Complet list of 1mqk hssp fileClick here to see the 3D structure Complete list of 1mqk.hssp file
HSSP       HOMOLOGY DERIVED SECONDARY STRUCTURE OF PROTEINS , VERSION 2.0 2011
PDBID      1MQK
THRESHOLD  according to: t(L)=(290.15 * L ** -0.562) + 5
REFERENCE  Sander C., Schneider R. : Database of homology-derived protein structures. Proteins, 9:56-68 (1991).
CONTACT    Maintained at http://www.cmbi.ru.nl/ by Maarten L. Hekkelman 
DATE       file generated on 2014-05-03
HEADER     IMMUNE SYSTEM                           16-SEP-02   1MQK
COMPND     MOL_ID: 1; MOLECULE: ANTIBODY 7E2 FV FRAGMENT, LIGHT CHAIN; CHAIN: L; 
SOURCE     MOL_ID: 1; ORGANISM_SCIENTIFIC: MUS MUSCULUS; ORGANISM_COMMON: HOUSE M
AUTHOR     L.-O.ESSEN,A.HARRENGA,C.OSTERMEIER,H.MICHEL
DBREF      1MQK L   11   109  UNP    P01636   KV5D_MOUSE      11    108
DBREF      1MQK H    1    98  UNP    P18525   HV54_MOUSE      20    117
SEQLENGTH   231
NCHAIN        2 chain(s) in 1MQK data set
NALIGN     1177
NOTATION : ID: EMBL/SWISSPROT identifier of the aligned (homologous) protein
NOTATION : STRID: if the 3-D structure of the aligned protein is known, then STRID is the Protein Data Bank identifier as taken
NOTATION : from the database reference or DR-line of the EMBL/SWISSPROT entry
NOTATION : %IDE: percentage of residue identity of the alignment
NOTATION : %SIM (%WSIM):  (weighted) similarity of the alignment
NOTATION : IFIR/ILAS: first and last residue of the alignment in the test sequence
NOTATION : JFIR/JLAS: first and last residue of the alignment in the alignend protein
NOTATION : LALI: length of the alignment excluding insertions and deletions
NOTATION : NGAP: number of insertions and deletions in the alignment
NOTATION : LGAP: total length of all insertions and deletions
NOTATION : LSEQ2: length of the entire sequence of the aligned protein
NOTATION : ACCNUM: SwissProt accession number
NOTATION : PROTEIN: one-line description of aligned protein
NOTATION : SeqNo,PDBNo,AA,STRUCTURE,BP1,BP2,ACC: sequential and PDB residue numbers, amino acid (lower case = Cys), secondary
NOTATION : structure, bridge partners, solvent exposure as in DSSP (Kabsch and Sander, Biopolymers 22, 2577-2637(1983)
NOTATION : VAR: sequence variability on a scale of 0-100 as derived from the NALIGN alignments
NOTATION : pair of lower case characters (AvaK) in the alignend sequence bracket a point of insertion in this sequence
NOTATION : dots (....) in the alignend sequence indicate points of deletion in this sequence
NOTATION : SEQUENCE PROFILE: relative frequency of an amino acid type at each position. Asx and Glx are in their
NOTATION : acid/amide form in proportion to their database frequencies
NOTATION : NOCC: number of aligned sequences spanning this position (including the test sequence)
NOTATION : NDEL: number of sequences with a deletion in the test protein at this position
NOTATION : NINS: number of sequences with an insertion in the test protein at this position
NOTATION : ENTROPY: entropy measure of sequence variability at this position
NOTATION : RELENT: relative entropy, i.e.  entropy normalized to the range 0-100
NOTATION : WEIGHT: conservation weight

## PROTEINS : identifier and alignment statistics
  NR.    ID         STRID   %IDE %WSIM IFIR ILAS JFIR JLAS LALI NGAP LGAP LSEQ2 ACCNUM     PROTEIN
    1 : HVM54_MOUSE 1MQK    0.93  0.95  110  207   20  117   98    0    0  117  P18525     Ig heavy chain V region 5-84 OS=Mus musculus PE=1 SV=1
    2 : K7THE9_MOUSE        0.90  0.93  124  227    1  105  105    1    1  105  K7THE9     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
    3 : A2NMA3_MOUSE        0.89  0.94    1  108    1  107  108    1    1  107  A2NMA3     Anti-carcinoma embryonic antigen light chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
    4 : K7TGW3_MOUSE        0.89  0.97  118  227    1  110  110    0    0  110  K7TGW3     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
    5 : K7TQZ1_MOUSE        0.87  0.93  118  227    1  112  112    1    2  112  K7TQZ1     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
    6 : KV5A4_MOUSE 1MQK    0.87  0.94    1  108    1  107  108    1    1  108  P01636     Ig kappa chain V-V region MOPC 149 OS=Mus musculus PE=1 SV=1
    7 : K7TD70_MOUSE        0.86  0.94  118  227    1  111  111    1    1  111  K7TD70     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
    8 : K7U6I0_MOUSE        0.86  0.94  129  227    1   98   99    1    1   98  K7U6I0     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
    9 : K7T977_MOUSE        0.85  0.93  118  227    1  111  111    1    1  111  K7T977     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   10 : K7T9D0_MOUSE        0.85  0.93  118  227    1  107  110    1    3  107  K7T9D0     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   11 : K7T9J4_MOUSE        0.85  0.92  118  227    1  111  112    2    3  111  K7T9J4     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   12 : K7TDT0_MOUSE        0.85  0.92  129  227    1   96   99    1    3   96  K7TDT0     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   13 : K7TRT7_MOUSE        0.85  0.93  118  227    1  106  110    1    4  106  K7TRT7     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   14 : K7U6J5_MOUSE        0.85  0.91  125  227    1  102  103    1    1  102  K7U6J5     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   15 : K7TD77_MOUSE        0.84  0.92  118  227    1  114  114    1    4  114  K7TD77     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   16 : K7TGR2_MOUSE        0.84  0.92  118  227    1  111  112    2    3  111  K7TGR2     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   17 : K7TGZ2_MOUSE        0.84  0.90  118  227    1  109  111    2    3  109  K7TGZ2     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   18 : K7THF4_MOUSE        0.84  0.92  124  227    1  107  108    2    5  107  K7THF4     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   19 : K7U5I4_MOUSE        0.84  0.91  118  227    1  108  110    2    2  108  K7U5I4     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   20 : KV5A3_MOUSE 1QBL    0.84  0.94    1   95   21  115   95    0    0  115  P01635     Ig kappa chain V-V region K2 (Fragment) OS=Mus musculus PE=1 SV=1
   21 : A0N7J2_9MURI3VRL    0.83  0.91  110  232    1  121  123    2    2  219  A0N7J2     Mc5 VHCH1 (Fragment) OS=Mus sp. GN=Mc5 VHCH1 PE=1 SV=1
   22 : A2NPL2_MOUSE        0.83  0.92  110  227    3  121  119    1    1  121  A2NPL2     QY1.5 Vh (Fragment) OS=Mus musculus PE=2 SV=1
   23 : K7T999_MOUSE        0.83  0.88  118  227    1  110  110    0    0  110  K7T999     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   24 : K7T9U6_MOUSE        0.83  0.94  116  227    1  112  113    2    2  112  K7T9U6     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   25 : K7TD00_MOUSE        0.83  0.87  118  227    1  109  110    1    1  109  K7TD00     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   26 : K7TDA3_MOUSE        0.83  0.92  118  227    1  108  111    2    4  108  K7TDA3     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   27 : K7TGW8_MOUSE        0.83  0.92  118  227    1  110  112    2    4  110  K7TGW8     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   28 : K7TRQ8_MOUSE        0.83  0.90  118  227    1  111  112    2    3  111  K7TRQ8     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   29 : K7U6I4_MOUSE        0.83  0.94  118  227    1  110  111    2    2  110  K7U6I4     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   30 : B5UB70_MOUSE        0.82  0.92  110  227    1  116  118    1    2  116  B5UB70     EP3-31 heavy chain variable region (Fragment) OS=Mus musculus GN=EP3-31VH PE=2 SV=1
   31 : K7TD11_MOUSE        0.82  0.89  118  227    1  110  111    2    2  110  K7TD11     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   32 : K7TD38_MOUSE        0.82  0.90  118  227    1  108  110    2    2  108  K7TD38     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   33 : K7TGY7_MOUSE        0.82  0.89  118  227    1  111  112    2    3  111  K7TGY7     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   34 : K7TR59_MOUSE        0.82  0.89  118  227    1  110  112    2    4  110  K7TR59     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   35 : K7U5H8_MOUSE        0.82  0.89  118  227    1  109  111    2    3  109  K7U5H8     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   36 : K7U634_MOUSE        0.82  0.88  118  227    1  111  111    1    1  111  K7U634     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   37 : Q920E6_MOUSE1JGL    0.82  0.93    1  108    1  107  108    1    1  109  Q920E6     Pterin-mimicking anti-idiotope kappa chain variable region (Fragment) OS=Mus musculus PE=4 SV=1
   38 : Q920E7_MOUSE        0.82  0.91  110  227    1  119  119    1    1  119  Q920E7     Pterin-mimicking anti-idiotope heavy chain variable region (Fragment) OS=Mus musculus PE=4 SV=1
   39 : A2NVW0_MOUSE        0.81  0.90  118  216    1  102  102    1    3  102  A2NVW0     Heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   40 : A2NW56_MOUSE        0.81  0.92    1  108    1  107  108    1    1  107  A2NW56     E8 variable light chain (Fragment) OS=Mus musculus PE=2 SV=1
   41 : K7T918_MOUSE        0.81  0.91  118  227    1  112  112    2    2  112  K7T918     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   42 : K7T935_MOUSE        0.81  0.91  118  227    1  108  110    2    2  108  K7T935     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   43 : K7TD05_MOUSE        0.81  0.89  118  227    1  109  111    2    3  109  K7TD05     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   44 : K7TD49_MOUSE        0.81  0.91  118  227    1  111  112    2    3  111  K7TD49     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   45 : K7TH81_MOUSE        0.81  0.93  118  227    1  111  112    2    3  111  K7TH81     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   46 : K7TRF6_MOUSE        0.81  0.88  118  227    1  111  113    2    5  111  K7TRF6     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   47 : K7TRH0_MOUSE        0.81  0.86  118  227    1  114  114    2    4  114  K7TRH0     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   48 : K7TRJ8_MOUSE        0.81  0.89  118  227    1  113  114    2    5  113  K7TRJ8     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   49 : K7U5Y3_MOUSE        0.81  0.90  118  227    1  108  110    1    2  108  K7U5Y3     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   50 : K7U6F6_MOUSE        0.81  0.89  118  227    1  113  113    1    3  113  K7U6F6     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   51 : A2NV20_MOUSE        0.80  0.87  110  227   20  138  119    1    1  138  A2NV20     Precursor polypeptide (AA -19 to 119) (480 is 1st base in codon) (Precursor) OS=Mus musculus GN=Ighv5-9 PE=2 SV=1
   52 : K7T958_MOUSE        0.80  0.91  118  227    1  111  112    2    3  111  K7T958     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   53 : K7T9K7_MOUSE        0.80  0.90  119  227    1  110  111    2    3  110  K7T9K7     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   54 : K7TGQ7_MOUSE        0.80  0.88  118  227    1  110  112    2    4  110  K7TGQ7     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   55 : K7U5Q9_MOUSE        0.80  0.91  118  227    1  111  112    2    3  111  K7U5Q9     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   56 : Q6KB05_MOUSE1MVU    0.80  0.91  110  228    1  122  122    2    3  255  Q6KB05     ScFv B8E5 protein (Fragment) OS=Mus musculus GN=scFv B8E5 PE=1 SV=1
   57 : B5UB66_MOUSE        0.79  0.89  110  227    1  121  122    2    5  121  B5UB66     EP3-1 heavy chain variable region (Fragment) OS=Mus musculus GN=EP3-1VH PE=2 SV=1
   58 : K7TD63_MOUSE        0.79  0.88  118  227    1  110  110    0    0  110  K7TD63     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   59 : K7TDE9_MOUSE        0.79  0.86  118  227    1  112  112    2    2  112  K7TDE9     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   60 : K7TDP8_MOUSE        0.79  0.90  118  227    1  111  112    2    3  111  K7TDP8     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   61 : K7TDT7_MOUSE        0.79  0.88  118  227    1  112  112    1    2  112  K7TDT7     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   62 : K7TRP7_MOUSE        0.79  0.84  125  227    1  106  106    1    3  106  K7TRP7     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   63 : K7TRN5_MOUSE        0.78  0.86  118  227    1  114  114    2    4  114  K7TRN5     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   64 : Q5F2I8_MOUSE        0.78  0.86  110  226    1  119  120    2    4  119  Q5F2I8     Gamma heavy chain variable region (Fragment) OS=Mus musculus GN=IgG1 TS1 VH PE=2 SV=1
   65 : K7T9L3_MOUSE        0.77  0.85  118  227    1  115  115    2    5  115  K7T9L3     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   66 : K7TDM9_MOUSE        0.77  0.90  118  227    1  111  111    1    1  111  K7TDM9     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   67 : K7TGS1_MOUSE        0.77  0.89  118  227    1  111  111    1    1  111  K7TGS1     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   68 : K7TH90_MOUSE        0.77  0.84  118  227    1  115  115    2    5  115  K7TH90     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   69 : K7TRU7_MOUSE        0.77  0.84  118  227    1  114  114    2    4  114  K7TRU7     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   70 : K7U686_MOUSE        0.77  0.84  118  227    1  115  115    2    5  115  K7U686     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   71 : U5JE77_MOUSE        0.77  0.85  115  228    2  118  118    2    5  118  U5JE77     Immmunoglobulin heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   72 : D3ZHM9_RAT          0.76  0.89    1   90   21  110   90    0    0  115  D3ZHM9     Uncharacterized protein OS=Rattus norvegicus PE=4 SV=2
   73 : K7T9R4_MOUSE        0.76  0.86  128  227    1  104  106    2    8  104  K7T9R4     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   74 : K7TDL3_MOUSE        0.76  0.83  118  227    1  115  115    2    5  115  K7TDL3     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   75 : A0N7D2_9MURI        0.75  0.84  110  228    1  121  122    2    4  123  A0N7D2     SD6 Fab heavy chain variable region (Fragment) OS=Mus sp. GN=Ig1 PE=4 SV=1
   76 : K7TRB1_MOUSE        0.75  0.88  118  227    1  111  112    2    3  111  K7TRB1     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   77 : HVM16_MOUSE 4KVC    0.74  0.87  110  227   17  136  121    2    4  136  P01783     Ig heavy chain V region MOPC 21 (Fragment) OS=Mus musculus PE=1 SV=1
