPPSRCCPPPPPGSGSSGPPYP
    98  372 A K  T 3  S+     0   0  180  628   75  L.Lt.ELLLL...N.KKKLKK.N.A
    99  373 A E  T 3  S+     0   0  152  645   81  P.PG.TPPPP..SN.DDDPDE.N.S
   100  374 A V    <   +     0   0    5  654   27  R.RNRLKTRRRMGLVVVVKVALLVL
   101  375 A K        +     0   0  100  656   58  EGEFDESDEEDEVKHEEEEEGGKQE
   102  376 A K        -     0   0   97  656   59  GPGKRKGRGGRGTKKKAKGARGKSK
   103  377 A I        -     0   0    2  656   12  IIIMILIIIIIVVIIIIIIILIIVI
   104  378 A S        -     0   0   13  656   18  DDDDDDDDDDDDEDDVMVDMSDDDD
   105  379 A A  E     -G  118   0C   0  655    9  TATAAATATTAAAGTGGGTGGAGAG
   106  380 A A  E     +G  117   0C   2  655   13  AAAAAAAAAAAAAAASSSASAAAAA
   107  381 A V  E     -G  116   0C   7  656   42  LFLLLMLLLLLFFMILFLLFLFMFM
   108  382 A H  E     -G  115   0C  22  656   84  RTRnYVRFRRYVVVWQAQRAQSVVV
   109  383 A F    >>  -     0   0   14  639   95  WRWrWWWWWWWWWWW...W..WWWW
   110  384 A E  T 34 S+     0   0  142  655   74  EIESLSEMEELLGGERRRERRAGGG
   111  385 A D  T 34 S+     0   0  115  655   75  PnPkALPPPPAHHHPGDGPDGHHHH
   112  386 A T  T <4 S-     0   0   74  656   75  VqVrNNVSVVNNNNNRNRVNRNNNN
   113  387 A G  S  < S+     0   0    8  656   73  GGGRGGGGGGGDGGGGGGGGGDGGG
   114  388 A K  E     - H   0 127C  32  656   24  KKKRKKKKKKKKKNYKKKKKKKNKR
   115  389 A T  E     -GH 108 126C   1  656   24  TTTTTTTTTTTTTTTVAVTAVTTTT
   116  390 A L  E     -GH 107 125C   9  656   36  YYYYYYYYYYYYYYYLLLYLLYYYY
   117  391 A L  E     -GH 106 124C   3  656   22  FLFFFFFFFFFFFFFLLLFLLFFFF
   118  392 A F  E     -GH 105 123C   2  656   18  FFFFFYFFFFFFFFFFFFFFFFFFF
   119  393 A S  E >   - H   0 122C  15  655   71  KKKVRSKRKKRKESSNNNKNSKSKS
   120  394 A G  T 3  S-     0   0   37  655   41  GGGKGGGGGGGDNGGGGGGGGDGGG
   121  395 A N  T 3  S+     0   0   44  620   55  ESENNTDNEENKSKDDEDDEENKNS
   122  396 A Q  E <   -HI 119 140C  57  621   65  RQRQKMQKRRKYHDRKQKQQSLDRM
   123  397 A V  E     -H  118   0C   0  656   26  YYYFYYYYYYYYYYYYYYYYYYYYY
   124  398 A W  E     -H  117   0C  11  656    6  WWWYYWWYWWYWWWWWWWWWWWWWW
   125  399 A R  E     -H  116   0C  58  656   41  RRRRRKRRRRRRRKRRRRRRRRKRR
   126  400 A Y  E     -HJ 115 133C  13  645    6  Y.YYFYYFYYFYFFFLLLYLLYFYF
   127  401 A D  E >>> -HJ 114 132C  13  653   25  S.SNNDNNSSNDDDNDNDNNDDDDD
   128  402 A D  T 345S+     0   0   19  656   26  EFEEDEEEEEDDDDEVLVELVDDDE
   129  403 A T  T 345S+     0   0   94  656   89  EEEEEDEEEEEHRNQKKKEKKHNIS
   130  404 A N  T <45S-     0   0  120  656   69  RDRKMEKTRRMLAETTTTRTVEEEV
   131  405 A H  T  <5S+     0   0  125  656   65  RGRGRGHRRRRRGQRQLQSLQRQKN
   132  406 A I  E   < -J  127   0C 101  656   82  AVAKSKTSAASHNESVTVTTRREKY
   133  407 A M  E     -J  126   0C  36  656   23  TLTMVVTVTTVMVVTVIVVIVMVMV
   134  408 A D        -     0   0   18  655   18  DDDDDEDDDDDDDEDDDDDDDDED.
   135  409 A K  S    S+     0   0  172  656   71  PPPRALAAPPALPKSKNKPNKPKRE
   136  410 A D  S    S+     0   0  111  656   27  GDGGDDGDGGDGGDDGGGGGGGDGL
   137  411 A Y        +     0   0   33  656   17  YYYYYYYYYYYYYYFYYYYYYYYYD
   138  412 A P        +     0   0   48  656    2  PPPPPPPPPPPPPPPPPPPPPPPPY
   139  413 A R        -     0   0  103  656   32  KRKKKRKKKKKKRRKRRRKRRSRKP
   140  414 A L  B  >  -I  122   0C  36  651   87  PNPPSNPNPPSESKPDQDPQAEKKR
   141  415 A I  H  > S+     0   0    1  656   27  IIIMIMIIIIISLINTTTITTAIID
   142  416 A E  H  4 S+     0   0   98  656   72  TSTSSATDTTSITHSEAESADIHDM
   143  417 A E  H  4 S+     0   0  110  656   73  VDVVVMVVVVVLLPRDDDVDDLPRS
   144  418 A D  H  < S+     0   0   46  656   85  WGWWWWWWWWWWWMWANAWNVWMWM
   145  419 A F  S >< S-     0   0   17  656   29  KFKREKKGKKEKKWGFYFKYFKWEF
   146  420 A P  T 3   +     0   0   72  655   57  GDGGGGGGGGGGGKRAPAGPTGKGA
   147  421 A G  T 3  S+     0   0   57  638   24  IGI.....II...G.GGG.GGIG.G
   148  422 A I  S <  S-     0   0    2  656   27  PIPVIVIIPPILVVIVVVIVVPVVV
   149  423 A G        -     0   0   29  656   65  QPQPPGPPQQPPPGPPPPPPPSGPG
   150  424 A D  S    S+     0   0   69  656   76  ADANEYDDAAESSTDIGIEGLPTNN
   151  425 A K        -     0   0   86  655   63  PNPNSNASPPSQGDSNDNADDLDND
   152  426 A V        +     0   0    1  656   42  QVQIPIPVQQPLLIPASAPSADILI
   153  427 A D  S    S-     0   0   43  656   21  GDGDRDQRGGRDDDKHHHQHRDDDD
   154  428 A A  E     -K  165   0D   1  656   19  AAAAASGGAAADDAGDDDGDNAAGA
   155  429 A V  E     +K  164   0D   2  655   51  FAFAAVAAFFAVIVAVVVAVVMVIV
   156  430 A Y  E     -K  163   0D  30  656   42  ILIMFFFFIIFMIFFFFFFFFRFMF
   157  431 A E  E     +K  162   0D  44  656   76  SASEMQIMSSMRSQLLLLILLWQQQ
   158  432 A K  E >   -K  161   0D 106  656   92  KLKDGWSGKKGWWWSYYYNYYSWWW
   159  433 A N  T 3  S-     0   0  130  656   79  EPEPNKRNEENSNKDKQQRQQDKTK
   160  434 A G  T 3  S+     0   0   14  655   38  gagtsdedggsddddEGEdGGGddn
   161  435 A Y  E <   -KL 158 174D  78  627   58  yryyynyfyyysskfNNNyN.Aklk
   162  436 A I  E     -KL 157 173D   1  648   74  TVTSTTTTTTTTTTTIYITYKSTTT
   163  437 A Y  E     -KL 156 172D  24  648   14  YYYMYYYYYYYYYYYHYHYYYYYYY
   164  438 A F  E     -KL 155 171D   2  647    7  FFFFFFFFFFFFFFFFFFFFHFFFF
   165  439 A F  E     -KL 154 170D   1  647   17  YFYLYFYYYYYFFFYCCCYCFFFFF
   166  440 A N  E >   - L   0 169D  30  647   73  KKKKKKKKKKKKKKHKQKKQCKKKK
   167  441 A G  T 3  S-     0   0   13  648   20  GGGGGGGGGGGGGDGDDDGDRGDGG
   168  442 A P  T 3  S+     0   0   71  647   72  RKRNNKKDRRNKTKSQQQKQGKKSK
   169  443 A I  E <   -LM 166 185D  62  645   92  DQDKKGERDDKEEGSFYFDYSEGQG
   170  444 A Q  E     -LM 165 184D   8  645   84  YYYVYYYYYYYYYFYYFYYFFYFYF
   171  445 A F  E     -LM 164 183D  17  643   33  WWWRWWWWWWWWWWWWWWWWYWWWW
   172  446 A E  E     -LM 163 182D  16  640   58  KEKYKKKKKKKRRKRRRRKRWKKKE
   173  447 A Y  E     -LM 162 180D   0  640   28  FYFLFFFFFFFVFFFMVMFVRLFFF
   174  448 A S  E  >> -LM 161 179D  15  640   51  DQDNNNDNDDNPLNDTTTDTMLNND
   175  449 A I  T  45S+     0   0   48  628   91  N NNNDNNNNNGGDNPSPNSTDDDD
   176  450 A W  T  45S+     0   0  161  628   85  Q QYQLQEQQQSGIRRRRQRPSIIL
   177  451 A S  T  45S-     0   0   52  628   75  K KKKQKKKKKDSRRRKRKKRERTR
   178  452 A N  T  <5 +     0   0   85  628   79  L LVLMLLLLLMVMWQQQLQYLMMM
   179  453 A R  E      -M  169   0D  70  608   55  N NPSPSSNNSLSLVKSKSSKSLS 
   186  460 A A  G >  S+     0   0    1  608   72  I IMVSIVIIVIASPYYYIYYISA 
   187  461 A N  G >  S+     0   0    9  607   56  l lElalllllapaSDDDlDDaap 
   188  462 A S  G X  S+     0   0   34  489   62  d dFdfdddddddvS...d..dvd 
   189  463 A I  G <  S+     0   0   14  602   30  W WWWWWWWWWWWWRILIWLIWWW 
   190  464 A L  G <  S-     0   0    1  602   18  M MLMMMMMMMLMM LLLMLLLMF 
   191  465 A W    <         0   0  108  599   75  G GGGGGGGGGLYG NRNGRQVGG 
   192  466 A a              0   0   90  599    0  C CCCCCCCCCCCC CCCCCCCCC 
 SeqNo PDBNo   V   L   I   M   F   W   Y   G   A   P   S   T   C   H   R   K   Q   E   N   D  NOCC NDEL NINS ENTROPY RELENT WEIGHT
    1  274 A   0   0   0   0   0   0   0   1   9   5   2  82   0   0   0   0   0   0   2   0   406    0    0   0.723     24  0.72
    2  275 A   0   0   0   0   0   0   0   2   1  91   3   1   0   0   0   0   1   0   0   0   590    0    0   0.461     15  0.86
    3  276 A   1   0   0   0   0   0   0   0  11   0   2   6   0   6   1   9   4  20   7  31   628    0    0   2.058     68  0.39
    4  277 A   7   9  16   2   0   0   0   0  22   4   2   6   0   1   5  19   3   0   1   1   628    0    0   2.254     75  0.16