   78 : K7T9H4_MOUSE        0.74  0.88  118  227    1  111  112    2    3  111  K7T9H4     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   79 : K7T9L8_MOUSE        0.74  0.81  118  227    1  115  116    2    7  115  K7T9L8     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   80 : K7TDG3_MOUSE        0.74  0.87  118  227    1  111  112    2    3  111  K7TDG3     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   81 : K7TGX7_MOUSE        0.74  0.87  118  227    1  114  115    2    6  114  K7TGX7     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   82 : K7TRG8_MOUSE        0.74  0.86  118  227    1  111  112    2    3  111  K7TRG8     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   83 : K7U664_MOUSE        0.74  0.87  118  227    1  107  110    2    3  107  K7U664     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   84 : Q0ZCH4_HUMAN        0.74  0.88  111  227    2  117  117    1    1  117  Q0ZCH4     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
   85 : A2KBB9_HUMAN        0.73  0.89  110  228    1  117  119    1    2  238  A2KBB9     Anti-(ED-B) scFV (Fragment) OS=Homo sapiens PE=2 SV=1
   86 : F8SQR6_RAT          0.73  0.84  110  227    2  117  118    1    2  117  F8SQR6     Immunglobulin heavy chain variable region (Fragment) OS=Rattus norvegicus PE=2 SV=1
   87 : K7THD1_MOUSE        0.73  0.88  118  227    1  111  111    1    1  111  K7THD1     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   88 : M0R816_RAT          0.73  0.90    1   93   21  113   93    0    0  115  M0R816     Uncharacterized protein OS=Rattus norvegicus PE=4 SV=1
   89 : A2KBC1_HUMAN        0.72  0.89  110  228    1  117  119    1    2  236  A2KBC1     Anti-(ED-B) scFV (Fragment) OS=Homo sapiens PE=2 SV=2
   90 : K7T9F1_MOUSE        0.72  0.86  118  227    1  112  112    2    2  112  K7T9F1     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   91 : K7TH31_MOUSE        0.72  0.84  118  227    1  112  112    1    2  112  K7TH31     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   92 : K7U6B4_MOUSE        0.72  0.85  118  227    1  114  116    2    8  114  K7U6B4     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
   93 : Q0ZCG6_HUMAN        0.72  0.86  111  227    3  118  117    1    1  118  Q0ZCG6     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
   94 : Q0ZCH9_HUMAN        0.72  0.87  110  227    1  121  121    2    3  121  Q0ZCH9     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
   95 : Q0ZCJ0_HUMAN        0.72  0.85  111  227    3  125  123    1    6  125  Q0ZCJ0     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
   96 : Q0ZCJ2_HUMAN        0.72  0.85  111  227    2  124  123    1    6  124  Q0ZCJ2     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
   97 : A2KUC3_HUMAN        0.71  0.86  110  227    1  121  122    2    5  121  A2KUC3     UGa8H (Fragment) OS=Homo sapiens GN=IGHV PE=4 SV=1
   98 : A2NUT3_HUMAN        0.71  0.87  110  228   20  145  126    2    7  161  A2NUT3     Mu-chain (AA -19 to 142) (Precursor) OS=Homo sapiens PE=2 SV=1
   99 : F7A323_MACMU        0.71  0.88    1   90   23  112   90    0    0  112  F7A323     Uncharacterized protein OS=Macaca mulatta PE=4 SV=1
  100 : F7HD15_MACMU        0.71  0.86    1   96    1   96   96    0    0   97  F7HD15     Uncharacterized protein (Fragment) OS=Macaca mulatta PE=4 SV=1
  101 : G1PYM4_MYOLU        0.71  0.84  110  218   20  122  109    2    6  122  G1PYM4     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
  102 : K7T9P9_MOUSE        0.71  0.86  118  227    1  111  112    2    3  111  K7T9P9     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  103 : Q0ZCH7_HUMAN        0.71  0.85  111  227    2  117  119    2    5  117  Q0ZCH7     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  104 : Q0ZCI8_HUMAN        0.71  0.85  111  227    2  124  123    1    6  124  Q0ZCI8     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  105 : Q9HCC1_HUMAN1T2J    0.71  0.86  110  223    1  112  114    2    2  112  Q9HCC1     Single chain Fv (Fragment) OS=Homo sapiens PE=1 SV=1
  106 : F1LYU3_RAT          0.70  0.82  110  216    2  104  107    1    4  113  F1LYU3     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=2
  107 : F1M0H4_RAT          0.70  0.82  110  218    2  109  109    1    1  118  F1M0H4     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=2
  108 : F6SD32_MACMU        0.70  0.88    1   90   10   99   90    0    0   99  F6SD32     Uncharacterized protein OS=Macaca mulatta GN=IGKV1-5 PE=4 SV=1
  109 : F7BMY9_MACMU        0.70  0.87    1   90   23  112   90    0    0  117  F7BMY9     Uncharacterized protein OS=Macaca mulatta GN=IGKV1D-17 PE=4 SV=1
  110 : F7H2U1_MACMU        0.70  0.86    1   90   22  111   90    0    0  116  F7H2U1     Uncharacterized protein OS=Macaca mulatta PE=4 SV=1
  111 : F7H2U3_MACMU        0.70  0.86    1   90   24  113   90    0    0  113  F7H2U3     Uncharacterized protein OS=Macaca mulatta PE=4 SV=1
  112 : K7T9F6_MOUSE        0.70  0.84  118  227    1  116  116    1    6  116  K7T9F6     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  113 : K7TDL7_MOUSE        0.70  0.87  118  227    1  111  112    2    3  111  K7TDL7     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  114 : K7TH23_MOUSE        0.70  0.83  118  227    1  111  112    2    3  111  K7TH23     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  115 : Q0ZCG7_HUMAN        0.70  0.82  111  227    3  121  120    2    4  121  Q0ZCG7     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  116 : Q0ZCJ5_HUMAN        0.70  0.84  111  227    3  121  119    2    2  121  Q0ZCJ5     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  117 : Q9UL90_HUMAN        0.70  0.85  110  227    1  113  118    1    5  113  Q9UL90     Myosin-reactive immunoglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  118 : Q9UL93_HUMAN        0.70  0.85  111  227    1  116  117    1    1  116  Q9UL93     Myosin-reactive immunoglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  119 : A2JA14_HUMAN        0.69  0.81  110  226    1  124  124    2    7  124  A2JA14     Anti-mucin1 heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  120 : F7I2T2_CALJA        0.69  0.83  110  218   20  122  109    2    6  123  F7I2T2     Uncharacterized protein OS=Callithrix jacchus PE=4 SV=1
  121 : G1QD73_MYOLU        0.69  0.84  110  221    1  112  113    2    2  118  G1QD73     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  122 : G3IMZ2_CRIGR        0.69  0.89    1   89   21  109   89    0    0  109  G3IMZ2     Putative uncharacterized protein OS=Cricetulus griseus GN=I79_025299 PE=4 SV=1
  123 : H2RAG8_PANTR        0.69  0.89    1   94   21  114   94    0    0  115  H2RAG8     Uncharacterized protein OS=Pan troglodytes PE=4 SV=1
  124 : H2RAG9_PANTR        0.69  0.88    2   90    1   89   89    0    0   96  H2RAG9     Uncharacterized protein (Fragment) OS=Pan troglodytes GN=IGKV1D-43 PE=4 SV=1
  125 : H9KXI1_CALJA        0.69  0.83  110  220   20  136  118    2    8  136  H9KXI1     Uncharacterized protein OS=Callithrix jacchus PE=4 SV=1
  126 : HVM38_MOUSE 3U0W    0.69  0.81  110  227    1  118  118    0    0  119  P01808     Ig heavy chain V region T601 OS=Mus musculus PE=1 SV=1
  127 : K7THB6_MOUSE        0.69  0.81  118  227    1  111  113    2    5  111  K7THB6     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  128 : K9J494_DESRO        0.69  0.82  110  227   37  157  124    2    9  171  K9J494     Putative secreted protein (Fragment) OS=Desmodus rotundus PE=2 SV=1
  129 : Q0ZCG4_HUMAN        0.69  0.81  111  227    3  122  121    2    5  122  Q0ZCG4     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  130 : Q0ZCJ4_HUMAN        0.69  0.82  111  224    3  120  121    2   10  120  Q0ZCJ4     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  131 : Q96SA9_HUMAN        0.69  0.86    1  108    1  106  108    1    2  107  Q96SA9     Anti-streptococcal/anti-myosin immunoglobulin kappa light chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  132 : Q9UL70_HUMAN        0.69  0.82    1  108    1  107  108    1    1  108  Q9UL70     Myosin-reactive immunoglobulin light chain variable region (Fragment) OS=Homo sapiens PE=1 SV=1
  133 : Q9UL91_HUMAN        0.69  0.83  110  226    1  117  120    2    6  118  Q9UL91     Myosin-reactive immunoglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  134 : A2NYV3_HUMAN        0.68  0.86    4  108    2  105  105    1    1  105  A2NYV3     Light chain Fab (Fragment) OS=Homo sapiens PE=2 SV=1
  135 : F1LZY6_RAT          0.68  0.82    1  107    1  107  107    0    0  108  F1LZY6     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=1
  136 : F7HD13_MACMU        0.68  0.87    1   92    1   92   92    0    0   92  F7HD13     Uncharacterized protein (Fragment) OS=Macaca mulatta GN=IGKV1D-13 PE=4 SV=1
  137 : G1QD65_MYOLU        0.68  0.83  110  219    1  106  111    2    6  119  G1QD65     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  138 : G3S4V4_GORGO        0.68  0.88    1   94   23  116   94    0    0  116  G3S4V4     Uncharacterized protein OS=Gorilla gorilla gorilla PE=4 SV=1
  139 : H2P5I1_PONAB        0.68  0.86    1   96   23  118   96    0    0  118  H2P5I1     Uncharacterized protein OS=Pongo abelii GN=LOC100939563 PE=4 SV=1
  140 : H9KX34_CALJA        0.68  0.85  110  218   20  121  109    3    7  121  H9KX34     Uncharacterized protein OS=Callithrix jacchus GN=LOC100391495 PE=4 SV=1
  141 : HV320_HUMAN         0.68  0.82  110  227    1  116  118    1    2  116  P01781     Ig heavy chain V-III region GAL OS=Homo sapiens PE=1 SV=1
  142 : HVM37_MOUSE         0.68  0.81  110  227    1  118  118    0    0  119  P01807     Ig heavy chain V region X44 OS=Mus musculus PE=1 SV=1
  143 : HVM39_MOUSE         0.68  0.80  110  227    1  117  118    1    1  118  P01809     Ig heavy chain V region X24 OS=Mus musculus PE=1 SV=1
  144 : K7T952_MOUSE        0.68  0.85  118  227    1  112  114    3    6  112  K7T952     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  145 : K7TDP0_MOUSE        0.68  0.82  118  227    1  111  114    2    7  111  K7TDP0     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  146 : K7TGZ8_MOUSE        0.68  0.84  118  227    1  110  114    3    8  110  K7TGZ8     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  147 : K7U5W1_MOUSE        0.68  0.82  118  227    1  109  111    2    3  109  K7U5W1     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  148 : KV108_HUMAN 1F6L    0.68  0.85    1  108    1  107  108    1    1  108  P01600     Ig kappa chain V-I region Hau OS=Homo sapiens PE=1 SV=1
  149 : Q0ZCG5_HUMAN        0.68  0.81  111  227    3  122  121    2    5  122  Q0ZCG5     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  150 : Q0ZCG9_HUMAN3EYO    0.68  0.82  111  227    3  121  120    2    4  121  Q0ZCG9     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=1 SV=1
  151 : Q0ZCH1_HUMAN        0.68  0.83  111  227    2  118  118    2    2  118  Q0ZCH1     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  152 : Q0ZCH5_HUMAN        0.68  0.82  111  227    3  119  118    2    2  119  Q0ZCH5     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  153 : Q0ZCH8_HUMAN        0.68  0.81  111  224    1  113  116    2    5  113  Q0ZCH8     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  154 : Q2VR03_MOUSE        0.68  0.84  110  227    1  123  124    3    7  123  Q2VR03     Anti-lipoteichoic acid heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  155 : Q2VT24_MOUSE        0.68  0.84  110  227    1  124  125    3    8  124  Q2VT24     Anti-lipoteichoic acid heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  156 : Q9UL72_HUMAN        0.68  0.83  110  227    1  118  120    3    4  118  Q9UL72     Myosin-reactive immunoglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  157 : S6BAP0_HUMAN        0.68  0.83  110  232   20  141  124    2    3  229  S6BAP0     IgG H chain OS=Homo sapiens PE=2 SV=1
  158 : A0N8J1_HUMAN        0.67  0.83    1   90    5   94   90    0    0   99  A0N8J1     V(k)3 sequence of NG9 gene from fetal liver DNA (Precursor) OS=Homo sapiens PE=4 SV=1
  159 : A2IPI4_HUMAN        0.67  0.85    1  108    3  109  108    1    1  113  A2IPI4     HRV Fab 025-VL (Fragment) OS=Homo sapiens PE=2 SV=1
  160 : A2JA16_HUMAN        0.67  0.84    1  108    1  107  108    1    1  107  A2JA16     Anti-mucin1 light chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  161 : A2N192_HUMAN        0.67  0.81  110  228   18  142  125    1    6  151  A2N192     Immunglobulin heavy chain (Precursor) OS=Homo sapiens GN=IGH@ PE=2 SV=1
  162 : G1PZF7_MYOLU        0.67  0.81  110  221    1  118  119    3    8  123  G1PZF7     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  163 : G7PN14_MACFA        0.67  0.86    1   96    1   96   96    0    0   97  G7PN14     Putative uncharacterized protein (Fragment) OS=Macaca fascicularis GN=EGM_05145 PE=4 SV=1
  164 : G7PN21_MACFA        0.67  0.84    2   90   24  112   89    0    0  117  G7PN21     Putative uncharacterized protein (Fragment) OS=Macaca fascicularis GN=EGM_05152 PE=4 SV=1
  165 : G8F1B7_MACMU        0.67  0.85    1   89   23  111   89    0    0  111  G8F1B7     Putative uncharacterized protein (Fragment) OS=Macaca mulatta GN=EGK_21166 PE=4 SV=1
  166 : H0X5X8_OTOGA        0.67  0.87    1   90    3   92   90    0    0  110  H0X5X8     Uncharacterized protein (Fragment) OS=Otolemur garnettii PE=4 SV=1
  167 : H0XIX5_OTOGA        0.67  0.88    2   90   22  110   89    0    0  115  H0XIX5     Uncharacterized protein OS=Otolemur garnettii PE=4 SV=1
  168 : HVM40_MOUSE 2FBJ    0.67  0.81  110  227    1  118  118    0    0  119  P01810     Ig heavy chain V region J539 OS=Mus musculus PE=1 SV=1
  169 : HVM42_MOUSE         0.67  0.81  110  227    1  117  118    1    1  117  P01812     Ig heavy chain V region MOPC 173 OS=Mus musculus PE=1 SV=1
  170 : Q0ZCH0_HUMAN        0.67  0.83  111  227    2  119  121    2    7  119  Q0ZCH0     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  171 : Q0ZCI1_HUMAN        0.67  0.86  111  227    2  118  118    2    2  118  Q0ZCI1     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  172 : Q0ZCI3_HUMAN        0.67  0.80  111  227    3  124  122    2    5  124  Q0ZCI3     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  173 : Q0ZCI6_HUMAN        0.67  0.80  111  227    3  122  122    2    7  122  Q0ZCI6     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  174 : Q0ZCI9_HUMAN3EYQ    0.67  0.79  110  227    1  126  126    2    8  126  Q0ZCI9     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=1 SV=1
  175 : Q2VT26_MOUSE        0.67  0.83  110  227    1  123  124    3    7  123  Q2VT26     Anti-lipoteichoic acid heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  176 : Q9UL71_HUMAN        0.67  0.83  110  227    1  121  121    1    3  121  Q9UL71     Myosin-reactive immunoglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=1 SV=1
  177 : Q9UL77_HUMAN2BX5    0.67  0.85    1  108    1  107  108    1    1  108  Q9UL77     Myosin-reactive immunoglobulin light chain variable region (Fragment) OS=Homo sapiens PE=1 SV=1
  178 : A0N5T8_9MURI        0.66  0.82  110  227    1  125  125    2    7  125  A0N5T8     Anti-hepatitis B virus core antigen MoAb C1-5 heavy chain variable region (Fragment) OS=Mus sp. GN=Ig VH PE=2 SV=1
  179 : A2JA18_HUMAN        0.66  0.80  110  227    1  117  118    1    1  117  A2JA18     Anti-mucin1 heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  180 : F6RBD0_MACMU        0.66  0.84    1   89   23  111   89    0    0  111  F6RBD0     Uncharacterized protein OS=Macaca mulatta PE=4 SV=1
  181 : F6VFU7_MACMU        0.66  0.84    1   92   23  114   92    0    0  114  F6VFU7     Uncharacterized protein OS=Macaca mulatta PE=4 SV=1
  182 : F7A2M2_MACMU        0.66  0.83    1   96    1   96   96    0    0   97  F7A2M2     Uncharacterized protein (Fragment) OS=Macaca mulatta PE=4 SV=1
  183 : F7C890_MACMU        0.66  0.84    1   90   23  112   90    0    0  117  F7C890     Uncharacterized protein OS=Macaca mulatta PE=4 SV=1
  184 : G1Q5Q0_MYOLU        0.66  0.75  110  227   20  122  118    2   15  122  G1Q5Q0     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
  185 : G3S8U8_GORGO        0.66  0.84    1   96   23  118   96    0    0  118  G3S8U8     Uncharacterized protein OS=Gorilla gorilla gorilla PE=4 SV=1
  186 : G7NAZ1_MACMU        0.66  0.84    1   96    1   96   96    0    0   97  G7NAZ1     Putative uncharacterized protein (Fragment) OS=Macaca mulatta GN=EGK_05701 PE=4 SV=1
  187 : G7PN17_MACFA        0.66  0.84    1   96   23  118   96    0    0  118  G7PN17     Putative uncharacterized protein (Fragment) OS=Macaca fascicularis GN=EGM_05148 PE=4 SV=1
  188 : G8F1J9_MACMU        0.66  0.84    1   90   23  112   90    0    0  112  G8F1J9     Putative uncharacterized protein (Fragment) OS=Macaca mulatta GN=EGK_21315 PE=4 SV=1
  189 : H0V8W1_CAVPO        0.66  0.84    1   91    1   91   91    0    0  108  H0V8W1     Uncharacterized protein (Fragment) OS=Cavia porcellus PE=4 SV=1
  190 : H2R6N5_PANTR        0.66  0.83    1   90   13  101   90    1    1  106  H2R6N5     Uncharacterized protein (Fragment) OS=Pan troglodytes GN=IGKV1-27 PE=4 SV=1
  191 : H9KXH8_CALJA        0.66  0.81  110  227    1  113  119    2    7  113  H9KXH8     Uncharacterized protein (Fragment) OS=Callithrix jacchus PE=4 SV=1
  192 : HV02_CANFA          0.66  0.75  110  227    1  117  123    3   11  117  P01785     Ig heavy chain V region MOO OS=Canis familiaris PE=1 SV=1
  193 : K7TDT3_MOUSE        0.66  0.82  119  227    1  109  110    2    2  109  K7TDT3     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  194 : K7TR23_MOUSE        0.66  0.80  118  227    1  111  113    2    5  111  K7TR23     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  195 : K9J492_DESRO        0.66  0.78  110  227   14  134  124    2    9  148  K9J492     Putative secreted protein (Fragment) OS=Desmodus rotundus PE=2 SV=1
  196 : Q0ZCF2_HUMAN        0.66  0.83  111  227    3  122  120    2    3  122  Q0ZCF2     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  197 : Q0ZCF9_HUMAN        0.66  0.78  111  227    1  118  123    2   11  118  Q0ZCF9     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  198 : Q0ZCI5_HUMAN        0.66  0.77  111  227    3  121  122    2    8  121  Q0ZCI5     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  199 : Q0ZCJ3_HUMAN        0.66  0.80  111  227    2  118  122    2   10  118  Q0ZCJ3     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  200 : Q2VT28_MOUSE        0.66  0.83  110  227    1  123  124    3    7  123  Q2VT28     Anti-lipoteichoic acid heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  201 : A0N5G1_HUMAN        0.65  0.85    1  108    1  107  108    1    1  116  A0N5G1     Rheumatoid factor C6 light chain (Fragment) OS=Homo sapiens GN=V1 PE=2 SV=1
  202 : A2IPI6_HUMAN        0.65  0.83    1  108    3  109  108    1    1  113  A2IPI6     HRV Fab 027-VL (Fragment) OS=Homo sapiens PE=2 SV=1
  203 : A2JA19_HUMAN        0.65  0.81    1  108    1  107  108    1    1  107  A2JA19     Anti-mucin1 light chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  204 : A2KD66_LAMGL        0.65  0.80  110  227    1  114  118    3    4  114  A2KD66     R9 protein (Fragment) OS=Lama glama GN=r9 PE=4 SV=1
  205 : A2MYE1_HUMAN        0.65  0.83    1   96    1   96   96    0    0   96  A2MYE1     A30 (Fragment) OS=Homo sapiens PE=4 SV=1
  206 : A2NMA2_MOUSE        0.65  0.79  110  227    1  117  120    3    5  117  A2NMA2     Anti-carcinoma embryonic antigen heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  207 : A2NYQ9_HUMAN        0.65  0.87  110  227    1  120  120    1    2  120  A2NYQ9     Anti-folate binding protein (Fragment) OS=Homo sapiens GN=HuVH8B VH PE=2 SV=1
  208 : A2NZ55_HUMAN        0.65  0.83  110  228    1  124  127    2   11  131  A2NZ55     Variable immnoglobulin anti-estradiol heavy chain (Fragment) OS=Homo sapiens PE=2 SV=1
  209 : F6V876_MACMU        0.65  0.84    1   95   23  117   95    0    0  117  F6V876     Uncharacterized protein OS=Macaca mulatta PE=4 SV=1
  210 : F7CUV4_MACMU        0.65  0.82    1   96    1   96   96    0    0   97  F7CUV4     Uncharacterized protein (Fragment) OS=Macaca mulatta PE=4 SV=1
  211 : F7HD11_MACMU        0.65  0.86    1   96    1   96   96    0    0   97  F7HD11     Uncharacterized protein (Fragment) OS=Macaca mulatta PE=4 SV=1
  212 : G1PZY6_MYOLU        0.65  0.78  110  219    1  115  116    2    7  122  G1PZY6     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  213 : G1Q803_MYOLU        0.65  0.81  110  227    1  117  120    3    5  117  G1Q803     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  214 : G3QD17_GORGO        0.65  0.83    1   99    1   99   99    0    0  100  G3QD17     Uncharacterized protein (Fragment) OS=Gorilla gorilla gorilla PE=4 SV=1
  215 : G3S3W8_GORGO        0.65  0.79  110  217   20  136  117    2    9  136  G3S3W8     Uncharacterized protein OS=Gorilla gorilla gorilla PE=4 SV=1
  216 : G3S5I9_GORGO        0.65  0.83    2  104    1  103  103    0    0  108  G3S5I9     Uncharacterized protein (Fragment) OS=Gorilla gorilla gorilla GN=101126705 PE=4 SV=1
  217 : H9KWV4_CALJA        0.65  0.80  110  220    1  116  117    2    7  123  H9KWV4     Uncharacterized protein (Fragment) OS=Callithrix jacchus PE=4 SV=1
  218 : H9KXD5_CALJA        0.65  0.80  110  218    1  114  115    2    7  120  H9KXD5     Uncharacterized protein (Fragment) OS=Callithrix jacchus PE=4 SV=1
  219 : HVM35_MOUSE         0.65  0.83  115  227    1  111  115    3    6  111  P01804     Ig heavy chain V-III region HPC76 (Fragment) OS=Mus musculus PE=4 SV=1
  220 : HVM41_MOUSE 1UZ8    0.65  0.80  110  227    1  117  119    2    3  117  P01811     Ig heavy chain V region UPC10 OS=Mus musculus PE=1 SV=1
  221 : K7T9G9_MOUSE        0.65  0.77  118  227    1  111  113    2    5  111  K7T9G9     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  222 : K7TRS8_MOUSE        0.65  0.81  118  227    1  112  113    3    4  112  K7TRS8     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  223 : K7U6K0_MOUSE        0.65  0.80  118  227    1  110  113    2    6  110  K7U6K0     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  224 : KV103_HUMAN         0.65  0.83    1  108    1  107  108    1    1  108  P01595     Ig kappa chain V-I region Bi OS=Homo sapiens PE=1 SV=1
  225 : KV110_HUMAN         0.65  0.87    1   93   23  115   93    0    0  117  P01602     Ig kappa chain V-I region HK102 (Fragment) OS=Homo sapiens GN=IGKV1-5 PE=4 SV=1
  226 : KV122_HUMAN         0.65  0.85    1  108    1  107  108    1    1  108  P04430     Ig kappa chain V-I region BAN OS=Homo sapiens PE=1 SV=1
  227 : KV123_HUMAN 3UPA    0.65  0.83    1  108   23  129  108    1    1  129  P04431     Ig kappa chain V-I region Walker OS=Homo sapiens PE=1 SV=1
  228 : M0R709_RAT          0.65  0.78  110  225    1  111  116    1    5  118  M0R709     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=1
  229 : M0R789_RAT          0.65  0.84    1   96    1   96   96    0    0   97  M0R789     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=1
  230 : Q0ZCF5_HUMAN        0.65  0.83  111  227    3  122  120    2    3  122  Q0ZCF5     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  231 : Q0ZCG0_HUMAN        0.65  0.78  111  227    1  118  123    2   11  118  Q0ZCG0     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  232 : Q0ZCI4_HUMAN        0.65  0.79  111  227    3  125  126    2   12  125  Q0ZCI4     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  233 : Q0ZCJ6_HUMAN        0.65  0.80  111  227    3  125  123    2    6  125  Q0ZCJ6     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=1 SV=1
  234 : Q9UL79_HUMAN        0.65  0.81    1  108    1  107  108    1    1  108  Q9UL79     Myosin-reactive immunoglobulin light chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  235 : Q9Y509_HUMAN        0.65  0.80  110  228    1  127  127    2    8  147  Q9Y509     VH3 protein (Fragment) OS=Homo sapiens GN=VH3 PE=1 SV=1
  236 : R9W154_LAMGL        0.65  0.77  110  227    1  121  124    2    9  121  R9W154     Anti-F4+ETEC bacteria VHH variable region (Fragment) OS=Lama glama PE=2 SV=1
  237 : R9W3F6_LAMGL        0.65  0.77  110  227    1  121  124    2    9  121  R9W3F6     Anti-F4+ETEC bacteria VHH variable region (Fragment) OS=Lama glama PE=2 SV=1
  238 : A2IPI0_HUMAN        0.64  0.85    1  108    3  109  108    1    1  113  A2IPI0     HRV Fab N6-VL (Fragment) OS=Homo sapiens PE=2 SV=1
  239 : A2JA17_HUMAN        0.64  0.78  110  227    1  117  118    1    1  117  A2JA17     Anti-mucin1 heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  240 : A2KD54_LAMGL        0.64  0.77  110  227    1  120  121    2    4  120  A2KD54     Hi6 protein (Fragment) OS=Lama glama GN=hi6 PE=4 SV=1
  241 : A2KD56_LAMGL        0.64  0.80  110  227    1  118  121    2    6  118  A2KD56     Hi15 protein (Fragment) OS=Lama glama GN=hi15 PE=4 SV=1
  242 : A2MYE2_HUMAN        0.64  0.83    1   96    1   96   96    0    0   96  A2MYE2     A30 protein (Fragment) OS=Homo sapiens GN=A30 PE=4 SV=1
  243 : A2NI60_HUMAN2Q1E    0.64  0.85    1  108    1  107  108    1    1  108  A2NI60     BRE (Fragment) OS=Homo sapiens PE=1 SV=1
  244 : A2NKM6_HUMAN        0.64  0.82  113  228    1  116  119    2    6  121  A2NKM6     NANUC-1 heavy chain (Fragment) OS=Homo sapiens PE=2 SV=1
  245 : B1N7B6_HUMAN        0.64  0.80  110  227    1  120  122    2    6  120  B1N7B6     Cryocrystalglobulin CC1 heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  246 : B5UB71_MOUSE        0.64  0.81    1  108    1  107  108    1    1  109  B5UB71     EP3-31 light chain variable region (Fragment) OS=Mus musculus GN=EP3-31VL PE=2 SV=1
  247 : F6UNC0_MACMU        0.64  0.85    1   95   21  115   95    0    0  115  F6UNC0     Uncharacterized protein OS=Macaca mulatta PE=4 SV=1
  248 : F7A8H2_MACMU        0.64  0.80    2   96    1   95   95    0    0  109  F7A8H2     Uncharacterized protein (Fragment) OS=Macaca mulatta GN=IGKV1-27 PE=4 SV=1
  249 : G1FM85_HUMAN        0.64  0.78  110  227    1  129  129    2   11  129  G1FM85     Anti-Influenza A hemagglutinin heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  250 : G1Q8U3_MYOLU        0.64  0.74  110  224   20  140  124    3   12  142  G1Q8U3     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
  251 : G1QDJ7_MYOLU        0.64  0.80  110  224    1  112  118    2    9  120  G1QDJ7     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  252 : H9H4H5_MACMU        0.64  0.84    1   96    1   96   96    0    0   97  H9H4H5     Uncharacterized protein (Fragment) OS=Macaca mulatta PE=4 SV=1
  253 : HV01_CANFA          0.64  0.81  110  227    1  114  118    2    4  114  P01784     Ig heavy chain V region GOM OS=Canis familiaris PE=1 SV=1
  254 : HV307_HUMAN         0.64  0.81  110  227    1  122  122    1    4  122  P01768     Ig heavy chain V-III region CAM OS=Homo sapiens PE=1 SV=1
  255 : HV310_HUMAN         0.64  0.80  110  227    1  121  122    2    5  121  P01771     Ig heavy chain V-III region HIL OS=Homo sapiens PE=1 SV=1
  256 : HVM30_MOUSE         0.64  0.81  110  225    1  113  118    3    7  113  P01799     Ig heavy chain V-III region ABE-47N OS=Mus musculus PE=1 SV=1
  257 : I3MN52_SPETR        0.64  0.85    1   89   21  109   89    0    0  109  I3MN52     Uncharacterized protein OS=Spermophilus tridecemlineatus PE=4 SV=1
  258 : I3MYZ9_SPETR        0.64  0.83    1   90    1   90   90    0    0  108  I3MYZ9     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  259 : I3NEG3_SPETR        0.64  0.80    1   92    1   92   92    0    0  107  I3NEG3     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  260 : K7TD58_MOUSE        0.64  0.80  118  227    1  111  113    3    5  111  K7TD58     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  261 : K7TDR2_MOUSE        0.64  0.82  117  227    1  111  114    3    6  111  K7TDR2     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  262 : K7TR54_MOUSE        0.64  0.81  118  227    1  112  113    3    4  112  K7TR54     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  263 : K7U5S0_MOUSE        0.64  0.81  118  227    1  112  113    3    4  112  K7U5S0     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  264 : K9IQU5_DESRO        0.64  0.84  110  227   36  153  122    2    8  166  K9IQU5     Putative secreted protein (Fragment) OS=Desmodus rotundus PE=2 SV=1
  265 : KV104_HUMAN         0.64  0.87    1   90    1   90   90    0    0  107  P01596     Ig kappa chain V-I region CAR OS=Homo sapiens PE=1 SV=1
  266 : KV109_HUMAN         0.64  0.81    1   95   23  117   95    0    0  117  P01601     Ig kappa chain V-I region HK101 (Fragment) OS=Homo sapiens PE=4 SV=1
  267 : KV112_HUMAN         0.64  0.83    1  108    1  107  108    1    1  108  P01604     Ig kappa chain V-I region Kue OS=Homo sapiens PE=1 SV=1
  268 : KV118_HUMAN         0.64  0.82    1  108    1  107  108    1    1  108  P01610     Ig kappa chain V-I region WEA OS=Homo sapiens PE=1 SV=1
  269 : KV119_HUMAN         0.64  0.86    1  108    1  107  108    1    1  108  P01611     Ig kappa chain V-I region Wes OS=Homo sapiens PE=1 SV=1
  270 : A2KD53_LAMGL        0.63  0.80  110  227    1  117  120    2    5  117  A2KD53     H14 protein (Fragment) OS=Lama glama GN=h14 PE=4 SV=1