    5  278 A   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   646    0    0   0.035      1  0.99
    6  279 A   0   0   0   0   0   0   0   3   1   1   5   2   0   1   0  14   1   3   4  66   646    1    0   1.297     43  0.57
    7  280 A   3   0   0   0   0   0   0   7   1  48  16   3   0   2   4   1   9   5   0   0   645    0    0   1.762     58  0.36
    8  281 A   0   0   0   1   0   0   0   2  10   1  15   5   0   4   4   9   2   3  20  23   645    0    0   2.225     74  0.29
    9  282 A   6  61  14   3   9   0   1   0   0   0   4   0   0   0   0   1   0   0   0   0   647    0    0   1.365     45  0.63
   10  283 A  19   0   4   0   4   0   0   0   1   0  33  25   0   0   2   1   0   0   2   6   647   50    6   1.811     60  0.23
   11  284 A   1  16   2   0  76   0   0   0   2   0   0   1   0   0   0   0   0   0   0   0   598   24    1   0.811     27  0.79
   12  285 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1  99   591    0    0   0.082      2  0.98
   13  286 A   0   0   0   0   0   0   0  10  86   0   1   2   0   0   0   0   0   0   0   0   626    0    0   0.516     17  0.84
   14  287 A  43   0  49   1   0   0   0   0   5   0   0   1   0   0   0   0   0   0   0   0   648    0    0   0.988     32  0.75
   15  288 A   0   0   0   0   0   0   0   0  21   0  15  61   0   0   0   0   0   0   0   0   649    1    0   1.043     34  0.54
   16  289 A   4   2   1   7   1   0   0   1   0   0  11  45   0   0   1   1  16   5   4   1   648    0    0   1.880     62  0.23
   17  290 A   6  48  33   2  10   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   650    0    0   1.262     42  0.70
   18  291 A   0   0   0   0   0   0   0  13   0   0   0   0   0   0  83   0   2   1   0   0   652    0    0   0.607     20  0.65
   19  292 A   0   0   0   0   0   0   0  75   0   0   0   0   0   0  10   5   0   1   4   4   652    0    0   0.953     31  0.59
   20  293 A   0   0   0   0   0   0   0   0   2   0   0   0   0   0   0   5   1  88   0   4   652    0    0   0.552     18  0.84
   21  294 A  16  17  35   9   0   0   2   0   1   0   0  18   0   0   0   2   0   0   0   0   653    0    0   1.719     57  0.46
   22  295 A   1  27   7  24  32   0   6   0   0   0   0   0   0   2   0   0   0   0   0   0   655    0    0   1.610     53  0.61
   23  296 A   7   3  13   0  76   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   655    0    0   0.825     27  0.75
   24  297 A   0   2   0   0  97   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   655    0    0   0.147      4  0.99
   25  298 A   1   1   0   0   0   0   0   0   0   0   0   0   0   0   2  94   0   0   0   0   655    0    0   0.326     10  0.91
   26  299 A   0   0   0   0   0   0   0  17   0   0   1   0   0   0   0   1   0   1   8  71   655    4    9   0.938     31  0.73
   27  300 A   0   0   0   0   0   1   0   6   0   3   5   0   0   0  74   8   1   2   0   0   651    0    0   1.043     34  0.62
   28  301 A   1   2   5   0  48   6  21   0   0   0   1   0   0  14   0   1   0   0   0   0   652    0    0   1.570     52  0.56
   29  302 A   4  13  10   4  53   0  15   0   0   0   0   0   0   0   0   0   0   0   0   0   652    0    0   1.424     47  0.70
   30  303 A   0   3   2   6   4  85   0   0   0   0   0   0   0   0   0   0   0   0   0   0   652    0    0   0.640     21  0.78
   31  304 A   0   2   0   1   0   4   0   0   0   0   0   1   0   0  89   2   0   0   0   0   652    0    0   0.565     18  0.85
   32  305 A   6  18  10   0   0   0   0   0   1   0   6  17   0   0  17  23   1   0   0   0   653    0    0   1.989     66  0.17
   33  306 A  12   2   2   1   1   0   9   2   2   1  14   6   0  27   4   0   9   0   8   0   653    0    0   2.293     76  0.12
   34  307 A   6   5   0   0   1   0   5   1   3  43   7   9   0   3   2   0   1   1  10   3   653    0    0   2.090     69  0.21
   35  308 A   1   1   0   0   9   3   4   1   2   9   4   1   0   6   9   4  26   6   6   6   654    0    0   2.479     82  0.13
   36  309 A   2  14   7   6   2   0   8   8   2   0   9   5   0   0  19   4   8   0   5   0   654    1    0   2.503     83  0.06
   37  310 A  13   7   1   2   0   0   1   4   4  20  12   8   0   1   6   3   6   1   3   7   653    0    0   2.503     83  0.15
   38  311 A   2   5   1   2   0   0   2   3   4   0   2   7   0   0   4  18   4  31   4  13   654    0    0   2.220     74  0.25
   39  312 A  25   1   7   0   0   1   0   4  16  31   1   7   0   0   1   0   1   4   0   1   655    0    0   1.933     64  0.27
   40  313 A   1   2   5   4   0   0   0   8   0   3   9   8   0   1   1   2   3  44   3   5   655   99   24   2.065     68  0.29
   41  314 A   6  35   3   3  19   0   7   2   0   1   0   2   0   2   8   1   9   1   1   0   556    0    0   2.108     70  0.26
   42  315 A   3   0   1   1   8   0   6  17   0  14   5   5   0   7   2   0   1   8  17   3   652   13  226   2.449     81  0.11
   43  316 A   1  56   2   1  17   0   0   0   0   4   2   6   0   1   4   3   3   2   0   0   641    0    0   1.623     54  0.41
   44  317 A  20   4  66   1   0   0   0   0   0   0   0   9   0   0   0   0   0   0   0   0   652    0    0   1.042     34  0.71
   45  318 A   0   0   0   0   0   0   0   1  20   0  43   7   0   3   2  15   2   1   1   2   654    0    0   1.743     58  0.33
   46  319 A   7  10   2   0   0   0   0   0   4   0  38  23   0   1   5   0   2   1   3   2   654    0    0   1.902     63  0.23
   47  320 A   0   7   2   1  71   0   6   0   0   0   6   5   0   0   1   2   0   0   0   0   654    0    0   1.152     38  0.61
   48  321 A   0   1   0   0   6  89   0   1   0   0   0   0   0   0   0   0   0   0   1   0   654   29    3   0.488     16  0.90
   49  322 A   0   0   0   0   0   0   1   0   1  86   3   1   0   0   3   2   0   3   0   0   625    0    0   0.711     23  0.74
   50  323 A   0   0   0   0   3   0   0   9   2   0  27   6   0   1   1   1  11  24   6   8   629    0    0   2.087     69  0.29
   51  324 A   2  88   5   0   1   0   0   0   3   0   0   0   0   0   0   0   0   0   0   0   634    0    0   0.561     18  0.86
   52  325 A   0   0   0   5   0   0   0   0   1  89   1   1   0   0   1   0   0   0   1   0   656    0    0   0.569     18  0.78
   53  326 A   2   1   1   0   0   0   0   1  11   4  33   5   0   1   0   2   0  12  22   5   656    0    0   1.997     66  0.31
   54  327 A   2   0   3   0   0   0   2  30   0   1   3   2   0   3   9  22   2   1  12   9   656    3   68   2.087     69  0.23
   55  328 A  21  17  58   1   3   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   653    0    0   1.112     37  0.76
   56  329 A   0   0   0   0   0   0   0   0   0   0   0   0   0   2   0   0  24   6   1  68   655    0    0   0.893     29  0.75
   57  330 A   0   0   0   0   0   0   0   0  97   0   0   2   0   0   0   0   0   0   0   0   655    0    0   0.161      5  0.95
   58  331 A  15   0   1   0   0   0   0   0  83   0   0   0   0   0   0   0   0   0   0   0   655    0    0   0.534     17  0.73
   59  332 A   0   0   0   0   7   0  91   0   0   0   0   0   1   0   0   0   0   0   0   0   655    0    0   0.378     12  0.96
   60  333 A   0   0   0   0   0   0   0   0   2   0   1   0   0   0   0   0   2  91   0   2   656    0    0   0.474     15  0.87
   61  334 A  20   1   9   0   4   0   1   0  10   0   5   0   0   7  10   0   0   2  21  10   656   75    2   2.245     74  0.12
   62  335 A   4   1   2   0   5   0   1   3  13  43   4   8   0   3   1   2   3   4   3   1   581    0    0   2.109     70  0.27