  271 : A2KD61_LAMGL        0.63  0.78  110  227    1  115  118    2    3  115  A2KD61     R4 protein (Fragment) OS=Lama glama GN=r4 PE=4 SV=1
  272 : A2MY60_MOUSE        0.63  0.81    1  108    1  107  108    1    1  107  A2MY60     Kappa (Fragment) OS=Mus musculus GN=kappa PE=2 SV=1
  273 : A2MYC7_9MURI        0.63  0.81    1  108    1  107  108    1    1  107  A2MYC7     MA-15 light chain (Fragment) OS=Mus sp. PE=2 SV=1
  274 : G1FM92_HUMAN        0.63  0.78  110  227    1  129  129    2   11  129  G1FM92     Anti-Influenza A hemagglutinin heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  275 : G1FM93_HUMAN        0.63  0.77  110  227    1  129  129    2   11  129  G1FM93     Anti-Influenza A hemagglutinin heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  276 : G1Q0I1_MYOLU        0.63  0.78  110  228    1  117  120    3    4  118  G1Q0I1     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  277 : G1Q1S8_MYOLU        0.63  0.79  110  228    1  118  121    4    5  119  G1Q1S8     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  278 : G1Q5C3_MYOLU        0.63  0.76  110  231    1  104  122    2   18  128  G1Q5C3     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  279 : G1QC73_MYOLU        0.63  0.78  110  224    1  124  125    3   11  127  G1QC73     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  280 : G1QE02_MYOLU        0.63  0.76  110  226   20  138  123    3   10  139  G1QE02     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
  281 : G1SAA2_NOMLE        0.63  0.83    1   89    1   89   89    0    0   89  G1SAA2     Uncharacterized protein (Fragment) OS=Nomascus leucogenys GN=IGKV1OR2-108 PE=4 SV=1
  282 : G1TPF8_RABIT        0.63  0.82    1   91    1   91   91    0    0  108  G1TPF8     Uncharacterized protein (Fragment) OS=Oryctolagus cuniculus PE=4 SV=1
  283 : G3RRY1_GORGO        0.63  0.80    2  104    4  106  103    0    0  112  G3RRY1     Uncharacterized protein (Fragment) OS=Gorilla gorilla gorilla PE=4 SV=1
  284 : G3U3S5_LOXAF        0.63  0.81    1   95   30  124   95    0    0  124  G3U3S5     Uncharacterized protein (Fragment) OS=Loxodonta africana PE=4 SV=1
  285 : G7PMP4_MACFA        0.63  0.81    1  108   23  124  108    1    6  125  G7PMP4     Putative uncharacterized protein OS=Macaca fascicularis GN=EGM_05004 PE=4 SV=1
  286 : G8F1K1_MACMU        0.63  0.80    1  108   23  124  108    1    6  125  G8F1K1     Putative uncharacterized protein OS=Macaca mulatta GN=EGK_21317 PE=4 SV=1
  287 : G8F1X3_MACMU        0.63  0.83    1   95   23  117   95    0    0  117  G8F1X3     Putative uncharacterized protein (Fragment) OS=Macaca mulatta GN=EGK_21523 PE=4 SV=1
  288 : H0XRL1_OTOGA        0.63  0.84    1   90    1   90   90    0    0  103  H0XRL1     Uncharacterized protein (Fragment) OS=Otolemur garnettii PE=4 SV=1
  289 : H0XSM5_OTOGA        0.63  0.82    1   91   21  111   91    0    0  117  H0XSM5     Uncharacterized protein OS=Otolemur garnettii PE=4 SV=1
  290 : H2P5H6_PONAB        0.63  0.83    2   95    2   95   94    0    0   97  H2P5H6     Uncharacterized protein (Fragment) OS=Pongo abelii GN=IGKV1OR2-108 PE=4 SV=1
  291 : H2R7U4_PANTR        0.63  0.87    1   90   13  102   90    0    0  107  H2R7U4     Uncharacterized protein (Fragment) OS=Pan troglodytes PE=4 SV=1
  292 : H9H465_MACMU        0.63  0.81  110  227    1  120  121    2    4  120  H9H465     Uncharacterized protein (Fragment) OS=Macaca mulatta PE=4 SV=1
  293 : HV302_HUMAN         0.63  0.83  110  227    1  114  118    2    4  114  P01763     Ig heavy chain V-III region WEA OS=Homo sapiens PE=1 SV=1
  294 : HV305_HUMAN         0.63  0.78  110  222    1  120  121    2    9  120  P01766     Ig heavy chain V-III region BRO OS=Homo sapiens PE=1 SV=1
  295 : HVM27_MOUSE         0.63  0.81  110  225    1  113  118    3    7  113  P01796     Ig heavy chain V-III region A4 OS=Mus musculus PE=1 SV=1
  296 : HVM31_MOUSE         0.63  0.81  110  225    1  113  118    3    7  113  P01800     Ig heavy chain V-III region T957 OS=Mus musculus PE=1 SV=2
  297 : I3N035_SPETR        0.63  0.86    1   90    1   90   90    0    0  107  I3N035     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  298 : I6U3W1_STRCA        0.63  0.81  111  227    2  122  121    2    4  122  I6U3W1     Immunonoglobulin heavy chain variable region (Fragment) OS=Struthio camelus PE=2 SV=1
  299 : K7TRH7_MOUSE        0.63  0.79  118  227    1  112  114    3    6  112  K7TRH7     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  300 : KV105_HUMAN         0.63  0.85    2   94    2   94   93    0    0  108  P01597     Ig kappa chain V-I region DEE OS=Homo sapiens PE=1 SV=1
  301 : KV125_HUMAN 1WTL    0.63  0.86    1  108    1  107  108    1    1  108  P80362     Ig kappa chain V-I region WAT OS=Homo sapiens PE=1 SV=1
  302 : Q9UL84_HUMAN        0.63  0.79  110  227    1  122  124    2    8  122  Q9UL84     Myosin-reactive immunoglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=1 SV=1
  303 : A0N5G2_HUMAN        0.62  0.79  117  232    1  119  119    1    3  119  A0N5G2     Rheumatoid factor C6 heavy chain (Fragment) OS=Homo sapiens GN=VH3 PE=2 SV=1
  304 : A0N5G7_HUMAN        0.62  0.77  117  232    1  119  122    2    9  119  A0N5G7     Rheumatoid factor D5 heavy chain (Fragment) OS=Homo sapiens GN=VH3 PE=2 SV=1
  305 : A2J1C8_MOUSE        0.62  0.81  110  227    1  117  120    3    5  117  A2J1C8     McAB 0.1C3 mmunoglobulin heavy chain (Fragment) OS=Mus musculus PE=2 SV=1
  306 : A2NYV1_HUMAN        0.62  0.77  110  227    1  128  128    2   10  128  A2NYV1     Heavy chain Fab (Fragment) OS=Homo sapiens PE=2 SV=1
  307 : B6EDE2_HUMAN        0.62  0.79  111  227    2  123  122    2    5  123  B6EDE2     Epididymis luminal protein 180 (Fragment) OS=Homo sapiens GN=HEL180 PE=2 SV=1
  308 : F6SD50_MACMU        0.62  0.82    1  104    1  104  104    0    0  108  F6SD50     Uncharacterized protein (Fragment) OS=Macaca mulatta PE=4 SV=1
  309 : G1PYM1_MYOLU        0.62  0.76  110  224    1  115  121    4   12  121  G1PYM1     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  310 : G1Q381_MYOLU        0.62  0.77  110  229   23  146  126    2    8  154  G1Q381     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  311 : G1Q4P7_MYOLU        0.62  0.76  113  221    1  116  118    2   11  121  G1Q4P7     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  312 : G1Q676_MYOLU        0.62  0.78  113  229    4  112  119    4   12  122  G1Q676     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  313 : G1Q696_MYOLU        0.62  0.79  110  224    1  114  118    2    7  117  G1Q696     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  314 : G1Q6G1_MYOLU        0.62  0.80  110  228    1  117  120    3    4  118  G1Q6G1     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  315 : G1QBP2_MYOLU        0.62  0.76  110  229    1  120  125    3   10  130  G1QBP2     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  316 : G1QCW0_MYOLU        0.62  0.75  110  228   23  148  128    3   11  157  G1QCW0     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  317 : G3SGB1_GORGO        0.62  0.84    1   90    1   90   90    0    0  107  G3SGB1     Uncharacterized protein (Fragment) OS=Gorilla gorilla gorilla PE=4 SV=1
  318 : H0V3H6_CAVPO        0.62  0.80    1  104    1  104  104    0    0  108  H0V3H6     Uncharacterized protein (Fragment) OS=Cavia porcellus PE=4 SV=1
  319 : H0X319_OTOGA        0.62  0.85    2   95   22  115   94    0    0  115  H0X319     Uncharacterized protein OS=Otolemur garnettii PE=4 SV=1
  320 : H9H365_MACMU        0.62  0.78  110  226    1  112  121    2   13  113  H9H365     Uncharacterized protein (Fragment) OS=Macaca mulatta PE=4 SV=1
  321 : H9H4W4_MACMU        0.62  0.83    1   95   23  117   95    0    0  117  H9H4W4     Uncharacterized protein OS=Macaca mulatta PE=4 SV=1
  322 : HV304_HUMAN         0.62  0.79  110  227    1  115  121    3    9  115  P01765     Ig heavy chain V-III region TIL OS=Homo sapiens PE=1 SV=1
  323 : HVM25_MOUSE         0.62  0.77  110  227    1  123  123    3    5  123  P01794     Ig heavy chain V region HPCG14 OS=Mus musculus PE=1 SV=1
  324 : HVM28_MOUSE         0.62  0.81  110  225    1  113  118    3    7  113  P01797     Ig heavy chain V-III region U61 OS=Mus musculus PE=1 SV=1
  325 : HVM32_MOUSE 1SM3    0.62  0.82  110  227    1  115  120    3    7  115  P01801     Ig heavy chain V-III region J606 OS=Mus musculus PE=1 SV=1
  326 : HVM33_MOUSE         0.62  0.82  110  227    1  115  120    3    7  115  P01802     Ig heavy chain V-III region W3082 OS=Mus musculus PE=1 SV=1
  327 : I6U3W7_STRCA        0.62  0.80  111  227    2  123  123    2    7  123  I6U3W7     Immunonoglobulin heavy chain variable region (Fragment) OS=Struthio camelus PE=2 SV=1
  328 : K7U672_MOUSE        0.62  0.79  118  227    1  112  114    3    6  112  K7U672     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  329 : KV101_HUMAN         0.62  0.82    1  108    1  107  108    1    1  108  P01593     Ig kappa chain V-I region AG OS=Homo sapiens PE=1 SV=1
  330 : KV102_HUMAN 1QP1    0.62  0.84    1  108    1  107  108    1    1  108  P01594     Ig kappa chain V-I region AU OS=Homo sapiens PE=1 SV=1
  331 : KV115_HUMAN 1REI    0.62  0.83    1  107    1  106  107    1    1  108  P01607     Ig kappa chain V-I region Rei OS=Homo sapiens PE=1 SV=1
  332 : KV117_HUMAN         0.62  0.83    1  108    1  107  108    1    1  108  P01609     Ig kappa chain V-I region Scw OS=Homo sapiens PE=1 SV=1
  333 : KV124_HUMAN         0.62  0.83    1  108   23  129  108    1    1  129  P04432     Ig kappa chain V-I region Daudi OS=Homo sapiens PE=4 SV=1
  334 : Q0ZCI0_HUMAN        0.62  0.80  111  227    2  122  121    2    4  122  Q0ZCI0     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=1 SV=1
  335 : A2NXP8_HUMAN        0.61  0.82  110  227    1  123  123    2    5  123  A2NXP8     Heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  336 : F1STC3_PIG          0.61  0.86    2   95   22  115   94    0    0  115  F1STC3     Uncharacterized protein OS=Sus scrofa GN=LOC100736924 PE=4 SV=2
  337 : F7GWP3_MACMU        0.61  0.79    1  107   23  122  107    1    7  142  F7GWP3     Uncharacterized protein OS=Macaca mulatta GN=IGKV1-5 PE=4 SV=1
  338 : G1PYQ8_MYOLU        0.61  0.81  110  226    1  117  120    2    6  118  G1PYQ8     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  339 : G1Q5X1_MYOLU        0.61  0.77  110  230    1  112  124    3   15  118  G1Q5X1     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  340 : G1Q914_MYOLU        0.61  0.72  110  226   20  138  125    4   14  139  G1Q914     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
  341 : G1QCV9_MYOLU        0.61  0.76  110  224    1  116  121    4   11  119  G1QCV9     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  342 : G1QE90_MYOLU        0.61  0.80  110  228    1  118  121    4    5  119  G1QE90     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  343 : G1TW85_RABIT        0.61  0.86    4   93    7   96   90    0    0   96  G1TW85     Uncharacterized protein (Fragment) OS=Oryctolagus cuniculus PE=4 SV=1
  344 : G3IKK1_CRIGR        0.61  0.83    1  107   21  121  107    1    6  123  G3IKK1     Putative uncharacterized protein OS=Cricetulus griseus GN=I79_024404 PE=4 SV=1
  345 : G3RMG7_GORGO        0.61  0.81    2  102    4  104  101    0    0  113  G3RMG7     Uncharacterized protein (Fragment) OS=Gorilla gorilla gorilla PE=4 SV=1
  346 : G3VAS4_SARHA        0.61  0.82    2   90    2   90   89    0    0  110  G3VAS4     Uncharacterized protein (Fragment) OS=Sarcophilus harrisii PE=4 SV=1
  347 : G7NAZ4_MACMU        0.61  0.82    1  104    1  104  104    0    0  108  G7NAZ4     Putative uncharacterized protein (Fragment) OS=Macaca mulatta GN=EGK_05707 PE=4 SV=1
  348 : G7PMP5_MACFA        0.61  0.80    1  108   23  124  108    1    6  125  G7PMP5     Putative uncharacterized protein OS=Macaca fascicularis GN=EGM_05005 PE=4 SV=1
  349 : G7PN12_MACFA        0.61  0.83    1   95   23  117   95    0    0  117  G7PN12     Putative uncharacterized protein (Fragment) OS=Macaca fascicularis GN=EGM_05143 PE=4 SV=1
  350 : G8F1B6_MACMU        0.61  0.80    1  108   23  124  108    1    6  125  G8F1B6     Putative uncharacterized protein OS=Macaca mulatta GN=EGK_21164 PE=4 SV=1
  351 : H2P5I2_PONAB        0.61  0.80    1  108   23  124  108    1    6  125  H2P5I2     Uncharacterized protein OS=Pongo abelii PE=4 SV=2
  352 : H2P756_PONAB        0.61  0.80    1   96   23  118   96    0    0  118  H2P756     Uncharacterized protein OS=Pongo abelii PE=4 SV=1
  353 : H9H4B2_MACMU        0.61  0.78    1  106   20  119  106    1    6  120  H9H4B2     Uncharacterized protein (Fragment) OS=Macaca mulatta PE=4 SV=1
  354 : HV306_HUMAN         0.61  0.80  110  227    1  115  122    3   11  115  P01767     Ig heavy chain V-III region BUT OS=Homo sapiens PE=1 SV=1
  355 : HVM18_MOUSE         0.61  0.76  110  227    1  123  123    2    5  123  P01787     Ig heavy chain V regions TEPC 15/S107/HPCM1/HPCM2/HPCM3 OS=Mus musculus PE=1 SV=1
  356 : HVM19_MOUSE         0.61  0.76  110  227    1  123  123    2    5  123  P01788     Ig heavy chain V region H8 OS=Mus musculus PE=1 SV=1
  357 : HVM20_MOUSE 1MCP    0.61  0.75  110  227    1  122  124    3    8  122  P01789     Ig heavy chain V region M603 OS=Mus musculus PE=1 SV=1
  358 : HVM21_MOUSE         0.61  0.77  110  227    1  122  122    2    4  122  P01790     Ig heavy chain V region M511 OS=Mus musculus PE=1 SV=1
  359 : HVM23_MOUSE         0.61  0.76  110  227    1  123  123    2    5  123  P01792     Ig heavy chain V region HPCG8 OS=Mus musculus PE=1 SV=1
  360 : HVM24_MOUSE         0.61  0.76  110  227    1  123  123    2    5  123  P01793     Ig heavy chain V region HPCG13 OS=Mus musculus PE=1 SV=1
  361 : HVR01_RAT           0.61  0.77  110  227   20  142  123    3    5  142  P01805     Ig heavy chain V region IR2 OS=Rattus norvegicus PE=4 SV=1
  362 : K7ETL4_PONAB        0.61  0.81    1  108   23  124  108    1    6  133  K7ETL4     Uncharacterized protein OS=Pongo abelii PE=4 SV=1
  363 : K7ETN1_PONAB        0.61  0.80    1  108   23  124  108    1    6  125  K7ETN1     Uncharacterized protein OS=Pongo abelii GN=IGKV1-27 PE=4 SV=1
  364 : K7EVP5_PONAB        0.61  0.81    1  108   23  124  108    1    6  133  K7EVP5     Uncharacterized protein OS=Pongo abelii PE=4 SV=1
  365 : K7U669_MOUSE        0.61  0.79  118  227    1  114  117    3   10  114  K7U669     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  366 : KV07_RABIT          0.61  0.84    2   89    2   89   88    0    0  108  P01688     Ig kappa chain V region K-25 OS=Oryctolagus cuniculus PE=1 SV=1
  367 : KV106_HUMAN         0.61  0.84    1  108    1  107  108    1    1  108  P01598     Ig kappa chain V-I region EU OS=Homo sapiens PE=1 SV=1