   63  336 A   2   4   3   2   0   0   0   3   7   7  18   2   0   1   2   2  15  14   3  15   650    0    0   2.440     81  0.21
   64  337 A   0   0   1   0   0   0   0   1   0   0   4   4   0   4  32  23   2  13   2  13   654    0    0   1.919     64  0.33
   65  338 A   0   0   0   0   0   0   0  14   0   0   1   0   0   1   1   4   1  17   7  54   654    0    0   1.436     47  0.59
   66  339 A   2  19   5   1   0   0   0   0   1   0   2  12   0   2   8  25  10  11   1   0   655    1    0   2.151     71  0.17
   67  340 A  42   4  24   2   3   0   0   0  16   0   2   6   0   0   0   0   0   0   1   0   654    0    0   1.606     53  0.46
   68  341 A  22  15   3   0  38   0  12   0   0   0   0   0   0   0   8   0   0   0   0   0   655    0    0   1.621     54  0.44
   69  342 A   9  27  21   2  40   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   655    0    0   1.401     46  0.67
   70  343 A   0   2   2   0  94   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0   656    0    0   0.292      9  0.94
   71  344 A   0   0   1   0   0   0   0   2  13   0  11   1   0   0  10  59   2   0   0   0   656    0    0   1.371     45  0.44
   72  345 A   1   0   0   0   0   0   0  81   0   0   0   0   0   0   0   0   0   2   1  15   656   13   19   0.666     22  0.80
   73  346 A   0   1   2   0   0   0   0   1   1   8   7   3   0   2  14   5   2   4  36  15   643    0    0   2.060     68  0.30
   74  347 A   0   0   0   0   0   0   0   0   0   0   0   0   0   6   5  40  23  18   7   0   654    0    0   1.614     53  0.42
   75  348 A   7   1   1   6  34   0  51   0   0   0   0   0   0   1   0   0   0   0   0   0   655    0    0   1.184     39  0.73
   76  349 A   0   0   0   0   0  96   2   0   0   0   0   1   0   0   0   0   0   0   0   0   655    0    0   0.200      6  0.95
   77  350 A  29   8   8   4   0   0   0   2  45   0   1   2   0   0   0   0   1   0   0   0   655    0    0   1.521     50  0.39
   78  351 A  16  24  20   2  13   0  17   0   1   0   0   7   0   0   0   0   0   0   0   0   655    0    0   1.865     62  0.42
   79  352 A   0   1   0   0   0   0   1   0   0   0  25   4   0   0  29   9   9   1  18   2   656    0    0   1.857     61  0.28
   80  353 A   0   0   0   0   0   0   0  64  19   0   1   0   0   1   0   1   1   4   5   4   656  140   16   1.199     40  0.62
   81  354 A   3  10   0   0   9   1  41   0   1   0   5   3   0   2   3   0   9   0  11   1   516    0    0   1.981     66  0.20
   82  355 A   1   0   0   0   0   0   0   0   5   0  12   5   0   1   8   3  10  11  11  32   647   69  126   2.106     70  0.33
   83  356 A  29  26  27   4   0   0   0   1   2   6   1   2   0   0   1   0   0   1   0   0   585    0    0   1.718     57  0.50
   84  357 A  12  34   1   6   0   0   0   0   1   1   1   1   0   0   1   1  17  22   0   2   653    0    0   1.862     62  0.24
   85  358 A   2   2   0   0   0   0   2   0  11  25   5   1   0   3  16   4  13  15   0   1   656    0    0   2.191     73  0.22
   86  359 A   0   2   0   0   0   0   1  79   0   1   1   0   0   1   2   0   0   1   4   8   656    0    0   0.948     31  0.68
   87  360 A   0   1   0   0   5   0  80   4   1   4   1   0   0   0   1   0   0   0   0   0   656    0    0   0.914     30  0.61
   88  361 A   0   0   0   0   0   0   0   0   3  95   1   0   0   0   0   0   0   0   0   0   656    0    0   0.270      9  0.91
   89  362 A   0   1   0   0   0   0   0   1   0   0   0   0   0   2  30  61   5   0   0   0   656    0    0   1.035     34  0.66
   90  363 A   0   0   0   0   0   0   3   7   1  20  22   5   0   1   4  16   0   0   7  15   656    0    0   2.087     69  0.24
   91  364 A   0  27  71   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   656    2    6   0.702     23  0.77
   92  365 A   1   1   0   0   0   0  22   1   2   0  25  17   0  22   2   0   2   3   1   1   654    0    0   1.927     64  0.14
   93  366 A   0   0   1   1   0   0   1   1   1   0  31  18   0   1   4   6   1  15   8  10   655    7   61   2.023     67  0.29
   94  368 A   0  65   1   3  24   0   7   0   0   0   0   0   0   0   0   0   0   0   0   0   649    0    0   0.993     33  0.81
   95  369 A   0   0   0   0   0   0   0  98   0   0   0   0   0   0   1   0   0   0   0   0   649    0    0   0.133      4  0.96
   96  370 A   0  35   1   0  61   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0   655    0    0   0.867     28  0.82
   97  371 A   0   0   0   0   0   0   0   2   0  92   4   0   1   0   1   0   0   0   0   0   655   28    2   0.413     13  0.86
   98  372 A   0   3   0   1   0   0   1   2   4  17  15   4   0   0  22  22   1   2   2   3   628    0    0   2.107     70  0.25
   99  373 A   0   0   0   0   3   1   5   2   1   5  16  25   0   4   5   1   0   8   4  19   645    0    0   2.225     74  0.19
  100  374 A  76   8   7   2   0   0   0   3   1   0   0   1   0   0   2   0   0   0   0   0   654    0    0   0.981     32  0.73
  101  375 A   0   0   0   0   0   0   0   1   1   1   1   4   0   1  12  43  23   8   3   2   656    0    0   1.727     57  0.41
  102  376 A   0   0   0   0   0   0   0   4   7   0   2   1   0   8  18  47   6   2   3   0   656    0    0   1.727     57  0.40
  103  377 A  25   2  73   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   656    0    0   0.676     22  0.87
  104  378 A   0   0   0   1   0   0   0   0   0   0   7   0   0   0   0   0   0   1   2  88   656    1    0   0.528     17  0.81
  105  379 A   0   0   0   0   0   0   0   5  93   0   0   2   0   0   0   0   0   0   0   0   655    0    0   0.321     10  0.90
  106  380 A   5   0   0   0   0   0   0   0  92   0   2   1   0   0   0   0   0   0   0   0   655    0    0   0.345     11  0.87
  107  381 A  53  14   5   2  22   0   2   0   0   0   0   1   0   0   0   0   0   0   0   0   656    0    0   1.332     44  0.57
  108  382 A   3   0   0   0  13   1  16   0   1   1  21   0   7  19   2   0   1   0  14   0   656   17    1   2.092     69  0.15
  109  383 A   5   7   7   0  11  21   6   0   0   0   0   0   0   0   0   1   0   8   9  23   639    1    0   2.136     71  0.04
  110  384 A   1   1   0   0   0   0   0   5   1   9  12   1   0   3  17  19   3  24   2   2   655    0    0   2.140     71  0.26
  111  385 A   0   4   0   0   1   0   1   4   2   3   8   2   0   5   4  16   4  18   9  20   655    0    3   2.358     78  0.25
  112  386 A   3   3   2   1   2   0   1   0   1   2   8  35   0   1   2  15   1   2  22   0   656    0    0   1.985     66  0.24
  113  387 A   0   0   0   1   0   0   4  43   1   0   0   6   0   1  11  23   6   1   2   1   656    0    0   1.742     58  0.26
  114  388 A   0   0   0   0   0   0   5   0   0   0   0   1   0   0   4  87   1   0   1   0   656    0    0   0.605     20  0.76
  115  389 A   2   0   1   0   5   0   0   0   3   0   0  87   0   0   0   0   0   0   0   0   656    0    0   0.567     18  0.76
  116  390 A   0  28   1   0   7   0  62   0   0   0   0   0   0   0   0   0   0   0   0   1   656    0    0   0.989     33  0.63
  117  391 A   4  13  13   0  68   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   656    0    0   0.989     33  0.77
  118  392 A   1   0   2   0  91   0   0   0   0   0   0   0   0   0   0   0   0   0   5   0   656    1    0   0.397     13  0.82
  119  393 A  46   0   3   0   0   0   0   0  18   0  13   6   0   0   3   4   0   0   4   3   655    0    0   1.690     56  0.28
  120  394 A   0   0   0   0   0   0   0  59   9   0   0   0   0   0   0   1   5  10   5  10   655   36    1   1.378     46  0.59