  368 : KV107_HUMAN         0.61  0.81    1  108    1  107  108    1    1  108  P01599     Ig kappa chain V-I region Gal OS=Homo sapiens PE=1 SV=1
  369 : KV113_HUMAN         0.61  0.81    1  108    1  107  108    1    1  108  P01605     Ig kappa chain V-I region Lay OS=Homo sapiens PE=1 SV=1
  370 : KV116_HUMAN         0.61  0.86    1  108    1  107  108    1    1  108  P01608     Ig kappa chain V-I region Roy OS=Homo sapiens PE=1 SV=1
  371 : KV5A5_MOUSE         0.61  0.79    1  108   21  127  108    1    1  128  P01637     Ig kappa chain V-V region T1 OS=Mus musculus PE=4 SV=1
  372 : Q0ZCF6_HUMAN        0.61  0.76  111  227    3  129  127    2   10  129  Q0ZCF6     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  373 : Q8K1F1_MOUSE        0.61  0.79    1  108    1  108  109    2    2  114  Q8K1F1     Anti-VIPase light chain variable region (Fragment) OS=Mus musculus PE=4 SV=1
  374 : S4R394_HUMAN        0.61  0.83    1   96   21  116   96    0    0  116  S4R394     Uncharacterized protein (Fragment) OS=Homo sapiens PE=4 SV=1
  375 : U5JE28_MOUSE        0.61  0.81   11  108    2   98   98    1    1  103  U5JE28     Immmunoglobulin light chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  376 : A0N6R0_9MURI        0.60  0.82    1  107    1  106  107    1    1  106  A0N6R0     Rheumatoid factor RF3-2C (Fragment) OS=Mus sp. GN=Ig V PE=2 SV=1
  377 : A2J1N6_HUMAN        0.60  0.75  113  229    1  115  122    3   12  115  A2J1N6     Rheumatoid factor RF-ET9 (Fragment) OS=Homo sapiens PE=2 SV=1
  378 : A2NKM7_HUMAN        0.60  0.74  114  228    1  132  132    1   17  133  A2NKM7     NANUC-2 heavy chain (Fragment) OS=Homo sapiens PE=2 SV=1
  379 : B1N7B7_HUMAN        0.60  0.78  110  227    1  121  124    2    9  121  B1N7B7     Cryocrystalglobulin CC2 heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  380 : G1FM90_HUMAN        0.60  0.76  110  227    1  129  129    2   11  129  G1FM90     Anti-Influenza A hemagglutinin heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  381 : G1PZL3_MYOLU        0.60  0.75  110  219    1  110  116    3   12  118  G1PZL3     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  382 : G1Q4Z9_MYOLU        0.60  0.73  111  219    1  117  122    2   18  125  G1Q4Z9     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
  383 : G1TVN7_RABIT        0.60  0.82    1   99   24  122   99    0    0  122  G1TVN7     Uncharacterized protein OS=Oryctolagus cuniculus PE=4 SV=1
  384 : G3IKD7_CRIGR        0.60  0.81    1  106   23  122  106    1    6  125  G3IKD7     Putative uncharacterized protein OS=Cricetulus griseus GN=I79_024338 PE=4 SV=1
  385 : G3RT85_GORGO        0.60  0.81    1  104    1  104  104    0    0  108  G3RT85     Uncharacterized protein (Fragment) OS=Gorilla gorilla gorilla GN=IGKV1OR2-108 PE=4 SV=1
  386 : G3RYF4_GORGO        0.60  0.78    1  106   23  122  106    1    6  123  G3RYF4     Uncharacterized protein OS=Gorilla gorilla gorilla PE=4 SV=1
  387 : G3SBG7_GORGO        0.60  0.79    1  108   21  127  108    1    1  127  G3SBG7     Uncharacterized protein (Fragment) OS=Gorilla gorilla gorilla PE=4 SV=1
  388 : G8F210_MACMU        0.60  0.78  110  227    1  121  122    3    5  121  G8F210     Putative uncharacterized protein (Fragment) OS=Macaca mulatta GN=EGK_21588 PE=4 SV=1
  389 : H0W3C0_CAVPO        0.60  0.84    1  104    1  104  104    0    0  109  H0W3C0     Uncharacterized protein (Fragment) OS=Cavia porcellus GN=LOC100730177 PE=4 SV=1
  390 : H0X621_OTOGA        0.60  0.79    2  101    1  100  100    0    0  100  H0X621     Uncharacterized protein (Fragment) OS=Otolemur garnettii PE=4 SV=1
  391 : H0XL64_OTOGA        0.60  0.77    1  108   21  127  108    1    1  127  H0XL64     Uncharacterized protein OS=Otolemur garnettii PE=4 SV=1
  392 : H9KXI7_CALJA        0.60  0.75  110  229    1  117  126    3   15  123  H9KXI7     Uncharacterized protein (Fragment) OS=Callithrix jacchus PE=4 SV=1
  393 : H9KYK3_CALJA        0.60  0.77  110  228    1  116  121    4    7  123  H9KYK3     Uncharacterized protein (Fragment) OS=Callithrix jacchus PE=4 SV=1
  394 : HV309_HUMAN         0.60  0.80  110  227    1  119  121    2    5  119  P01770     Ig heavy chain V-III region NIE OS=Homo sapiens PE=1 SV=1
  395 : HV311_HUMAN 2RCJ    0.60  0.78  110  227    1  126  127    2   10  126  P01772     Ig heavy chain V-III region KOL OS=Homo sapiens PE=1 SV=1
  396 : HV321_HUMAN         0.60  0.74  110  227    1  120  123    2    8  120  P01782     Ig heavy chain V-III region DOB OS=Homo sapiens PE=1 SV=1
  397 : HVM22_MOUSE         0.60  0.75  110  227    1  123  125    3    9  123  P01791     Ig heavy chain V region HPCM6 OS=Mus musculus PE=1 SV=1
  398 : HVM26_MOUSE         0.60  0.77  110  227   20  144  125    2    7  144  P01795     Ig heavy chain V region M167 OS=Mus musculus PE=1 SV=1
  399 : HVM29_MOUSE         0.60  0.81  110  225    1  113  118    3    7  113  P01798     Ig heavy chain V-III region E109 OS=Mus musculus PE=1 SV=1
  400 : I3NCK3_SPETR        0.60  0.72    1  104    1  104  104    0    0  108  I3NCK3     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  401 : I6UXR8_STRCA        0.60  0.77  111  227    2  123  126    3   13  123  I6UXR8     Immunonoglobulin heavy chain variable region (Fragment) OS=Struthio camelus PE=2 SV=1
  402 : KV114_HUMAN         0.60  0.81    1  108    1  107  108    1    1  108  P01606     Ig kappa chain V-I region OU OS=Homo sapiens PE=1 SV=1
  403 : KV5A6_MOUSE         0.60  0.78    1   95   21  115   95    0    0  115  P01638     Ig kappa chain V-V region L6 (Fragment) OS=Mus musculus PE=4 SV=1
  404 : M0R4B9_RAT          0.60  0.80    1  103   21  117  103    1    6  117  M0R4B9     Protein RGD1565252 OS=Rattus norvegicus GN=RGD1565252 PE=4 SV=1
  405 : M3X8N0_FELCA        0.60  0.77    1  103   23  119  103    1    6  119  M3X8N0     Uncharacterized protein OS=Felis catus PE=4 SV=1
  406 : Q0ZCI2_HUMAN        0.60  0.73  111  227    3  122  125    2   13  122  Q0ZCI2     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  407 : Q9UL78_HUMAN        0.60  0.82    1  108    1  108  109    2    2  109  Q9UL78     Myosin-reactive immunoglobulin light chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  408 : U5JE43_MOUSE        0.60  0.80  111  232    1  121  124    3    5  133  U5JE43     Immmunoglobulin heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  409 : A0N6Y3_9MURI2IBZ    0.59  0.84    1  108    1  107  108    1    1  107  A0N6Y3     F30C7 light chain variable region (Fragment) OS=Mus sp. GN=Ig VL PE=1 SV=1
  410 : A2IPH7_HUMAN        0.59  0.80  113  227    1  121  123    2   10  121  A2IPH7     HRV Fab 025-VH (Fragment) OS=Homo sapiens PE=2 SV=1
  411 : A2KD57_LAMGL2P49    0.59  0.75  110  227    1  132  132    1   14  132  A2KD57     Hi113 protein (Fragment) OS=Lama glama GN=hi113 PE=1 SV=1
  412 : A2KD59_LAMGL2X89    0.59  0.72  110  227    1  128  128    3   10  128  A2KD59     R2 protein (Fragment) OS=Lama glama GN=r2 PE=1 SV=1
  413 : A2KD67_LAMGL        0.59  0.72  110  227    1  128  129    3   12  128  A2KD67     R10 protein (Fragment) OS=Lama glama GN=r10 PE=4 SV=1
  414 : A2NVF0_MOUSE        0.59  0.81    1  108    1  107  108    1    1  108  A2NVF0     Immnuoglobulin kappa light chain (Fragment) OS=Mus musculus PE=4 SV=1
  415 : D2HUP7_AILME        0.59  0.78    1   96   23  118   96    0    0  118  D2HUP7     Putative uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca GN=PANDA_016015 PE=4 SV=1
  416 : D3ZXH4_RAT          0.59  0.82    1   98   21  117   98    1    1  117  D3ZXH4     Uncharacterized protein OS=Rattus norvegicus PE=4 SV=1
  417 : F1D882_MACMU        0.59  0.71  110  228   12  146  136    3   18  164  F1D882     Anti-quaternary epitope monoclonal antibody heavy chain (Fragment) OS=Macaca mulatta PE=2 SV=1
  418 : F6S1K7_MACMU        0.59  0.83    1   90    4   93   90    0    0   98  F6S1K7     Uncharacterized protein (Fragment) OS=Macaca mulatta PE=4 SV=1
  419 : F7B7J7_ORNAN        0.59  0.76  110  226    1  121  123    2    8  122  F7B7J7     Uncharacterized protein (Fragment) OS=Ornithorhynchus anatinus PE=4 SV=1
  420 : G3IL03_CRIGR        0.59  0.81    1  107   21  121  107    1    6  123  G3IL03     Putative uncharacterized protein OS=Cricetulus griseus GN=I79_024561 PE=4 SV=1
  421 : G3VM20_SARHA        0.59  0.75    2  105    1  103  104    1    1  107  G3VM20     Uncharacterized protein (Fragment) OS=Sarcophilus harrisii PE=4 SV=1
  422 : H2P764_PONAB        0.59  0.80    1  105   23  121  105    1    6  125  H2P764     Uncharacterized protein OS=Pongo abelii PE=4 SV=2
  423 : HV313_HUMAN         0.59  0.74  110  224    1  119  122    4   10  119  P01774     Ig heavy chain V-III region POM OS=Homo sapiens PE=1 SV=1
  424 : HVM17_MOUSE         0.59  0.75  110  227    1  117  120    3    5  117  P01786     Ig heavy chain V region MOPC 47A OS=Mus musculus PE=1 SV=1
  425 : HVM34_MOUSE         0.59  0.78  110  225    1  113  118    3    7  113  P01803     Ig heavy chain V region AMPC1 OS=Mus musculus PE=1 SV=1
  426 : I3N3H0_SPETR        0.59  0.81    1  104    1  104  104    0    0  109  I3N3H0     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  427 : I3N746_SPETR        0.59  0.74    1  104   21  124  104    0    0  129  I3N746     Uncharacterized protein OS=Spermophilus tridecemlineatus PE=4 SV=1
  428 : I6TTA4_STRCA        0.59  0.76  111  227    2  121  120    2    3  121  I6TTA4     Immunonoglobulin heavy chain variable region (Fragment) OS=Struthio camelus PE=2 SV=1
  429 : I6ULB2_STRCA        0.59  0.77  111  227    2  119  119    2    3  119  I6ULB2     Immunonoglobulin heavy chain variable region (Fragment) OS=Struthio camelus PE=2 SV=1
  430 : I6UVJ4_STRCA        0.59  0.78  111  227    2  124  124    3    8  124  I6UVJ4     Immunonoglobulin heavy chain variable region (Fragment) OS=Struthio camelus PE=2 SV=1
  431 : K7ETY1_PONAB        0.59  0.80    1  108   23  124  108    1    6  125  K7ETY1     Uncharacterized protein OS=Pongo abelii GN=LOC100939465 PE=4 SV=1
  432 : K7EVX7_PONAB        0.59  0.76    1  106   23  122  106    1    6  123  K7EVX7     Uncharacterized protein OS=Pongo abelii GN=LOC100939951 PE=4 SV=1
  433 : KV03_RABIT          0.59  0.77    1   93    2   94   93    0    0  109  P01684     Ig kappa chain V region 3374 OS=Oryctolagus cuniculus PE=1 SV=1
  434 : KV306_HUMAN         0.59  0.80    1  108    1  108  109    2    2  109  P01624     Ig kappa chain V-III region POM OS=Homo sapiens PE=1 SV=1
  435 : KV5AE_MOUSE 2VWE    0.59  0.81    1  108    1  107  108    1    1  108  P01647     Ig kappa chain V-V region HP 124E1 OS=Mus musculus PE=1 SV=1
  436 : L7N0K2_CANFA        0.59  0.75  110  225    1  116  124    3   16  121  L7N0K2     Uncharacterized protein (Fragment) OS=Canis familiaris PE=4 SV=1
  437 : L7N0L4_CANFA        0.59  0.74  110  224    1  131  131    2   16  134  L7N0L4     Uncharacterized protein (Fragment) OS=Canis familiaris PE=4 SV=1
  438 : M0R628_RAT          0.59  0.81    1  108    1  108  108    0    0  109  M0R628     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=1
  439 : R9VYW2_LAMGL        0.59  0.75  110  227    1  121  122    3    5  121  R9VYW2     Anti-F4+ETEC bacteria VHH variable region (Fragment) OS=Lama glama PE=2 SV=1
  440 : U5JE48_MOUSE        0.59  0.76    8  108    1  102  102    1    1  111  U5JE48     Immmunoglobulin light chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  441 : A0N586_9MURI        0.58  0.79    1  108   21  127  108    1    1  127  A0N586     Anti-CD4 mAb M-T151 variable region light chain (Fragment) OS=Mus sp. GN=Ig VL PE=2 SV=1
  442 : A2N2G5_HUMAN        0.58  0.72  110  227    1  135  135    3   17  135  A2N2G5     VH87-2 protein (Fragment) OS=Homo sapiens GN=VH87-2 PE=2 SV=1
  443 : A2NVE9_MOUSE        0.58  0.81    1  108    1  107  108    1    1  108  A2NVE9     Immnuoglobulin kappa light chain (Fragment) OS=Mus musculus PE=4 SV=1
  444 : F1D883_MACMU        0.58  0.71  110  228   12  146  136    3   18  164  F1D883     Anti-quaternary epitope monoclonal antibody heavy chain (Fragment) OS=Macaca mulatta PE=2 SV=1
  445 : F7GBH6_MONDO        0.58  0.75    2   95   22  123  102    1    8  123  F7GBH6     Uncharacterized protein OS=Monodelphis domestica GN=LOC100618001 PE=4 SV=2
  446 : G1FM91_HUMAN        0.58  0.74  110  227    1  129  131    2   15  129  G1FM91     Anti-Influenza A hemagglutinin heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  447 : G1Q6F4_MYOLU        0.58  0.71  114  228    1  134  134    2   19  135  G1Q6F4     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  448 : G1QAG0_MYOLU        0.58  0.72  110  221    1  127  127    2   15  133  G1QAG0     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  449 : G1QC76_MYOLU        0.58  0.70  110  231    1  128  134    5   18  136  G1QC76     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  450 : G3IL53_CRIGR        0.58  0.77   14  106   33  118   93    1    7  122  G3IL53     Putative uncharacterized protein OS=Cricetulus griseus GN=I79_024615 PE=4 SV=1
  451 : G8F154_MACMU        0.58  0.70  110  227   20  139  125    3   12  139  G8F154     Putative uncharacterized protein (Fragment) OS=Macaca mulatta GN=EGK_21347 PE=4 SV=1
  452 : G8F2P8_MACFA        0.58  0.76  110  227    1  120  124    2   10  120  G8F2P8     Putative uncharacterized protein (Fragment) OS=Macaca fascicularis GN=EGM_19491 PE=4 SV=1
  453 : H0VZM4_CAVPO        0.58  0.80    1  103   23  119  103    1    6  119  H0VZM4     Uncharacterized protein (Fragment) OS=Cavia porcellus PE=4 SV=1
  454 : H0XNP9_OTOGA        0.58  0.78    1  106    1  106  106    0    0  108  H0XNP9     Uncharacterized protein (Fragment) OS=Otolemur garnettii PE=4 SV=1
  455 : H9KVQ0_CALJA        0.58  0.69  110  232    1  122  130    3   15  125  H9KVQ0     Uncharacterized protein (Fragment) OS=Callithrix jacchus PE=4 SV=1
  456 : HV314_HUMAN         0.58  0.75  111  224    2  119  121    4   10  119  P01775     Ig heavy chain V-III region LAY OS=Homo sapiens PE=1 SV=1
  457 : HV315_HUMAN         0.58  0.78  110  224    1  117  118    4    4  117  P01776     Ig heavy chain V-III region WAS OS=Homo sapiens PE=1 SV=1
  458 : I3NAP6_SPETR        0.58  0.75    1  104    1  104  104    0    0  106  I3NAP6     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  459 : I6UXQ7_STRCA        0.58  0.81  111  227    2  124  124    2    8  124  I6UXQ7     Immunonoglobulin heavy chain variable region (Fragment) OS=Struthio camelus PE=2 SV=1
  460 : K7ET87_PONAB        0.58  0.77    1  108   23  124  108    1    6  125  K7ET87     Uncharacterized protein OS=Pongo abelii GN=IGKV1-5 PE=4 SV=1