  121  395 A   0   0   6   0   0   0   0   1   0   0   4   0   0   2   4   3   2   9  26  42   620    0    0   1.723     57  0.45
  122  396 A   1   1   0   3   1   6   1   0   0   0   2   0   0   2   8  43  19   9   2   2   621    0    0   1.867     62  0.35
  123  397 A   8   1   1   0  21   0  61   0   0   0   0   0   8   0   0   0   0   0   0   0   656    0    0   1.145     38  0.74
  124  398 A   0   0   0   0   0  87  12   0   0   0   0   0   0   0   0   0   0   0   0   0   656    0    0   0.419     13  0.93
  125  399 A   0   0   0   0   0   0   0   0   0   0  29   0   0   0  69   2   0   0   0   0   656   11    5   0.710     23  0.58
  126  400 A   0   2   0   0  18   0  79   0   0   0   0   0   0   0   0   0   0   0   0   0   645    0    0   0.593     19  0.94
  127  401 A   0   0   0   0   0   0   1   0   0   0   2   0   0   0   0   0   0   0  22  74   653    0    0   0.702     23  0.74
  128  402 A   3   1   0   0   0   0   0   0   0   0   0   0   0   1   0   0   0  77   5  11   656    0    0   0.856     28  0.74
  129  403 A  13   0   2   3   0   0   7   1  10   0   3   9   0   2  15  10   6   9   7   5   656    0    0   2.519     84  0.10
  130  404 A   1   1   1   2   0   0   0   0   4   0   5  17   0   0  23  31   2   2   9   1   656    0    0   1.952     65  0.30
  131  405 A   0   2   0   0   0   0   0   4   3   0   3   0   0   6  19  23  31   3   5   0   656    0    0   1.913     63  0.34
  132  406 A   5   3   4   3   3   0   0   0   5   0  27  15   0   1   8  21   5   1   0   0   656    0    0   2.170     72  0.18
  133  407 A   5   2   2  85   0   0   0   0   0   3   1   2   0   0   0   0   0   0   0   0   656    1    0   0.700     23  0.77
  134  408 A   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0  26   0  71   655    0    0   0.755     25  0.82
  135  409 A   0   3   0   0   1   0   0   0   8  38   4   3   0   1   5  24   4   3   1   3   656    0    0   1.973     65  0.28
  136  410 A   0   0   0   0   0   0   0  74   2   0   2   0   0   0   1   0   0   1   1  17   656    0    0   0.918     30  0.73
  137  411 A   0   0   0   0  34   0  60   0   0   0   3   0   0   0   0   1   0   0   1   0   656    0    0   0.928     30  0.83
  138  412 A   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   656    0    0   0.076      2  0.98
  139  413 A   0   0   0   0   0   0   0   0   0   0   1   0   0   0  40  52   6   0   0   0   656    5    0   0.992     33  0.68
  140  414 A   1  33   1   6   3   0   1   0   1   5  12   1   0   1  11   6   8   1   6   3   651    0    0   2.271     75  0.13
  141  415 A   9   4  75   1   0   0   0   0   0   0   0   9   0   0   0   0   0   0   0   1   656    0    0   0.935     31  0.72
  142  416 A   7   0   3   0   0   0   0   3  33   1  10   8   0   1   2   2   1  19   3   5   656    0    0   2.153     71  0.27
  143  417 A   4   4   1   1   0   2   0   2   3   1   5   4   0   4   2  10   2  25   3  26   656    0    0   2.266     75  0.27
  144  418 A   3   1   1   2   1   9   4   2  11   0   7   4   1   4   0   0   0  11   4  36   656    0    0   2.237     74  0.15
  145  419 A   0   0   0   0  73  17   1   0   0   0   0   0   0   0   2   3   0   3   0   0   656    1    0   0.937     31  0.70
  146  420 A   0   1   0   0   0   0   0  10   3  59   7   1   0   0   1   1   3   0  15   0   655   18    1   1.421     47  0.43
  147  421 A   1   0   2   0   0   0   0  82  11   0   0   0   0   0   1   1   0   1   0   1   638    0    0   0.724     24  0.75
  148  422 A  21   2  67   3   0   0   0   0   0   6   0   0   0   0   0   0   0   0   0   0   656    0    0   0.977     32  0.72
  149  423 A   0   1   0   0   0   0   0  38   0  24   5   4   0   1   2   1   1   9   7   6   656    0    0   1.871     62  0.35
  150  424 A   0   5   2   0   0   0   1  10   3  11  14   3   1   5   2   2   1   2   8  28   656    1    0   2.338     78  0.23
  151  425 A   2   0   0   0   0   0   0   2   1   5   1   3   0   1  13  43   5   2  14   7   655    0    0   1.902     63  0.36
  152  426 A  52  13  23   0   0   0   0   0   1   2   1   0   0   0   0   0   2   0   0   5   656    0    0   1.373     45  0.58
  153  427 A   0   0   0   0   0   0   0   2   2   0   0   4   0   3   1   0   1   1   2  85   656    0    0   0.724     24  0.78
  154  428 A   3   0   0   0   0   0   0   2  88   0   3   0   0   0   0   0   0   0   0   4   656    1    0   0.556     18  0.81
  155  429 A  55   0   0   0   3   0   0   0  37   0   1   3   0   0   0   0   0   0   0   0   655    0    0   1.002     33  0.49
  156  430 A  18  10   2   1  54   0  11   0   1   0   0   1   0   0   0   0   1   0   0   0   656    0    0   1.421     47  0.57
  157  431 A   0   4   1   3   0   0  10   2   1   0   9   1   0   2   1   3  30  25   0   9   656    0    0   2.088     69  0.23
  158  432 A   2  19   0   1   2   2  11   1   6   0   5   1   0   8   3  19   6   5   7   2   656    0    0   2.464     82  0.08
  159  433 A   0   0   0   0  10   0   4   4   2   1   2   3   0   1   5  11  11   5  30  11   656    0    0   2.231     74  0.20
  160  434 A   0   0   0   0   0   0   2  75   1   0   3   0   0   3   4   1   0   2   4   5   655   26  164   1.124     37  0.62
  161  435 A   1   3   0   1  36   0  33   0   1   0   2   0   0  14   2   2   1   0   3   3   627    0    0   1.716     57  0.41
  162  436 A   2  15  15   0  29   0   8   0   1   0  14  14   0   0   0   1   0   0   2   0   648    0    0   1.917     63  0.25
  163  437 A   0   5   0   0   1   0  90   0   0   0   0   0   0   2   0   0   0   0   0   0   648    0    0   0.465     15  0.86
  164  438 A   1   6   3   0  89   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   647    0    0   0.468     15  0.93
  165  439 A   0   1   0   0  85   0   7   0   0   0   6   0   1   0   0   0   0   0   0   0   647    0    0   0.629     21  0.82
  166  440 A   0   0   2   0   0   0   0   0   0   0  27   2   2  13   9  26   8   0  10   1   647    0    0   1.945     64  0.26
  167  441 A   0   0   0   0   0   0   0  85   0   0   0   0   0   0   3   1   2   2   0   7   648    0    0   0.640     21  0.79
  168  442 A   1   0   0   0   0   2   0   0  13  26  26   9   0   2   4   5   4   0   5   2   647    0    0   2.082     69  0.27
  169  443 A   3   5   7   0   1   0  14   1   0   0  10   4   0   8  16  17   4   1   5   3   645    0    0   2.444     81  0.07
  170  444 A   3   0   1   4   4   0  29   0   4   0   1   2   0   0   1   0  50   0   0   0   645    0    0   1.465     48  0.15
  171  445 A   0  20   0   0  36  11  26   0   1   0   1   2   0   0   1   0   1   0   0   0   643    0    0   1.569     52  0.66
  172  446 A   0   0   0   0   0   2   0   0   6   0   0   0   0   0   6  32   6  47   0   0   640    0    0   1.382     46  0.41
  173  447 A   2  12   0   4  42   0  38   0   0   0   0   0   0   0   2   0   0   0   0   0   640    0    0   1.292     43  0.72
  174  448 A   0   0   1   2   0   0   0   1   1   3  14   1   0   0   0   0   0  14  12  51   640    1    0   1.556     51  0.48
  175  449 A   3  10  14   3   5   0   3   0   0  23   2   8   0   0   0   2   0   1  13  10   628    0    0   2.321     77  0.09
  176  450 A   2   4   3   0   1  10   0   4   1   2   5   4   0   1   8  18  12   7  16   2   628    0    0   2.511     83  0.14
  177  451 A   0   3   1   0   1   0   2   1  20   0  35  14   0   1   6  10   2   0   3   0   628    0    0   1.973     65  0.24
  178  452 A   3  18   1   3   0   0   1   1   0   0   1   0   0   3  12  37   7   7   7   0   628    0    0   1.995     66  0.21
  179  453 A   0   0   1   3   0   0   0   0   0   0   2   3   0   2  41  32   5   1   5   6   621    0    0   1.673     55  0.45
  180  454 A  50   4  34   0   0   0   0   0   2   0   7   2   0   0   0   0   0   0   0   1   621    0    0   1.286     42  0.62
  181  455 A  35  10   6   1   2   0   1   0   1   0   0  29   0   0   2   0   1   6   1   4   617    0    0   1.871     62  0.29
  182  456 A   1   0   0   0   0   0   1   1   1   5   7   7   0  10  38  21   4   1   2   1   617    1    0   1.963     65  0.33
  183  457 A  37  14  16   1   7   0   1   6   1   0   1   7   0   0   2   1   1   2   0   3   610    3  161   2.065     68  0.35
  184  458 A   9  35  14  16   0   0   0   1   4   0   1   0   0   0   3   3   9   0   0   3   607    0    0   2.034     67  0.35
  185  459 A   0   3   0   0   0   0   0   1   0  10   4   2   0   1  17  54   1   1   3   2   608    0    0   1.599     53  0.44
  186  460 A   1   0   4   3   0   0   4   2  14   1  40  17   0   1   0   4   1   0   7   0   608    0    0   1.911     63  0.28
  187  461 A   0   2   1   0   0   0   4   4   1   0  10   3   0   0   0   1   0   1  55  17   607  117   49   1.542     51  0.43
  188  462 A   1   2   2   0   3   0   3   2   2   0  60   9   0   0   3   5   0   1   2   5   489    0    0   1.646     54  0.37
  189  463 A   1   8   6   0   3  79   0   0   0   0   0   0   0   0   0   1   0   0   0   0   602    0    0   0.849     28  0.69
  190  464 A   1  58   5   4  31   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   602    0    0   1.062     35  0.82
  191  465 A   0   2   0   1   0   9   1  32   1   2   2   1   0   4   4   2   4   1  30   6   599    0    0   2.004     66  0.24
  192  466 A   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   599    0    0   0.000      0  1.00
 AliNo  IPOS  JPOS   Len Sequence
    45    73   352     2 gKPs
    45    81   362     1 vAy
    47    73   353     2 aQGr
    54    27   307     2 dRAr
    61    27   429     2 dRTr
    61   161   565     3 gSLGy
    63   109   386     1 nHv
    64   161   440     2 rPDy
    94    86   105     1 rSf
    97    94   367     1 rSf
    99    94   366     1 tSf
   100    94   125     1 rSf
   101    94   367     1 rSf
   105    73   343     1 gSn
   105    94   365     1 rSf
   108    94   367     1 rSf
   109    94   371     1 sSf
   110    94   367     1 rSf
   111    94   366     1 sSf
   116    94   301     1 sSf
   117    94   296     1 sSf
   118    94   367     1 rSf
   120    94   296     1 rSf
   125    94   367     1 sSf
   128    94   366     1 sSf
   129    94   367     1 sSf
   130    94   367     1 sSf
   131   161   443     1 eGl
   132    93   366     1 sSf
   134    94   371     1 kSf
   137    94   367     1 sSf
   138    94   367     1 rSf
   139    94   367     1 sSf
   140    94   303     1 sSf
   141    94   236     1 sSf
   142    94   288     1 sSf
   143    94   367     1 sSf
   145    94   130     1 sSf
   146    94   369     1 sSf
   154    94   367     1 rSf
   158    94   367     1 tTf
   159    94   367     1 sSf
   160    94   370     1 rSf
   161    94   366     1 sSf
   162    93   332     1 sSf
   163    94   368     1 sSf
   168    94   367     1 sSf
   169    94   367     1 sSf
   173    94   366     1 rSf
   177    94   368     1 rSf
   181    94   367     1 sSf
   184    94   367     1 sSf
   185    73   349     1 gNd
   202   126   412     3 rGCRf
   219   109   851     1 hNt
   223    94   371     1 qSf
   245   161   539     2 sSGy
   245   184   564     2 iRLf
   256    94   371     1 sTf
   261    73   358     1 vGn
   278    94   333     1 rSf
   278   161   401    10 sSIVLFCLFPGf
   279    80   356     1 nSv
   282    94   370     1 eTf
   293    94   347     1 hSf
   298   160   436     1 nRy
   304    42   435     1 qTl
   318    51   335     2 iDSv
   318    78   364     1 tTi
   319    94   365     1 sFf
   320    93   335     1 hSl
   321    94   310     1 sFf
   322    73   549     2 eTGn
   322   161   639     2 vAGf
   323    93   406     1 rSf
   324    51   339     2 iDSv
   324    78   368     1 nTi
   328    80   378     1 gEy
   329    72   354     1 vGn
   336   161   475     6 gVLSSAGf
   338    82   370     1 qAv
   340   124   406     1 sRy
   342    51   335     2 iDSv
   342    78   364     1 nTi
   344    51   339     2 iDSv
   344    78   368     1 nTi
   348    81   368     1 dTi
   354    51   342     3 pLTNi
   355   124   396     1 sRy
   356    43   315     1 lSf
   356    94   367     1 sSf
   358   160   438     1 nKy
   360   160   208     1 nKy
   362    48   344     1 lIp
   362    54   351     1 iDa
   363    82   352     1 qSv
   363    93   364     1 sFf
   364   160   438     1 nKy
   366   160   438     1 nKy
   367   160   438     1 nKy
   368   160   439     1 nKy
   369    81   545     1 eTi
   370    81   519     1 eTi
   371    81   483     1 eTi
   373    80   352     1 qNv
   373    91   364     1 sFf
   374   160   438     1 nKy
   375   160   438     1 nKy
   377   160   438     1 nKy
   378    82   385     1 dTl
   380   160   394     1 nKy
   381    82   353     1 qSv
   381    93   365     1 sFf
   382    80   352     1 qNv
   382    91   364     1 sFf
   383    81   370     1 eTi
   384    39    98     1 pMl
   384   157   217     2 gIDy
   385    42   334     1 pSt
   387    42   337     1 pSt
   389    42   330     2 iRSv
   389    68   358     1 aTs
   389    70   361     1 rTi
   392    42   334     1 pSt
   394    42   334     1 pSt
   395    51   319     2 vGRv
   396    40   504     2 gPMl
   396   158   624     2 gIDy
   396   181   649     2 lGEi
   397    40   500     2 gPMl
   397    79   541     1 dQi
   397   157   620     2 gIDy
   397   180   645     2 lGEi
   398    61   285     1 nMn
   398    72   297    12 nVWLSFLLCLSTGn
   401    40   504     2 gPMl
   401    79   545     1 dQi
   401   157   624     2 gIDy
   401   180   649     2 lGEi
   402    42   333     1 pSt
   403    51   358     2 vGRv
   404    40   493     1 eTi
   404    50   504     2 vGRv
   404   156   612     2 sMGy
   405    43   334     1 pSt
   406    42   334     1 pSt
   407    43   334     1 pSt
   408    51   329     2 iRSv
   408    69   349     2 gKGn
   408    77   359     1 aTs
   408    79   362     1 rTi
   409    52   342     2 iRSv
   409    78   370     1 aTs
   409    80   373     1 rTi
   410    51   328     2 iRSv
   410    77   356     1 aTs
   410    79   359     1 rTi
   411    51   299     2 iRSv
   411    69   319     2 gKGn
   411    77   329     1 aTs
   411    79   332     1 rTi
   412    52   297     2 iRSv
   412    78   325     1 aTs
   412    80   328     1 rTi
   413    40   502     2 gPMl
   413    79   543     1 dAl
   413   157   622     2 gIDy
   413   180   647     2 lGEi
   414    40   511     2 gPMl
   414    79   552     1 dAl
   414   157   631     2 gIDy
   414   180   656     2 lGEi
   415    40   523     2 gPMl
   415    79   564     1 dAl
   415   157   643     2 gIDy
   415   180   668     2 lGEi
   416    39   266     1 pMl
   416    78   306     1 dAl
   416   156   385     2 gIDy
   416   183   414     1 rKd
   417    41   351     1 fSk
   417    50   361     2 iRYv
   417    76   389     1 gTs
   417    78   392     1 rTv
   418    51   350     2 iRSv
   418    77   378     1 aTs
   418    79   381     1 rTi
   418   180   483     1 vLl
   419    42   333     1 pSt
   420    51   358     2 vGRv
   421    40   504     2 gPMl
   421    79   545     1 dAl
   421   157   624     2 gIDy
   421   180   649     2 lGEi
   422    41   319     1 fSk