  461 : K7EU93_PONAB        0.58  0.81    1  108   23  124  108    1    6  125  K7EU93     Uncharacterized protein OS=Pongo abelii PE=4 SV=1
  462 : K7EUX4_PONAB        0.58  0.79    1  108   23  124  108    1    6  131  K7EUX4     Uncharacterized protein OS=Pongo abelii GN=LOC100939897 PE=4 SV=1
  463 : KV120_HUMAN         0.58  0.81    1  108    1  108  108    0    0  109  P01612     Ig kappa chain V-I region Mev OS=Homo sapiens PE=1 SV=1
  464 : KV5AA_MOUSE         0.58  0.81    1  108    1  107  108    1    1  108  P01643     Ig kappa chain V-V region MOPC 173 OS=Mus musculus PE=1 SV=1
  465 : KV5AB_MOUSE 2ZJS    0.58  0.81    1  108    1  107  108    1    1  108  P01644     Ig kappa chain V-V region HP R16.7 OS=Mus musculus PE=1 SV=1
  466 : KV5AC_MOUSE 1A14    0.58  0.80    1  108    1  107  108    1    1  108  P01645     Ig kappa chain V-V region HP 93G7 OS=Mus musculus PE=1 SV=1
  467 : KV5AD_MOUSE 1DVF    0.58  0.81    1  108    1  107  108    1    1  108  P01646     Ig kappa chain V-V region HP 123E6 OS=Mus musculus PE=1 SV=1
  468 : KV5AF_MOUSE 1JFQ    0.58  0.81    1  108    1  107  108    1    1  108  P01648     Ig kappa chain V-V region HP 91A3 OS=Mus musculus PE=1 SV=1
  469 : L8B0X5_PIG          0.58  0.69  110  232   20  152  137    3   18  475  L8B0X5     IgG heavy chain OS=Sus scrofa GN=IGHG PE=2 SV=1
  470 : L9JM07_TUPCH        0.58  0.76    1  108   23  124  108    1    6  125  L9JM07     Ig kappa chain V-I region HK102 OS=Tupaia chinensis GN=TREES_T100021706 PE=4 SV=1
  471 : Q0ZCJ1_HUMAN        0.58  0.75  111  230    2  119  125    3   12  121  Q0ZCJ1     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  472 : Q9UL81_HUMAN        0.58  0.81    1  105    1  105  105    0    0  107  Q9UL81     Myosin-reactive immunoglobulin light chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  473 : Q9UL85_HUMAN        0.58  0.81    1  108    1  108  108    0    0  109  Q9UL85     Myosin-reactive immunoglobulin kappa chain variable region (Fragment) OS=Homo sapiens PE=1 SV=1
  474 : Q9UL88_HUMAN        0.58  0.72  110  227    1  131  134    3   19  131  Q9UL88     Myosin-reactive immunoglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  475 : A2IPW9_MOUSE        0.57  0.78    1  108   21  127  108    1    1  127  A2IPW9     Immnogloblin light chain variable region (Precursor) OS=Mus musculus GN=Igkv9-124 PE=2 SV=1
  476 : A2KD65_LAMGL        0.57  0.73  110  227    1  128  128    3   10  128  A2KD65     R8 protein (Fragment) OS=Lama glama GN=r8 PE=4 SV=1
  477 : F6XC02_ORNAN        0.57  0.73  110  229    1  114  123    4   12  124  F6XC02     Uncharacterized protein (Fragment) OS=Ornithorhynchus anatinus PE=4 SV=1
  478 : F7ASQ3_MONDO        0.57  0.72  110  217   20  137  123    2   20  158  F7ASQ3     Uncharacterized protein OS=Monodelphis domestica GN=LOC100619427 PE=4 SV=2
  479 : F7DQ70_MONDO        0.57  0.72  110  217   20  136  123    3   21  139  F7DQ70     Uncharacterized protein OS=Monodelphis domestica PE=4 SV=2
  480 : F7DSH4_MONDO        0.57  0.76  110  217   20  137  120    2   14  158  F7DSH4     Uncharacterized protein OS=Monodelphis domestica PE=4 SV=2
  481 : F7E8Z5_MONDO        0.57  0.71  110  217   20  137  123    2   20  138  F7E8Z5     Uncharacterized protein OS=Monodelphis domestica PE=4 SV=2
  482 : G1R7H1_NOMLE        0.57  0.77    1  108   23  124  108    1    6  125  G1R7H1     Uncharacterized protein OS=Nomascus leucogenys GN=IGKV1-27 PE=4 SV=2
  483 : G3IKK2_CRIGR        0.57  0.79    1  107   34  133  107    2    7  135  G3IKK2     Putative uncharacterized protein OS=Cricetulus griseus GN=I79_024405 PE=4 SV=1
  484 : G3U533_LOXAF        0.57  0.71  110  224    1  116  120    2    9  124  G3U533     Uncharacterized protein (Fragment) OS=Loxodonta africana GN=LOC100668942 PE=4 SV=1
  485 : G7P8Z5_MACFA        0.57  0.71  110  225   20  143  124    3    8  144  G7P8Z5     Putative uncharacterized protein (Fragment) OS=Macaca fascicularis GN=EGM_17028 PE=4 SV=1
  486 : H0XHT9_OTOGA        0.57  0.79    2  108    4  109  107    1    1  113  H0XHT9     Uncharacterized protein (Fragment) OS=Otolemur garnettii PE=4 SV=1
  487 : H0XU06_OTOGA        0.57  0.78    2  107    2  106  106    1    1  108  H0XU06     Uncharacterized protein (Fragment) OS=Otolemur garnettii PE=4 SV=1
  488 : H0Y1Y6_OTOGA        0.57  0.76    2  108    1  107  107    0    0  107  H0Y1Y6     Uncharacterized protein (Fragment) OS=Otolemur garnettii PE=4 SV=1
  489 : H2PUB0_PONAB        0.57  0.77    1  108   23  128  108    2    2  128  H2PUB0     Uncharacterized protein OS=Pongo abelii PE=4 SV=1
  490 : H9H2S9_MACMU        0.57  0.71  110  225   20  143  124    3    8  144  H9H2S9     Uncharacterized protein OS=Macaca mulatta GN=IGHV3-72 PE=4 SV=1
  491 : H9KW43_CALJA        0.57  0.74  110  228   20  142  128    3   14  165  H9KW43     Uncharacterized protein OS=Callithrix jacchus PE=4 SV=1
  492 : H9KWZ0_CALJA        0.57  0.71  110  230    1  116  130    4   23  121  H9KWZ0     Uncharacterized protein (Fragment) OS=Callithrix jacchus PE=4 SV=1
  493 : HV316_HUMAN         0.57  0.73  110  224    1  119  122    4   10  119  P01777     Ig heavy chain V-III region TEI OS=Homo sapiens PE=1 SV=1
  494 : HV318_HUMAN         0.57  0.75  110  224    1  116  120    4    9  116  P01779     Ig heavy chain V-III region TUR OS=Homo sapiens PE=1 SV=1
  495 : HV319_HUMAN         0.57  0.77  110  224    1  115  117    4    4  115  P01780     Ig heavy chain V-III region JON OS=Homo sapiens PE=1 SV=1
  496 : I3MTL7_SPETR        0.57  0.77    1  104    1  104  104    0    0  109  I3MTL7     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  497 : I3N872_SPETR        0.57  0.78    1  104    1  104  104    0    0  108  I3N872     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  498 : I6UXR3_STRCA        0.57  0.76  111  227    2  120  121    4    6  120  I6UXR3     Immunonoglobulin heavy chain variable region (Fragment) OS=Struthio camelus PE=2 SV=1
  499 : KV111_HUMAN         0.57  0.79    1  108    1  107  108    1    1  108  P01603     Ig kappa chain V-I region Ka OS=Homo sapiens PE=1 SV=1
  500 : KV302_HUMAN         0.57  0.81    1  108    1  108  109    2    2  109  P01620     Ig kappa chain V-III region SIE OS=Homo sapiens PE=1 SV=1
  501 : KV304_HUMAN         0.57  0.81    1  108    1  108  109    2    2  109  P01622     Ig kappa chain V-III region Ti OS=Homo sapiens PE=1 SV=1
  502 : KV311_HUMAN         0.57  0.81    1  108   21  127  108    1    1  128  P06311     Ig kappa chain V-III region IARC/BL41 OS=Homo sapiens PE=1 SV=1
  503 : KV312_HUMAN         0.57  0.78    1  108   21  128  109    2    2  129  P18135     Ig kappa chain V-III region HAH OS=Homo sapiens PE=2 SV=1
  504 : KV313_HUMAN         0.57  0.79    1  108   21  128  109    2    2  129  P18136     Ig kappa chain V-III region HIC OS=Homo sapiens PE=2 SV=2
  505 : KV5AM_MOUSE         0.57  0.76    1  108    1  107  108    1    1  108  P04946     Ig kappa chain V-V region NQ5-89.4 OS=Mus musculus PE=4 SV=1
  506 : L8B0S7_PIG          0.57  0.74  110  232   20  157  138    2   15  480  L8B0S7     IgG heavy chain OS=Sus scrofa GN=IGHG PE=2 SV=1
  507 : L9JML7_TUPCH        0.57  0.77    1  108   23  124  108    1    6  125  L9JML7     Ig kappa chain V-I region Walker OS=Tupaia chinensis GN=TREES_T100021705 PE=4 SV=1
  508 : Q2VT27_MOUSE        0.57  0.76    1  108    1  106  108    2    2  106  Q2VT27     Anti-lipoteichoic acid light chain variable region (Fragment) OS=Mus musculus GN=Igkv4-72 PE=2 SV=1
  509 : Q811C3_MOUSE        0.57  0.80    1  108   23  131  109    1    1  131  Q811C3     Imunoglobulin gamma-3 kappa chain (Precursor) OS=Mus musculus PE=2 SV=1
  510 : Q9JL76_MOUSE        0.57  0.74   11  108    1   97   98    1    1   97  Q9JL76     Anti-myosin immunoglobulin light chain variable region (Fragment) OS=Mus musculus GN=Igkv4-72 PE=2 SV=1
  511 : Q9UGP3_HUMAN        0.57  0.74  127  230    1  110  116    3   18  112  Q9UGP3     Immunoblobulin heavy chain (Fragment) OS=Homo sapiens GN=IgH PE=2 SV=1
  512 : Q9UL83_HUMAN        0.57  0.80    1  108    1  107  108    1    1  108  Q9UL83     Myosin-reactive immunoglobulin light chain variable region (Fragment) OS=Homo sapiens PE=1 SV=1
  513 : R9W2R6_LAMGL        0.57  0.75  110  227    1  121  122    3    5  121  R9W2R6     Anti-F4+ETEC bacteria VHH variable region (Fragment) OS=Lama glama PE=2 SV=1
  514 : A0N275_MOUSE        0.56  0.78    1  108   20  125  108    2    2  127  A0N275     Antigen, B-cell receptor (Precursor) OS=Mus musculus PE=4 SV=1
  515 : A2IPI2_HUMAN        0.56  0.78    1  108    3  111  109    1    1  115  A2IPI2     HRV Fab N27-VL (Fragment) OS=Homo sapiens PE=2 SV=1
  516 : A2IPI3_HUMAN        0.56  0.79    1  108    3  110  109    2    2  114  A2IPI3     HRV Fab N28-VL (Fragment) OS=Homo sapiens PE=2 SV=1
  517 : A2IPI5_HUMAN        0.56  0.80    1  108    3  109  108    1    1  113  A2IPI5     HRV Fab 026-VL (Fragment) OS=Homo sapiens PE=2 SV=1
  518 : A2KD62_LAMGL        0.56  0.70  110  227    1  128  131    3   16  128  A2KD62     R5 protein (Fragment) OS=Lama glama GN=r5 PE=4 SV=1
  519 : A2KD63_LAMGL        0.56  0.69  110  227    1  128  131    3   16  128  A2KD63     R6 protein (Fragment) OS=Lama glama GN=r6 PE=4 SV=1
  520 : A2KD64_LAMGL        0.56  0.70  110  227    1  128  131    3   16  128  A2KD64     R7 protein (Fragment) OS=Lama glama GN=r7 PE=4 SV=1
  521 : A2N1N1_MOUSE        0.56  0.78    1  108   20  132  114    2    7  134  A2N1N1     B cell antigen receptor (Precursor) OS=Mus musculus PE=4 SV=1
  522 : A2NB46_HUMAN        0.56  0.80    1  108    1  108  109    2    2  109  A2NB46     Cold agglutinin FS-2 L-chain (Fragment) OS=Homo sapiens PE=2 SV=1
  523 : A2NXP9_HUMAN        0.56  0.79    1  108    1  109  109    1    1  110  A2NXP9     K light chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  524 : B1N7B8_HUMAN        0.56  0.81    1  108    1  107  108    1    1  107  B1N7B8     Cryocrystalglobulin CC1 kappa light chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  525 : F6ZVQ0_ORNAN        0.56  0.72  110  229    1  112  123    5   14  122  F6ZVQ0     Uncharacterized protein (Fragment) OS=Ornithorhynchus anatinus PE=4 SV=1
  526 : F7ASP4_MONDO        0.56  0.69  110  217   20  136  123    3   21  161  F7ASP4     Uncharacterized protein OS=Monodelphis domestica GN=LOC100619427 PE=4 SV=2
  527 : F7DQ52_MONDO        0.56  0.71  110  217   20  137  123    2   20  158  F7DQ52     Uncharacterized protein OS=Monodelphis domestica PE=4 SV=2
  528 : G1FM86_HUMAN        0.56  0.75  110  227    1  129  131    2   15  129  G1FM86     Anti-Influenza A hemagglutinin heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  529 : G1LVU5_AILME        0.56  0.74    1  106   21  120  106    1    6  128  G1LVU5     Uncharacterized protein OS=Ailuropoda melanoleuca PE=4 SV=1
  530 : G1Q6A7_MYOLU        0.56  0.74  110  231   20  136  129    3   19  161  G1Q6A7     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
  531 : G1TJE1_RABIT        0.56  0.77    2  106   24  121  105    1    7  125  G1TJE1     Uncharacterized protein OS=Oryctolagus cuniculus GN=LOC100356529 PE=4 SV=2
  532 : G3UBV3_LOXAF        0.56  0.74    1   98    1   97   98    1    1   97  G3UBV3     Uncharacterized protein (Fragment) OS=Loxodonta africana PE=4 SV=1
  533 : G3UKA6_LOXAF        0.56  0.69  110  224    1  115  119    2    8  118  G3UKA6     Uncharacterized protein (Fragment) OS=Loxodonta africana GN=LOC100670927 PE=4 SV=1
  534 : G3VBJ5_SARHA        0.56  0.79    2  105   22  128  108    2    5  132  G3VBJ5     Uncharacterized protein OS=Sarcophilus harrisii PE=4 SV=1
  535 : H0XHX3_OTOGA        0.56  0.78    1  108    1  107  108    1    1  116  H0XHX3     Uncharacterized protein (Fragment) OS=Otolemur garnettii PE=4 SV=1
  536 : H0XX49_OTOGA        0.56  0.79    1  107    1  101  107    1    6  102  H0XX49     Uncharacterized protein (Fragment) OS=Otolemur garnettii PE=4 SV=1
  537 : H9H6T6_MONDO        0.56  0.70  110  217   20  137  123    2   20  145  H9H6T6     Uncharacterized protein OS=Monodelphis domestica GN=LOC100618709 PE=4 SV=2
  538 : H9H6T9_MONDO        0.56  0.70  110  217   20  137  123    2   20  156  H9H6T9     Uncharacterized protein OS=Monodelphis domestica GN=LOC100618912 PE=4 SV=2
  539 : H9KXD8_CALJA        0.56  0.77    1  107    1  107  107    0    0  109  H9KXD8     Uncharacterized protein (Fragment) OS=Callithrix jacchus GN=IGKV1D-42 PE=4 SV=1
  540 : HV317_HUMAN         0.56  0.74  110  224    1  116  119    4    7  116  P01778     Ig heavy chain V-III region ZAP OS=Homo sapiens PE=1 SV=1
  541 : I3LW75_SPETR        0.56  0.80    1  108    3  109  108    1    1  113  I3LW75     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  542 : I3MVU9_SPETR        0.56  0.77    1  104   21  124  104    0    0  129  I3MVU9     Uncharacterized protein OS=Spermophilus tridecemlineatus PE=4 SV=1
  543 : I3N7Z4_SPETR        0.56  0.74    1   98    1   99   99    1    1  105  I3N7Z4     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  544 : I3NC61_SPETR        0.56  0.78    1  108    1  102  108    1    6  110  I3NC61     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  545 : I6TTD2_STRCA        0.56  0.73  111  227    2  128  127    2   10  128  I6TTD2     Immunonoglobulin heavy chain variable region (Fragment) OS=Struthio camelus PE=2 SV=1
  546 : I6U3W4_STRCA        0.56  0.74  111  227    2  122  124    2   10  122  I6U3W4     Immunonoglobulin heavy chain variable region (Fragment) OS=Struthio camelus PE=2 SV=1
  547 : I6ULA6_STRCA        0.56  0.75  111  227    2  128  127    2   10  128  I6ULA6     Immunonoglobulin heavy chain variable region (Fragment) OS=Struthio camelus PE=2 SV=1
  548 : I6UVI9_STRCA        0.56  0.74  111  227    2  123  124    4    9  123  I6UVI9     Immunonoglobulin heavy chain variable region (Fragment) OS=Struthio camelus PE=2 SV=1
  549 : K7DYQ1_MONDO        0.56  0.70  110  217   20  137  123    2   20  141  K7DYQ1     Uncharacterized protein OS=Monodelphis domestica PE=4 SV=1
  550 : KV305_HUMAN         0.56  0.79    1  108    1  108  109    2    2  109  P01623     Ig kappa chain V-III region WOL OS=Homo sapiens PE=1 SV=1
  551 : KV307_HUMAN         0.56  0.78    1  108    1  108  109    2    2  109  P04206     Ig kappa chain V-III region GOL OS=Homo sapiens PE=1 SV=1
  552 : KV3AI_MOUSE         0.56  0.76    1  108    1  111  112    2    5  111  P01670     Ig kappa chain V-III region PC 6684 OS=Mus musculus PE=1 SV=1
  553 : KV3AK_MOUSE         0.56  0.75    1  108    1  111  112    2    5  111  P01672     Ig kappa chain V-III region PC 7940 OS=Mus musculus PE=1 SV=1
  554 : KV5A7_MOUSE         0.56  0.77    1  108   23  129  108    1    1  130  P01639     Ig kappa chain V-V region MOPC 41 OS=Mus musculus GN=Gm5571 PE=1 SV=1