   422    50   329     2 iRYv
   422    76   357     1 gTs
   422    78   360     1 rTv
   423    40   504     2 gPMl
   423    79   545     1 dQi
   423   157   624     2 gIDy
   423   180   649     2 lGEi
   424   182   487     1 vLl
   427    43   334     1 pSt
   428    42   334     1 pSt
   429    81   121     1 sSl
   430    42   332     1 pSt
   431    42   334     1 pSm
   432    42   334     1 pSt
   433    42   509     2 gPLl
   433    81   550     1 sTl
   433   159   629     2 gSGy
   433   182   654     2 vGNv
   434    43   334     1 pSt
   435    42   335     1 pLs
   436    43   332     1 pSt
   438    42   334     1 pSt
   439    43   334     1 pSt
   440    42   334     1 pSt
   441    43   334     1 pSt
   442    43   334     1 pSt
   443    40   507     2 gPLl
   443    79   548     1 dEl
   443   157   627     2 gIDy
   443   180   652     2 lGEi
   444    42   334     1 pSt
   445    51   338     2 iRSv
   445    69   358     2 gKGn
   445    77   368     1 aTs
   445    79   371     1 rTi
   445   180   473     1 vLl
   446    51   337     2 iRSv
   446    69   357     2 gKGn
   446    77   367     1 aTs
   446    79   370     1 rTi
   446   180   472     1 vLl
   447    51   351     2 iRSv
   447    69   371     2 gKGn
   447    77   381     1 aTs
   447    79   384     1 rTi
   447   180   486     1 vLl
   448    39   316     1 nDn
   448    78   356     1 dAl
   448   156   435     2 gIDy
   448   179   460     2 lGEi
   449    25   507     3 dSSYw
   449    40   525     2 gPMl
   449    79   566     1 dAl
   449   157   645     2 gIDy
   449   180   670     2 lGEi
   450    40   503     2 gPMl
   450    79   544     1 dAl
   450   157   623     2 gIDy
   450   180   648     2 lGEi
   451    51   163     1 rYv
   451   154   267     1 gEk
   452    40   502     2 gPMl
   452    79   543     1 dAl
   452   157   622     2 gIDy
   452   180   647     2 lGEi
   453    40   503     2 gPMl
   453    78   543     1 dQl
   453   156   622     2 gIDy
   453   179   647     2 lGEi
   455    42   334     1 pSt
   456    36   308     6 aDSRMAGn
   456    57   335     1 sSf
   456   124   403     4 gQNISs
   457    43   334     1 pSt
   458    38   503     2 gPMl
   458    77   544     1 dEl
   458   155   623     2 gIDy
   458   178   648     2 lGEi
   459    42   334     1 pSt
   460    40   475     2 gPMl
   460    79   516     1 dAl
   460   157   595     2 gIDy
   460   180   620     2 lGEi
   461    42   501     2 gPLl
   461    81   542     1 sTl
   461   159   621     2 gSGy
   461   182   646     2 vGNv
   462    40   503     2 gPLl
   462    79   544     1 dEl
   462   157   623     2 gIDy
   462   180   648     2 lGEi
   463    43   355     1 pSt
   465    42   334     1 pSt
   466    43   288     1 lNt
   467    26   271     1 lTr
   467    72   318     3 gLIGp
   469    40   502     2 gPTl
   469    79   543     1 dVl
   469   157   622     2 gIDy
   469   180   647     2 lGEi
   470    40   484     2 gPTl
   470    79   525     1 dVl
   470   157   604     2 gIDy
   470   180   629     2 lGEi
   472    73   349     2 gNGh
   472    94   372     1 qSf
   473    25   512     2 dSSw
   473    41   530     2 gPMl
   473    80   571     1 dAl
   473   158   650     2 gIDy
   473   181   675     2 lGEi
   474    25   283     1 dRr
   475    43   181     1 pLl
   475   161   300     2 gSGh
   478    42   332     1 pSt
   480    42   502     2 gPLl
   480    81   543     1 sTl
   480   159   622     2 gSGy
   480   182   647     2 vGNv
   482    43   302     1 pLs
   483    40   343     1 eGp
   484    42   502     2 gPLl
   484    81   543     1 sTl
   484   159   622     2 gSGh
   484   182   647     2 vGSv
   485    42   507     2 gPLl
   485    81   548     1 sTl
   485   159   627     2 aGGy
   485   182   652     2 lGSi
   486    11   478     2 nIVf
   486    42   511     2 gPLl
   486    81   552     1 sTl
   486   159   631     2 gSGh
   486   182   656     2 vGNi
   487    11   477     2 nIVf
   487    42   510     2 gPLl
   487    81   551     1 sTl
   487   159   630     2 gSGh
   487   182   655     2 vGNi
   488    43   132     1 pLl
   489    42   504     2 gPLl
   489    81   545     1 sTl
   489   159   624     2 gSGy
   489   182   649     2 vGNv
   490    42   485     2 gPLl
   490    81   526     1 sTl
   490   159   605     2 aGGy
   490   182   630     2 lGSi
   491    41   319     1 nSl
   491    43   322     2 rEGl
   492    40   504     2 gPLl
   492   158   624     2 gETy
   492   181   649     1 gEv
   493    42   507     2 gPLl
   493    81   548     1 sTl
   493   159   627     2 gGGh
   493   182   652     2 fGSi
   494    42   507     2 gPLl
   494    81   548     1 sTl
   494   159   627     2 gGGh
   494   182   652     2 fGSi
   495    40   341     1 eGp
   496    42   507     2 gPLl
   496    81   548     1 sTl
   496   159   627     2 gGGh
   496   182   652     2 fGSi
   497    42   506     2 gPLl
   497    81   547     1 sTl
   497   159   626     2 gGGh
   497   182   651     2 fGSi
   498    42   508     2 gPLl
   498    81   549     1 sTl
   498   159   628     2 gSGh
   498   182   653     2 vGNi
   499    42   508     2 gPLl
   499    81   549     1 sTl
   499   159   628     2 gSGh
   499   182   653     2 vGSi
   500    42   508     2 gPLl
   500    81   549     1 sTl
   500   159   628     2 gGGh
   500   182   653     2 fGSv
   501    40   327     1 eGp
   502    42   508     2 gPLl
   502    81   549     1 sTl
   502   159   628     2 gGGh
   502   182   653     2 fGSi
   503    38   499     2 gPMl
   503    77   540     1 sTl
   503   155   619     2 gHGh
   503   178   644     2 vGNv
   505    42   508     2 gPLl
   505    81   549     1 sTl
   505   159   628     2 gGGh
   505   182   653     2 vGSi
   506    42   428     2 gPLl
   506    81   469     1 sTl
   506   159   548     2 gSEf
   506   182   573     2 vGNv
   507    42   507     2 gPLl
   507    81   548     1 sTl
   507   159   627     2 gDGh
   507   182   652     2 fGSi
   508    42   507     2 gPLl
   508    81   548     1 sTl
   508   159   627     2 gGGh
   508   182   652     2 fGSi
   509    42   507     2 gPLl
   509    81   548     1 sTl
   509   159   627     2 gGGh
   509   182   652     2 fGSi
   510    42   507     2 gPLl
   510    81   548     1 sTl
   510   159   627     2 gGGh
   510   182   652     2 fGSi
   511    42   508     2 gPLl
   511    81   549     1 sTl
   511   159   628     2 gSGh
   511   182   653     2 vGSi
   512    42   508     2 gPLl
   512    81   549     1 sTl
   512   159   628     2 gGGh
   512   182   653     2 fGSi
   513    42   506     2 gPLl
   513    81   547     1 sTl
   513   159   626     2 gSGh
   513   182   651     2 fGSi
   514    42   469     2 gPLl
   514    81   510     1 sTl
   514   159   589     2 gGGh
   514   182   614     2 fGSv
   515    26    68     5 nSYVWLr
   516    38   329     1 ePl
   516    65   357     2 nTDm
   517    38   504     2 gPTl
   517    77   545     1 sTl
   517   155   624     2 gDGy
   517   178   649     2 iGDi
   518    42   467     2 gPLl
   518    81   508     1 sTl
   518   159   587     2 gGGh
   518   182   612     2 fGSi
   519    12    84     1 gId
   519    43   116     1 pVe
   519    55   129     3 nLEKi
   520    42   444     2 gPLl
   520    81   485     1 sTl
   520   159   564     2 gSGh
   520   182   589     2 fGSi
   521    40   503     2 gPMl
   521    79   544     1 sTl
   521   157   623     2 sDGh
   521   180   648     2 vGEv
   522    42   499     2 gPLl
   522    81   540     1 sTl
   522   159   619     2 gSGh
   522   182   644     2 fGSi
   523    42   459     2 gPLl
   523    81   500     1 sTl
   523   159   579     2 gGGh
   523   182   604     2 fGSi
   524    42   506     2 gPLl
   524    81   547     1 sTl
   524   159   626     2 gSGh
   524   182   651     2 fGSi
   525    42   430     2 gPLl
   525    81   471     1 sTl
   525   159   550     2 gSGh
   525   182   575     2 fGSi
   526    42   456     2 gPLl
   526    81   497     1 sTl
   526   159   576     2 gSGh
   526   182   601     2 fGSi
   527    42   506     2 gPLl
   527    81   547     1 sTl
   527   159   626     2 gSGh
   527   182   651     2 fGSi
   528    42   497     2 gPLl
   528    81   538     1 sTl
   528   159   617     2 gSGh
   528   182   642     2 fGSi
   529    42   335     2 gPLl
   529    81   376     1 sTl
   529   159   455     2 gSGh
   529   182   480     2 fGSi
   530    42   505     2 gPLl
   530    81   546     1 sTl
   530   159   625     2 gSGh
   530   182   650     2 fGSi
   531    42   507     2 gPLl
   531    81   548     1 sTl
   531   159   627     2 gSGh
   531   182   652     2 fGSi
   532    42   475     2 gPLl
   532    81   516     1 sTl
   532   159   595     2 gSGh
   532   182   620     2 fGSi
   533    42   488     2 gPLl
   533    81   529     1 sTl
   533   159   608     2 gSGh
   533   182   633     2 fGSi
   534    42   509     2 gPLl
   534    81   550     1 sTl
   534   159   629     2 gSGh
   534   182   654     2 fGSi
   535    42   510     2 gPLl
   535    81   551     1 sTl
   535   159   630     2 gGGh
   535   182   655     2 fGSi
   536    42   405     2 gPLl
   536    81   446     1 sTl
   536   159   525     2 gSGh
   536   182   550     2 fGSi
   537    42   451     2 gPLl
   537    81   492     1 sTl
   537   159   571     2 gSGh
   537   182   596     2 fGSi
   538    42   521     2 gPLl
   538    81   562     1 sTl
   538   159   641     2 gSGh
   538   182   666     2 vGNv
   539    40    62     2 pAEi
   539    46    70     1 nLp
   539   156   181     1 nGk
   540    42   506     2 gPLl
   540    81   547     1 sTl
   540   159   626     2 gSGh
   540   182   651     2 fGSi
   541    41   311     1 qAl
   541   159   430     4 vCPAGf
   542    42   427     2 gPLl
   542    81   468     1 sTl
   542   159   547     2 gSGh
   542   182   572     2 fGSi
   543    42   518     2 gPLl
   543    81   559     1 sTl
   543   159   638     2 gSGh
   543   182   663     2 vGNv
   544    42   430     2 gPLl
   544    81   471     1 sTl
   544   159   550     2 gSGh
   544   182   575     2 fGSi
   545    42   464     2 gPLl
   545    81   505     1 sTl
   545   159   584     2 gGGh
   545   182   609     2 fGSi
   546    40   503     2 gPMl
   546    79   544     1 sTl
   546   157   623     2 sDGh
   546   180   648     2 vGEi
   547    42   506     2 gPLl
   547    81   547     1 sTl
   547   159   626     2 gGGh
   547   182   651     2 fGSi
   548    42   508     2 gPLl
   548    81   549     1 sTl
   548   159   628     2 gGGh
   548   182   653     2 fGSi
   549    42   508     2 gPLl
   549    81   549     1 sTl
   549   159   628     2 gGGh
   549   182   653     2 fGSi
   550    40   503     2 gPMl
   550    79   544     1 sTl
   550   157   623     2 gDGh
   550   180   648     2 vGEv
   551    40   503     2 gPMl
   551    79   544     1 sTl
   551   157   623     2 gDGh
   551   180   648     2 vGEv
   552    43   508     1 aPa
   552    82   548     1 sTl
   552   160   627     2 gGGh
   552   183   652     2 fGSi
   553    42   478     2 gPLl
   553    81   519     1 sTl
   553   159   598     2 gSGh
   553   182   623     2 fGSi
   554    43   177     1 pLl
   554   161   296     2 dSGy
   555    42   518     2 gPLl
   555    81   559     1 sTl
   555   159   638     2 gSGh
   555   182   663     2 vGNv
   556    43   219     1 pLl
   556   161   338     2 dSGy
   556   188   367     1 nSd
   557    43   139     1 pLl
   557   161   258     2 dSGy
   558    26    56     1 pMq
   558   143   174     1 gTy
   559    39   317     1 nRl
   559    41   320     2 kEGp
   560    40   500     2 sPRn
   560   177   639     2 vSYv
   561    42   511     2 gPLl
   561    81   552     1 sTl
   561   159   631     2 gGGh
   561   182   656     2 fGSi
   562    42   507     2 gPLl
   562   160   627     2 dSGy
   562   183   652     2 iGKi
   564    42   536     2 gPFr
   564   179   675     2 vGYv
   565    42   509     2 gPLl
   565   160   629     2 dSGy
   565   183   654     2 iGKi
   566    42   508     2 gPLl
   566   160   628     2 dSGy
   567    43   234     1 pGl
   568    40   145     1 pMl
   568   157   263     1 gAy
   569    42   507     2 gPLl
   569   160   627     2 dSGy
   569   183   652     2 iGKi
   570    22    22     1 pVe
   570    34    35     3 nLEKi
   570   138   142     1 dGq
   571    40   531     2 sPRk
   571   177   670     2 vGYv
   572    40   522     2 sPRk
   572   177   661     2 vGYv
   573    50   355     3 hLDRi
   573   151   459     1 dGy
   573   174   483     2 gYPk
   573   178   489     1 aQn
   574    41   366     2 gPDp
   574    80   407     1 tTp
   574   142   470     1 gLr
   574   156   485     3 tGDDh
   574   179   511     1 gYl
   575    40   274     1 pIl
   575    52   287     3 nVSHi
   575    79   317     1 nIa
   575   180   419     2 gYPi
   575   184   425     1 sSf
   576    40   423     1 pVe
   576    52   436     3 nLTHi
   576    59   446     1 kPs
   576    80   468     1 eQg
   576   155   544     1 nGk
   576   178   568     2 pIPs
   576   182   574     1 aPy
   577    38   372     1 sPr
   577    40   375     1 pAr
   577    52   388     3 qVKVi
   577   179   518     2 dSPq
   577   183   524     1 gPk
   578    42   512     2 gPLl
   578   160   632     2 dSGy
   578   183   657     2 iGKi
   579    38   358     1 sPq
   579    40   361     1 pAr
   579    52   374     3 qVTVi
   579   179   504     2 dSPq
   579   183   510     1 gPq
   580    38   352     1 sPr
   580    40   355     1 pAk
   580    52   368     3 hVSTv
   580   180   499     2 dSPh
   580   184   505     1 gPe
   581    42   508     2 gPMl
   581   160   628     2 gDGh
   581   183   653     2 vGSv
   582    27   320     1 nRr
   582    41   335     1 nQl
   582    43   338     2 tEGl
   582    89   386     2 gSIq
   582   123   422     2 rTRf
   583    11   288     2 pQHf
   583    41   320     1 nRl
   583    43   323     2 tQGh
   584    38   354     1 sPr
   584    40   357     1 pAr
   584    52   370     3 hVRVi
   584   179   500     2 dSPq
   584   183   506     1 gPk
   585    40   438     1 pVe
   585    52   451     3 nLEKi
   585    78   480     1 nRp
   585   155   558     1 dGq
   585   178   582     1 rTk
   586    35   238     1 yPl
   586    46   250     2 fRLa
   587    40   258     1 nRl
   587    42   261     2 rEGh
   588    41    43     2 rPAh
   588    53    57     3 nLDSv
   588   156   163     1 dGs
   589    38   464     1 sPr
   589    40   467     1 pAr
   589    52   480     3 qVKVi
   589   179   610     2 dSPq
   589   183   616     1 gPk
   590    42   535     2 sPMl
   590   179   674     2 vGYv
   591    41   312     1 pVe
   591    53   325     3 dLPRv
   591    90   365     2 gRPl
   591    92   369     1 tYm
   592    40   394     1 pAe
   592    52   407     3 dIKRi
   592    79   437     1 nIp
   592   156   515     1 dKn
   592   179   539     2 eKGs
   592   183   545     1 aPf