  555 : KV5AG_MOUSE         0.56  0.80    1  108    1  107  108    1    1  108  P01649     Ig kappa chain V-V regions OS=Mus musculus PE=1 SV=1
  556 : KV5AH_MOUSE         0.56  0.76    1  108    1  107  108    1    1  108  P01650     Ig kappa chain V-V region UPC 61 OS=Mus musculus PE=1 SV=1
  557 : KV5AK_MOUSE         0.56  0.76    1  108    1  107  108    1    1  108  P01652     Ig kappa chain V-V region J606 OS=Mus musculus PE=1 SV=1
  558 : L9JML0_TUPCH        0.56  0.73    1  108   23  124  108    1    6  125  L9JML0     Ig kappa chain V-I region HK102 OS=Tupaia chinensis GN=TREES_T100021695 PE=4 SV=1
  559 : M0R8G6_RAT          0.56  0.76    1  103    1   97  103    1    6   97  M0R8G6     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=1
  560 : Q0ZCH6_HUMAN        0.56  0.72  111  227    2  131  133    3   19  131  Q0ZCH6     Immunglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=4 SV=1
  561 : Q2VR04_MOUSE        0.56  0.76    1  108    1  106  108    2    2  106  Q2VR04     Anti-lipoteichoic acid light chain variable region (Fragment) OS=Mus musculus GN=Igkv4-72 PE=2 SV=1
  562 : Q2VT29_MOUSE        0.56  0.74    1  108    1  106  108    2    2  106  Q2VT29     Anti-lipoteichoic acid light chain variable region (Fragment) OS=Mus musculus GN=Igkv4-72 PE=2 SV=1
  563 : Q5R3X1_MOUSE1MOE    0.56  0.73  116  228    1  114  115    2    3  114  Q5R3X1     V(H) region of G5 Bb 2.2 (Fragment) OS=Mus musculus PE=1 SV=1
  564 : Q6N094_HUMAN        0.56  0.69  110  232   20  155  139    2   19  480  Q6N094     Putative uncharacterized protein DKFZp686O01196 OS=Homo sapiens GN=DKFZp686O01196 PE=1 SV=1
  565 : Q8K1F0_MOUSE        0.56  0.73    1  108    1  106  108    2    2  112  Q8K1F0     Anti-VIPase light chain variable region (Fragment) OS=Mus musculus PE=4 SV=1
  566 : Q8VDD0_MOUSE        0.56  0.77    1  108   23  128  108    2    2  134  Q8VDD0     Anti-MOG Z12 variable light chain (Fragment) OS=Mus musculus GN=Igkv4-70 PE=2 SV=1
  567 : Q920E9_MOUSE        0.56  0.76    1  108    1  111  112    2    5  111  Q920E9     Pterin-mimicking anti-idiotope kappa chain variable region (Fragment) OS=Mus musculus PE=4 SV=1
  568 : Q96PF6_HUMAN        0.56  0.81    1  108    1  107  108    1    1  116  Q96PF6     Kappa 1 light chain variable region (Fragment) OS=Homo sapiens GN=SDNK1 PE=4 SV=1
  569 : Q9JL78_MOUSE        0.56  0.76    9  108    1  101  101    1    1  101  Q9JL78     Anti-myosin immunoglobulin light chain variable region (Fragment) OS=Mus musculus GN=Igkv4-91 PE=2 SV=1
  570 : Q9QXE9_MOUSE        0.56  0.79  110  227    1  117  118    1    1  117  Q9QXE9     Immunoglobulin heavy chain V-D-J region (Fragment) OS=Mus musculus PE=2 SV=1
  571 : A0N7G6_9MURI        0.55  0.74    9  108    1   99  100    1    1  100  A0N7G6     H2 (Fragment) OS=Mus sp. GN=Ig VL PE=2 SV=1
  572 : A2KD58_LAMGL        0.55  0.69  110  227    1  128  131    3   16  128  A2KD58     R1 protein (Fragment) OS=Lama glama GN=r1 PE=4 SV=1
  573 : A2KD60_LAMGL        0.55  0.69  110  227    1  128  131    3   16  128  A2KD60     R3 protein (Fragment) OS=Lama glama GN=r3 PE=4 SV=1
  574 : A2N494_MOUSE3DUR    0.55  0.78    1  108    1  113  114    2    7  114  A2N494     Aberrantly recombined kappa chain Vk8/J1 region (Fragment) OS=Mus musculus PE=1 SV=1
  575 : B5UB65_MOUSE        0.55  0.78    1  108    1  113  114    2    7  115  B5UB65     CP3-10 light chain variable region (Fragment) OS=Mus musculus GN=CP3-10VL PE=2 SV=1
  576 : F1LWD0_RAT          0.55  0.71  110  223    1  118  121    3   10  123  F1LWD0     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=1
  577 : F7GBG0_MONDO        0.55  0.73    2   95   22  123  102    1    8  123  F7GBG0     Uncharacterized protein OS=Monodelphis domestica GN=LOC100617959 PE=4 SV=1
  578 : F8SQR5_RAT          0.55  0.78    1  108    2  107  108    2    2  107  F8SQR5     Immunglobulin light chain variable region (Fragment) OS=Rattus norvegicus PE=2 SV=1
  579 : G1FM94_HUMAN        0.55  0.75  110  227    1  129  131    2   15  129  G1FM94     Anti-Influenza A hemagglutinin heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  580 : G1Q274_MYOLU        0.55  0.72  110  232    1  120  129    4   15  120  G1Q274     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  581 : G1Q9D5_MYOLU        0.55  0.71  112  228    1  127  132    3   20  130  G1Q9D5     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  582 : G1QGD4_MYOLU        0.55  0.69  110  228    1  133  136    4   20  135  G1QGD4     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  583 : G1TI63_RABIT        0.55  0.77    1  106    1  103  106    1    3  106  G1TI63     Uncharacterized protein (Fragment) OS=Oryctolagus cuniculus PE=4 SV=1
  584 : G1TLA0_RABIT        0.55  0.77    4  105    4  102  102    1    3  104  G1TLA0     Uncharacterized protein (Fragment) OS=Oryctolagus cuniculus PE=4 SV=1
  585 : G3U7C1_LOXAF        0.55  0.74    1   98    1   97   98    1    1   97  G3U7C1     Uncharacterized protein (Fragment) OS=Loxodonta africana PE=4 SV=1
  586 : G3VA63_SARHA        0.55  0.76    2  108   22  131  110    1    3  132  G3VA63     Uncharacterized protein OS=Sarcophilus harrisii PE=4 SV=1
  587 : G3VGN7_SARHA        0.55  0.75    2  102   22  127  106    2    5  138  G3VGN7     Uncharacterized protein OS=Sarcophilus harrisii PE=4 SV=1
  588 : G7NAL4_MACMU        0.55  0.73    1  108   23  124  108    1    6  125  G7NAL4     Putative uncharacterized protein OS=Macaca mulatta GN=EGK_05552 PE=4 SV=1
  589 : H0XRM7_OTOGA        0.55  0.76    2  107    1  104  106    1    2  106  H0XRM7     Uncharacterized protein (Fragment) OS=Otolemur garnettii PE=4 SV=1
  590 : HV312_HUMAN         0.55  0.77  110  226    1  118  123    2   11  119  P01773     Ig heavy chain V-III region BUR OS=Homo sapiens PE=1 SV=1
  591 : HV322_HUMAN 2FL5    0.55  0.74  110  227    1  118  121    3    6  118  P80419     Ig heavy chain V-III region GAR OS=Homo sapiens PE=1 SV=1
  592 : I3MVD1_SPETR        0.55  0.73    1  108    1  104  108    1    4  109  I3MVD1     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  593 : I3MZS9_SPETR        0.55  0.72    1  108    1  104  108    1    4  108  I3MZS9     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  594 : I3NGY9_SPETR        0.55  0.74    1  104    1  104  104    0    0  108  I3NGY9     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  595 : K7DYQ2_MONDO        0.55  0.69  110  217   20  137  123    2   20  153  K7DYQ2     Uncharacterized protein OS=Monodelphis domestica GN=LOC100618872 PE=4 SV=1
  596 : K7FV56_PELSI        0.55  0.74    1   95   21  119   99    1    4  121  K7FV56     Uncharacterized protein OS=Pelodiscus sinensis PE=4 SV=1
  597 : K7THE2_MOUSE        0.55  0.73  118  227    1  113  113    1    3  113  K7THE2     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  598 : KV04_RABIT          0.55  0.73    1  108    2  106  108    1    3  107  P01685     Ig kappa chain V region 4135 OS=Oryctolagus cuniculus PE=1 SV=1
  599 : KV06_RABIT          0.55  0.76    1  108    1  107  108    1    1  108  P01687     Ig kappa chain V region BS-5 OS=Oryctolagus cuniculus PE=1 SV=1
  600 : KV303_HUMAN         0.55  0.79    1   91    5   96   92    1    1  100  P01621     Ig kappa chain V-III region NG9 (Fragment) OS=Homo sapiens PE=1 SV=1
  601 : KV308_HUMAN         0.55  0.79    1  108   21  128  108    0    0  129  P04207     Ig kappa chain V-III region CLL OS=Homo sapiens PE=1 SV=2
  602 : KV3AJ_MOUSE         0.55  0.77    1  108    1  111  112    2    5  111  P01671     Ig kappa chain V-III region PC 7175 OS=Mus musculus PE=1 SV=1
  603 : KV3AL_MOUSE         0.55  0.77    1  108    1  111  112    2    5  111  P01673     Ig kappa chain V-III region PC 2485/PC 4039 OS=Mus musculus PE=1 SV=1
  604 : KV404_HUMAN         0.55  0.74    1  108   21  133  114    2    7  134  P06314     Ig kappa chain V-IV region B17 OS=Homo sapiens PE=2 SV=1
  605 : KV5AL_MOUSE         0.55  0.75    1  108    1  107  108    1    1  108  P01653     Ig kappa chain V-V region W3082 OS=Mus musculus PE=1 SV=1
  606 : M3YD93_MUSPF        0.55  0.76    1  106   21  120  106    1    6  121  M3YD93     Uncharacterized protein OS=Mustela putorius furo PE=4 SV=1
  607 : Q2VT25_MOUSE        0.55  0.74    1  108    1  106  108    2    2  106  Q2VT25     Anti-lipoteichoic acid light chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  608 : Q65ZN3_MOUSE        0.55  0.76    1  107    1  111  111    1    4  111  Q65ZN3     Rheumatoid factor RF10-2 (Fragment) OS=Mus musculus GN=Ig Vkappa PE=2 SV=1
  609 : Q65ZR6_MOUSE        0.55  0.76  110  227   18  134  119    2    3  134  Q65ZR6     Ab 126.33 heavy chain variable and joining regions (Fragment) OS=Mus musculus PE=2 SV=1
  610 : Q8K1F2_MOUSE1RVF    0.55  0.77    1  108    1  106  108    2    2  112  Q8K1F2     Anti-VIPase light chain variable region (Fragment) OS=Mus musculus PE=1 SV=1
  611 : Q924R0_MOUSE        0.55  0.81  110  227    1  118  119    2    2  143  Q924R0     VH186.2-D-J-C mu protein (Fragment) OS=Mus musculus GN=VH186.2-D-J-C mu PE=2 SV=1
  612 : Q925S9_MOUSE        0.55  0.77    1  108   21  127  108    1    1  127  Q925S9     Immunoglobulin light chain (Fragment) OS=Mus musculus GN=Igkv9-120 PE=2 SV=1
  613 : A0N588_9MURI        0.54  0.78    1  108   21  131  112    2    5  131  A0N588     Anti-CD4 mAb M-T310 variable region light chain (Fragment) OS=Mus sp. GN=Ig VL PE=2 SV=1
  614 : A0N7H8_9MURI        0.54  0.79  110  227    1  117  119    2    3  117  A0N7H8     Anti-anti-Id Ab3-2C4 (Fragment) OS=Mus sp. GN=Ig VH PE=2 SV=1
  615 : A0N7J6_HUMAN        0.54  0.79    1  108   21  128  108    0    0  134  A0N7J6     REV25-2 (Fragment) OS=Homo sapiens PE=2 SV=1
  616 : A2KD55_LAMGL        0.54  0.70  110  227    1  125  128    2   13  125  A2KD55     H13 protein (Fragment) OS=Lama glama GN=h13 PE=4 SV=1
  617 : A2NV19_MOUSE        0.54  0.73    1  108   20  131  113    2    6  131  A2NV19     Precursor polypeptide (AA -10 to 121) (413 is 1st base in codon) (Precursor) OS=Mus musculus GN=Igkv1-117 PE=2 SV=1
  618 : A2NW55_MOUSE        0.54  0.73  110  227    1  117  120    2    5  117  A2NW55     E8 variable heavy chain (Fragment) OS=Mus musculus PE=2 SV=1
  619 : B5UB63_MOUSE        0.54  0.78    1  108    1  113  114    2    7  115  B5UB63     CP1-10 light chain variable region (Fragment) OS=Mus musculus GN=CP1-10VL PE=2 SV=1
  620 : F1M5X4_RAT          0.54  0.72  110  227    1  118  125    4   14  124  F1M5X4     Uncharacterized protein (Fragment) OS=Rattus norvegicus GN=LOC100362687 PE=4 SV=1
  621 : F6QU61_ORNAN        0.54  0.68  110  227    1  124  126    2   10  124  F6QU61     Uncharacterized protein (Fragment) OS=Ornithorhynchus anatinus PE=4 SV=1
  622 : F7B5N2_XENTR        0.54  0.74    1  108   22  129  108    0    0  130  F7B5N2     Uncharacterized protein (Fragment) OS=Xenopus tropicalis GN=LOC734128 PE=4 SV=1
  623 : F7EQ27_ORNAN        0.54  0.70  110  229    1  112  124    3   16  122  F7EQ27     Uncharacterized protein (Fragment) OS=Ornithorhynchus anatinus GN=LOC100681637 PE=4 SV=1
  624 : G1TYZ5_RABIT        0.54  0.82    1  101    1  101  101    0    0  109  G1TYZ5     Uncharacterized protein (Fragment) OS=Oryctolagus cuniculus PE=4 SV=1
  625 : G1U177_RABIT        0.54  0.82    2  101    2   99  100    1    2  107  G1U177     Uncharacterized protein (Fragment) OS=Oryctolagus cuniculus PE=4 SV=1
  626 : G3VAP0_SARHA        0.54  0.74    2  105    1  109  109    2    5  112  G3VAP0     Uncharacterized protein (Fragment) OS=Sarcophilus harrisii PE=4 SV=1
  627 : G3VQ74_SARHA        0.54  0.74    1   96   19  119  101    1    5  120  G3VQ74     Uncharacterized protein OS=Sarcophilus harrisii PE=4 SV=1
  628 : H0VN43_CAVPO        0.54  0.75    1  103    1   97  103    1    6   97  H0VN43     Uncharacterized protein (Fragment) OS=Cavia porcellus PE=4 SV=1
  629 : HV301_HUMAN         0.54  0.77  110  227    1  122  123    2    6  122  P01762     Ig heavy chain V-III region TRO OS=Homo sapiens PE=1 SV=1
  630 : I0ITL1_MOUSE        0.54  0.80  110  223    1  113  115    2    3  113  I0ITL1     I (Fragment) OS=Mus musculus GN=IgVH PE=2 SV=1
  631 : I3NCF9_SPETR        0.54  0.76    1  108    1  104  108    1    4  107  I3NCF9     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  632 : I3NHT7_SPETR        0.54  0.71    1  108    1  104  108    1    4  108  I3NHT7     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  633 : K7FLP7_PELSI        0.54  0.76    1   95   21  119   99    1    4  121  K7FLP7     Uncharacterized protein OS=Pelodiscus sinensis PE=4 SV=1
  634 : K7FSU8_PELSI        0.54  0.75    1   95   21  119   99    1    4  121  K7FSU8     Uncharacterized protein OS=Pelodiscus sinensis PE=4 SV=1
  635 : K7T9I5_MOUSE        0.54  0.76  118  227    1  112  113    2    4  112  K7T9I5     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  636 : K7TDB3_MOUSE        0.54  0.77  118  227    1  112  113    2    4  112  K7TDB3     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  637 : K7TH06_MOUSE        0.54  0.76  118  227    1  113  114    2    5  113  K7TH06     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  638 : K7TRQ3_MOUSE        0.54  0.74  118  227    1  113  114    2    5  113  K7TRQ3     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  639 : KV12_RABIT          0.54  0.75    1  108    2  111  110    1    2  111  P01693     Ig kappa chain V region 3368 OS=Oryctolagus cuniculus PE=1 SV=1
  640 : KV13_RABIT          0.54  0.77    4  108    4  109  106    1    1  110  P01694     Ig kappa chain V region 3547 OS=Oryctolagus cuniculus PE=1 SV=1
  641 : KV3A1_MOUSE 2OR9    0.54  0.76    1  108    1  111  112    2    5  111  P01654     Ig kappa chain V-III region PC 2880/PC 1229 OS=Mus musculus PE=1 SV=1
  642 : KV3A2_MOUSE         0.54  0.77    1  108    1  112  112    1    4  112  P01655     Ig kappa chain V-III region PC 7132 OS=Mus musculus PE=1 SV=1
  643 : KV3A3_MOUSE         0.54  0.76    1  108    1  111  112    2    5  111  P01656     Ig kappa chain V-III region MOPC 70 OS=Mus musculus PE=1 SV=1
  644 : KV3A8_MOUSE 2VL5    0.54  0.76    1  108    1  111  112    2    5  111  P01660     Ig kappa chain V-III region PC 3741/TEPC 111 OS=Mus musculus PE=1 SV=1
  645 : KV3AC_MOUSE         0.54  0.77    1  108    1  111  112    2    5  111  P01664     Ig kappa chain V-III region CBPC 101 OS=Mus musculus PE=1 SV=1
  646 : KV402_HUMAN 1QAC    0.54  0.75    1  108    1  113  114    2    7  114  P01625     Ig kappa chain V-IV region Len OS=Homo sapiens PE=1 SV=2
  647 : KV403_HUMAN         0.54  0.73    1  108   21  132  114    2    8  133  P06313     Ig kappa chain V-IV region JI OS=Homo sapiens PE=4 SV=1