   593    30    62     2 pAEi
   593    40    74     3 eIDHv
   593   144   181     1 nGk
   594    42   503     2 gPMl
   594   160   623     2 gDGh
   594   183   648     2 vGSv
   595    40   297     2 yPVk
   595    52   311     3 tVTHi
   595   181   443     2 gYPr
   595   185   449     1 gTi
   596    42   536     2 gPFi
   596   179   675     1 vGy
   597    40   113     2 qPAq
   597    52   127     3 hLDSv
   598    27    57     2 pAEi
   598    37    69     3 dIDYv
   598   141   176     1 dHk
   599    27    59     2 pAEi
   599    37    71     3 gIDHv
   599   141   178     1 nGk
   600    24   308     2 gDCp
   600    38   324     1 sPr
   600    40   327     1 pAr
   600    52   340     3 qVQVi
   600   179   470     2 dSPq
   600   183   476     1 gPk
   601    38   351     1 sPr
   601    40   354     1 pAr
   601    52   367     3 qVRVv
   601   179   497     2 dAPq
   601   183   503     1 gPn
   602    40   315     1 pMq
   602   157   433     1 gYy
   602   180   457     2 gYPr
   602   184   463     1 lRd
   603    38   370     1 sTr
   603    40   373     1 pAr
   603    52   386     3 yVKVi
   603   179   516     2 dSPq
   603   183   522     1 gPe
   604    40   285     2 rPAr
   604    52   299     3 eVKVi
   604   179   429     2 dSPq
   604   183   435     1 gPk
   605    38   399     1 sPr
   605    40   402     1 pAr
   605    52   415     3 yVKVi
   605    89   455     1 tVl
   605   178   545     2 dSPq
   605   182   551     1 gPe
   606    38   360     1 sPr
   606    40   363     1 pAr
   606    52   376     3 qVKVv
   606   179   506     2 dSPq
   606   183   512     1 gPk
   607    42   536     2 sPMl
   607    72   568     3 vTTGt
   607   179   678     2 vGYv
   608    38   351     1 sPr
   608    40   354     1 pAr
   608    52   367     3 qVRVv
   608   179   497     2 dAPq
   608   183   503     1 gPn
   609    42   531     2 gPFv
   609   179   670     2 vGYv
   610    10   295     1 nTl
   610    39   325     1 pMl
   610    77   364     1 tVl
   610    86   374     2 iTQf
   610   152   442     2 aNGf
   611    11   463     2 pQHf
   611    41   495     1 nRl
   611    43   498     2 tQGh
   611   160   617     3 lFTGs
   612    38   407     1 sPr
   612    40   410     1 pAr
   612    52   423     3 qVQVi
   612   179   553     2 dSPq
   612   183   559     1 gPk
   613    40   209     1 pVe
   613    52   222     3 nLEKi
   613    78   251     1 nRp
   613   183   357     1 vGe
   614    38   404     1 sPr
   614    40   407     1 pAr
   614    52   420     3 eVKVi
   614   179   550     2 dSPq
   614   183   556     1 gPk
   615    38   351     1 sPr
   615    40   354     1 pAr
   615    52   367     3 qVRVv
   615   179   497     2 dAPq
   615   183   503     1 gPn
   616    42   536     2 gPFi
   616   179   675     1 vGy
   617    42   519     2 nPQr
   617   180   659     1 gYv
   618    41   210     2 yPAe
   618    53   224     3 tLTHv
   618   158   332     1 dGk
   619    35   252     1 rLp
   619    41   259     1 nGi
   619    57   276    10 gPSTPEACSAKt
   619   170   399     1 sNs
   620    40   248     1 pMl
   620   157   366     1 gFy
   620   180   390     2 gYPk
   620   184   396     1 lKd
   621    38   426     1 eGy
   621    40   429     2 pVRi
   621    51   442     3 nIDRi
   621   156   550     1 sGk
   621   179   574     2 gYPr
   621   183   580     1 gQi
   622    40   267     1 pMq
   622   157   385     1 gYy
   622   180   409     2 gYPr
   622   184   415     1 lRd
   623    40   303     1 pMq
   623   157   421     1 gYy
   623   180   445     2 gYPr
   623   184   451     1 lRd
   624    41   271     1 pDp
   624    79   310     1 gVl
   624   156   388     1 dGh
   624   179   412     2 gYPr
   624   183   418     1 sDg
   625    23    23     1 pMl
   625   140   141     1 nGf
   626    40   377     1 pMl
   626   156   494     2 eGFy
   626   179   519     2 gYPk
   626   183   525     1 lKd
   627    38   351     1 sPr
   627    40   354     1 pAr
   627    52   367     3 qVRVv
   627   179   497     2 dAPq
   627   183   503     1 gPn
   628    42   521     2 nPQr
   628   122   603     1 sRl
   628   180   662     1 gYv
   629    40   211     2 rPAr
   629    52   225     3 hVRVi
   629    92   268     1 gLp
   630    40   333     1 pMq
   630   156   450     2 eGYy
   630   179   475     2 gYPk
   630   183   481     1 lRd
   631    40   264     1 pMq
   631   157   382     1 gYy
   631   180   406     2 gYPr
   631   184   412     1 lRd
   632     7    64     1 tRg
   632    37    95     2 gKPf
   632    63   123     1 kAv
   632    74   135     1 dVw
   632    89   151     1 nCq
   632   136   199     7 aHSYSGREr
   633    40   285     1 pMq
   633   157   403     1 gYy
   633   180   427     2 gYPr
   633   184   433     1 lRd
   634    94   485     1 pSt
   634   105   497     2 nWRr
   634   108   502     1 kRr
   634   156   551     3 tRSRy
   635    41   349     1 pMp
   635    79   388     1 aLl
   635    88   398     2 lREm
   635   154   466     2 sEVy
   635   177   491     2 gYPk
   635   181   497     1 lQd
   636    40   364     1 pMe
   636    52   377     3 nLTHv
   636    78   406     1 qYl
   636   155   484     1 dGn
   636   178   508     2 eQQl
   636   182   514     1 aPf
   637    40   339     1 pMq
   637   156   456     2 eGYy
   637   179   481     2 gYPk
   637   183   487     1 lRd
   638    41   352     1 pLp
   638   157   469     2 dEAf
   638   180   494     2 gYPk
   638   184   500     1 lRd
   639    40   303     1 pMq
   639   157   421     1 gYy
   639   180   445     2 gYPr
   639   184   451     1 lRd
   640    40   248     1 pMq
   640   157   366     1 gYy
   640   180   390     2 gYPr
   640   184   396     1 lRd
   641    41   367     1 pMp
   641    79   406     1 aLl
   641    88   416     2 lREm
   641   154   484     2 sEVy
   641   177   509     2 gYPk
   641   181   515     1 lQd
   642    41   368     2 rPAq
   642    53   382     3 nLDSv
   642    80   412     1 nIv
   642   155   488     1 dGs
   642   178   512     2 gYPr
   642   182   518     1 aKd
   643    41   323     2 ePAq
   643    53   337     3 dFERi
   643   157   444     1 dGs
   643   180   468     2 gYPr
   643   184   474     1 pQd
   644    41   248     2 yPAe
   644    53   262     3 tLTHv
   644   158   370     1 dGk
   644   181   394     2 yEQk
   644   185   400     1 aPv
   645    41   347     1 pMp
   645    89   396     2 lRAy
   645   155   464     2 dSAf
   645   178   489     1 aTl
   646    42   528     2 gPLk
   646   180   668     1 gYv
   647    42   520     2 sPLr
   647   180   660     1 gYv
   648    42   528     2 gPVk
   648   180   668     1 gYv
   649    40   310     1 pMq
   649   156   427     2 dGYy
   649   179   452     2 gYPk
   649   183   458     1 lRd
   650    42   520     2 sPLr
   650   180   660     1 gYv
   651    42   558     2 gAFs
   651   179   697     2 vGYv
   652    40   288     2 qPAq
   652    52   302     3 nLDSl
   652    79   332     1 nNv
   652   178   432     2 gYPq
   652   182   438     1 aRd
   653    39   282     1 sGy
   653    41   285     2 pAEi
   653    52   298     3 tLTHv
   653   157   406     1 dGk
   653   180   430     2 yEQk
   653   184   436     1 aPv
   654    39   376     1 pAm
   654    51   389     2 gVHv
   654    77   417     1 nYl
   654   152   493     1 dGl
   654   175   517     2 gYPr
   654   179   523     1 pHd
   655    40   156     2 pAEi
   655    50   168     3 sIDHv
   655   154   275     1 nGk