  648 : KV5AI_MOUSE         0.54  0.73    1  108    1  107  108    1    1  108  P01651     Ig kappa chain V-V region EPC 109 OS=Mus musculus PE=1 SV=1
  649 : KV6AB_MOUSE         0.54  0.76    1  108    1  108  109    2    2  108  P04945     Ig kappa chain V-VI region NQ2-6.1 OS=Mus musculus PE=2 SV=1
  650 : Q924Q1_MOUSE        0.54  0.79  110  227    1  117  118    1    1  142  Q924Q1     V23-D-J-C mu protein (Fragment) OS=Mus musculus GN=Ighv1-53 PE=2 SV=1
  651 : Q924Q6_MOUSE1I8M    0.54  0.79  110  227    1  120  121    2    4  145  Q924Q6     VH186.2-D-J-C mu protein (Fragment) OS=Mus musculus GN=Ighm PE=1 SV=1
  652 : Q924Q9_MOUSE        0.54  0.79  110  227    1  120  121    2    4  145  Q924Q9     VH186.2-D-J-C mu protein (Fragment) OS=Mus musculus GN=Ighm PE=2 SV=1
  653 : Q924R4_MOUSE        0.54  0.80  110  227    1  120  120    2    2  145  Q924R4     VH186.2-D-J-C mu protein (Fragment) OS=Mus musculus GN=Ighm PE=2 SV=1
  654 : Q9N0W4_RABIT        0.54  0.65  110  227    1  124  127    2   12  124  Q9N0W4     Anti-human A33 heavy chain domain (Fragment) OS=Oryctolagus cuniculus PE=2 SV=1
  655 : Q9N0W6_RABIT        0.54  0.65  110  227    1  124  127    2   12  124  Q9N0W6     Anti-human A33 heavy chain domain (Fragment) OS=Oryctolagus cuniculus PE=2 SV=1
  656 : Q9QXF0_MOUSE        0.54  0.76  110  227    1  117  119    2    3  117  Q9QXF0     Immunoglobulin heavy chain V-D-J region (Fragment) OS=Mus musculus PE=2 SV=1
  657 : A0N5G5_HUMAN        0.53  0.81    1  108    1  109  109    1    1  118  A0N5G5     Rheumatoid factor D5 light chain (Fragment) OS=Homo sapiens GN=V3 PE=2 SV=1
  658 : A0N6Q6_9MURI        0.53  0.77   10  108    1  104  104    2    5  104  A0N6Q6     Rheumatoid factor RF3-5A (Fragment) OS=Mus sp. GN=Ig V PE=2 SV=1
  659 : A0N7I9_HUMAN        0.53  0.73  113  228    5  120  118    3    4  123  A0N7I9     F5-20 (Fragment) OS=Homo sapiens GN=F5-20 PE=1 SV=1
  660 : A2N2F4_HUMAN        0.53  0.74    4  108    1  105  106    2    2  108  A2N2F4     VK3 protein (Fragment) OS=Homo sapiens GN=VK3 PE=2 SV=1
  661 : A2NW98_HUMAN        0.53  0.75    1  108   21  133  114    2    7  134  A2NW98     Rheumatoid factor light chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  662 : B5UB61_MOUSE        0.53  0.78    1   96    1  102  102    1    6  115  B5UB61     CP1-5 light chain variable region (Fragment) OS=Mus musculus GN=CP1-5VL PE=2 SV=1
  663 : D3ZPL2_RAT          0.53  0.79    1  108   20  123  108    1    4  123  D3ZPL2     Uncharacterized protein OS=Rattus norvegicus PE=4 SV=2
  664 : F1LWW1_RAT          0.53  0.75    1  107   21  120  107    1    7  121  F1LWW1     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=2
  665 : F6S1J6_MACMU        0.53  0.78    4  108    1  104  105    1    1  104  F6S1J6     Uncharacterized protein OS=Macaca mulatta GN=IGKV1-5 PE=4 SV=1
  666 : F6TG26_XENTR        0.53  0.73    1   89    1   88   89    1    1  107  F6TG26     Uncharacterized protein (Fragment) OS=Xenopus tropicalis PE=4 SV=1
  667 : F6V1L8_MONDO        0.53  0.69    1   95   21  120  100    1    5  120  F6V1L8     Uncharacterized protein OS=Monodelphis domestica PE=4 SV=1
  668 : F6VT01_HORSE        0.53  0.76    1  106   22  121  106    1    6  121  F6VT01     Uncharacterized protein (Fragment) OS=Equus caballus GN=LOC100065623 PE=4 SV=1
  669 : G1TXI3_RABIT        0.53  0.79    4  100    8  105   99    2    3  105  G1TXI3     Uncharacterized protein (Fragment) OS=Oryctolagus cuniculus PE=4 SV=1
  670 : G3TSL1_LOXAF        0.53  0.71    1  108    1  102  108    1    6  109  G3TSL1     Uncharacterized protein (Fragment) OS=Loxodonta africana PE=4 SV=1
  671 : G3VLF6_SARHA        0.53  0.73    2  104    2  109  108    2    5  114  G3VLF6     Uncharacterized protein (Fragment) OS=Sarcophilus harrisii PE=4 SV=1
  672 : G3VPR0_SARHA        0.53  0.77    2  108   22  127  107    1    1  128  G3VPR0     Uncharacterized protein OS=Sarcophilus harrisii PE=4 SV=1
  673 : H3AN87_LATCH        0.53  0.75  110  227   20  135  119    2    4  135  H3AN87     Uncharacterized protein OS=Latimeria chalumnae PE=4 SV=1
  674 : H9H3X9_MACMU        0.53  0.66  110  225    1  120  126    4   16  122  H9H3X9     Uncharacterized protein (Fragment) OS=Macaca mulatta PE=4 SV=1
  675 : HV02_XENLA          0.53  0.73  113  227   21  135  117    3    4  135  P20957     Ig heavy chain V region XIG14 (Fragment) OS=Xenopus laevis PE=2 SV=1
  676 : HVM13_MOUSE 2OZ4    0.53  0.75  110  227    1  117  118    1    1  117  P01757     Ig heavy chain V region J558 OS=Mus musculus PE=1 SV=1
  677 : I3MZD7_SPETR        0.53  0.70    1  108    1  108  108    0    0  109  I3MZD7     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  678 : I3N0W9_SPETR        0.53  0.75    1  108    1  104  108    1    4  108  I3N0W9     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  679 : K7T993_MOUSE        0.53  0.75  118  227    1  112  114    2    6  112  K7T993     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  680 : K7TRF0_MOUSE        0.53  0.73  118  227    1  113  113    2    3  113  K7TRF0     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  681 : K7TRU2_MOUSE        0.53  0.70  118  227    1  115  116    2    7  115  K7TRU2     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  682 : KV3A4_MOUSE         0.53  0.76    1  108    1  111  112    2    5  111  P03977     Ig kappa chain V-III region 50S10.1 OS=Mus musculus PE=1 SV=1
  683 : KV3A9_MOUSE 1EGJ    0.53  0.77    1  108   21  131  112    2    5  131  P01661     Ig kappa chain V-III region MOPC 63 OS=Mus musculus PE=1 SV=1
  684 : KV3AA_MOUSE         0.53  0.77    1  108    1  111  112    2    5  111  P01662     Ig kappa chain V-III region ABPC 22/PC 9245 OS=Mus musculus PE=1 SV=1
  685 : KV3AD_MOUSE 2ZCL    0.53  0.77    1  108    1  111  112    2    5  111  P01665     Ig kappa chain V-III region PC 7043 OS=Mus musculus PE=1 SV=1
  686 : KV3AF_MOUSE         0.53  0.77    1  108    1  111  112    2    5  111  P01667     Ig kappa chain V-III region PC 6308 OS=Mus musculus PE=1 SV=1
  687 : KV401_HUMAN         0.53  0.75    1   95   21  121  101    1    6  121  P06312     Ig kappa chain V-IV region (Fragment) OS=Homo sapiens GN=IGKV4-1 PE=4 SV=1
  688 : KV4A1_MOUSE         0.53  0.73    1  108   23  128  109    2    4  129  P01680     Ig kappa chain V-IV region S107B OS=Mus musculus PE=4 SV=1
  689 : KV6A1_MOUSE 3BT2    0.53  0.74    1   90    1   89   90    1    1  107  P01675     Ig kappa chain V-VI region XRPC 44 OS=Mus musculus PE=1 SV=1
  690 : KV6A2_MOUSE         0.53  0.74    1   90    1   89   90    1    1  107  P01676     Ig kappa chain V-VI region XRPC 24 OS=Mus musculus PE=1 SV=1
  691 : KV6A3_MOUSE         0.53  0.72    1  108    1  106  108    2    2  107  P01677     Ig kappa chain V-VI region TEPC 601/TEPC 191 OS=Mus musculus PE=1 SV=1
  692 : KV6A4_MOUSE         0.53  0.74    1   90    1   89   90    1    1  107  P01678     Ig kappa chain V-VI region SAPC 10 OS=Mus musculus PE=1 SV=1
  693 : KV6A5_MOUSE 2FBJ    0.53  0.71    1  108    1  106  108    2    2  107  P01679     Ig kappa chain V-VI region J539 OS=Mus musculus PE=1 SV=1
  694 : KV6A6_MOUSE         0.53  0.75    1  108    1  106  108    2    2  107  P04940     Ig kappa chain V-VI region NQ2-17.4.1 OS=Mus musculus PE=4 SV=1
  695 : KV6A8_MOUSE         0.53  0.75    1  108    1  106  108    2    2  107  P04942     Ig kappa chain V-VI region NQ5-61.1.2 OS=Mus musculus PE=4 SV=1
  696 : M0R7F5_RAT          0.53  0.71    1  108    1  107  108    1    1  108  M0R7F5     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=1
  697 : M3YDF0_MUSPF        0.53  0.75    1  106   21  120  106    1    6  121  M3YDF0     Uncharacterized protein OS=Mustela putorius furo PE=4 SV=1
  698 : Q5F2I7_MOUSE        0.53  0.76    1  108    1  111  112    2    5  111  Q5F2I7     Kappa light chain variable region (Fragment) OS=Mus musculus GN=Igk PE=2 SV=1
  699 : Q7Z351_HUMAN3PGF    0.53  0.69  110  232   20  157  138    1   15  482  Q7Z351     Putative uncharacterized protein DKFZp686N02209 OS=Homo sapiens GN=DKFZp686N02209 PE=2 SV=1
  700 : Q8VIJ0_MOUSE        0.53  0.79    1  108    1  107  108    1    1  108  Q8VIJ0     Anti-DNA light chain (Fragment) OS=Mus musculus GN=Igkv6-14 PE=2 SV=1
  701 : Q924P7_MOUSE        0.53  0.79  110  227    1  120  121    2    4  145  Q924P7     VH186.2-D-J-C mu protein (Fragment) OS=Mus musculus GN=VH186.2-D-J-C mu PE=2 SV=1
  702 : Q924R1_MOUSE        0.53  0.79  110  227    1  120  121    2    4  145  Q924R1     VH186.2-D-J-C mu protein (Fragment) OS=Mus musculus GN=Ighm PE=2 SV=1
  703 : Q924R2_MOUSE        0.53  0.79  110  227    1  115  118    2    3  140  Q924R2     VH186.2-D-J-C mu protein (Fragment) OS=Mus musculus GN=VH186.2-D-J-C mu PE=2 SV=1
  704 : Q925S3_MOUSE        0.53  0.77  110  228    3  122  120    1    1  147  Q925S3     MRP3 OS=Mus musculus PE=2 SV=1
  705 : Q9JL84_MOUSE        0.53  0.74    1  108    1  107  108    1    1  107  Q9JL84     Anti-myosin immunoglobulin light chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  706 : Q9U410_MOUSE        0.53  0.74    1  108    1  106  108    2    2  106  Q9U410     Monoclonal anti-idiotypic Schistosoma japonicum antibody NP30 immunoglobulin light chain variable region (Fragment) OS=Mus musculus PE=4 SV=1
  707 : Q9UL92_HUMAN        0.53  0.76  110  227    1  124  124    1    6  124  Q9UL92     Myosin-reactive immunoglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  708 : A0N262_MOUSE3DV4    0.52  0.78    1   90    2   97   96    1    6  115  A0N262     Vk protein (Fragment) OS=Mus musculus GN=Vk PE=1 SV=1
  709 : A2N7P4_HUMAN        0.52  0.77  110  222    4  120  117    2    4  120  A2N7P4     Immunoglobulin mu-chain D-J4-region (Fragment) OS=Homo sapiens GN=IGHM PE=4 SV=1
  710 : A2NC20_MOUSE        0.52  0.76    1  108   21  133  114    2    7  133  A2NC20     CC49 Fab (Precursor) OS=Mus musculus GN=Igkv8-30 PE=2 SV=1
  711 : A2NUE8_MOUSE2AJV    0.52  0.75  110  232   19  142  125    3    3  149  A2NUE8     Vh gene product (Fragment) OS=Mus musculus PE=1 SV=1
  712 : B5UB67_MOUSE        0.52  0.73    1  108    1  112  113    2    6  114  B5UB67     EP3-1 light chain variable region (Fragment) OS=Mus musculus GN=EP3-1VL PE=2 SV=1
  713 : F1M279_RAT          0.52  0.75    1  108    1  107  108    1    1  108  F1M279     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=2
  714 : F1M8N5_RAT          0.52  0.76    1  105    1  104  105    1    1  108  F1M8N5     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=2
  715 : F7H150_MACMU        0.52  0.74    1  108    1  104  108    1    4  104  F7H150     Uncharacterized protein (Fragment) OS=Macaca mulatta PE=4 SV=1
  716 : G1THC9_RABIT        0.52  0.77    2  106    1  101  105    1    4  106  G1THC9     Uncharacterized protein (Fragment) OS=Oryctolagus cuniculus PE=4 SV=1
  717 : G1TMG6_RABIT        0.52  0.77    1  107    3  107  108    2    4  114  G1TMG6     Uncharacterized protein (Fragment) OS=Oryctolagus cuniculus PE=4 SV=1
  718 : G3VA59_SARHA        0.52  0.72    2  108   22  133  112    2    5  139  G3VA59     Uncharacterized protein OS=Sarcophilus harrisii PE=4 SV=1
  719 : G3VJI1_SARHA        0.52  0.75    1  106   21  120  106    1    6  121  G3VJI1     Uncharacterized protein OS=Sarcophilus harrisii PE=4 SV=1
  720 : H0W6K0_CAVPO        0.52  0.77    1  103    3  105  109    2   12  105  H0W6K0     Uncharacterized protein (Fragment) OS=Cavia porcellus PE=4 SV=1
  721 : HV308_HUMAN         0.52  0.75  110  227    1  122  127    2   14  122  P01769     Ig heavy chain V-III region GA OS=Homo sapiens PE=1 SV=1
  722 : HVM07_MOUSE 1OCW    0.52  0.78  110  227   20  139  120    1    2  139  P01751     Ig heavy chain V region B1-8/186-2 OS=Mus musculus GN=Gm16709 PE=1 SV=1
  723 : HVM12_MOUSE 3BQU    0.52  0.74  110  227    1  117  119    2    3  117  P01756     Ig heavy chain V region MOPC 104E OS=Mus musculus PE=1 SV=1
  724 : I3N1A0_SPETR        0.52  0.75    1  108    3  110  108    0    0  113  I3N1A0     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  725 : I3N4M7_SPETR        0.52  0.70    1  108    1  104  108    1    4  109  I3N4M7     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  726 : K7FYE6_PELSI        0.52  0.70    1  108   21  131  112    2    5  132  K7FYE6     Uncharacterized protein OS=Pelodiscus sinensis PE=4 SV=1
  727 : K7T9J0_MOUSE        0.52  0.76  118  227    1  112  114    3    6  112  K7T9J0     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  728 : K7TDF9_MOUSE        0.52  0.71  118  227    1  110  113    2    6  110  K7TDF9     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  729 : K7TH02_MOUSE        0.52  0.74  118  227    1  116  116    1    6  116  K7TH02     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  730 : K7TH26_MOUSE        0.52  0.76  118  227    1  112  114    3    6  112  K7TH26     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  731 : KV05_RABIT          0.52  0.75    1  108    1  107  108    1    1  108  P01686     Ig kappa chain V region BS-1 OS=Oryctolagus cuniculus PE=1 SV=1
  732 : KV08_RABIT          0.52  0.79    2  108    2  107  107    1    1  108  P01689     Ig kappa chain V region 120 OS=Oryctolagus cuniculus PE=1 SV=1
  733 : KV3AE_MOUSE 1F58    0.52  0.77    1  108    1  111  112    2    5  111  P01666     Ig kappa chain V-III region PC 7183 OS=Mus musculus PE=1 SV=1
  734 : KV3AH_MOUSE         0.52  0.76    1  108    1  111  112    2    5  111  P01669     Ig kappa chain V-III region PC 7769 OS=Mus musculus PE=1 SV=1
  735 : KV3AM_MOUSE         0.52  0.75    1  105    1  108  109    2    5  108  P01674     Ig kappa chain V-III region PC 2154 OS=Mus musculus PE=1 SV=1
  736 : KV405_HUMAN         0.52  0.69    1  104    1  109  110    2    7  109  P83593     Ig kappa chain V-IV region STH (Fragment) OS=Homo sapiens PE=1 SV=1
  737 : KV6A7_MOUSE         0.52  0.74    1  108    1  106  108    2    2  107  P04941     Ig kappa chain V-VI region NQ2-48.2.2 OS=Mus musculus PE=4 SV=1
  738 : KV6A9_MOUSE         0.52  0.74    1  108    1  106  108    2    2  107  P04943     Ig kappa chain V-VI region NQ6-8.3.1 OS=Mus musculus PE=4 SV=1
  739 : KV6AA_MOUSE         0.52  0.73    1  108    1  106  108    2    2  107  P04944     Ig kappa chain V-VI region NQ5-78.2.6 OS=Mus musculus PE=4 SV=1
  740 : M9MMM3_PONAB        0.52  0.73    1  107   21  123  107    1    4  123  M9MMM3     Uncharacterized protein OS=Pongo abelii PE=4 SV=1
  741 : Q924P9_MOUSE        0.52  0.78  110  227    1  118  119    2    2  143  Q924P9     V303-D-J-C mu protein (Fragment) OS=Mus musculus GN=V303-D-J-C mu PE=2 SV=1
  742 : Q924Q3_MOUSE        0.52  0.77  110  227    1  121  122    2    5  146  Q924Q3     VH186.2-D-J-C mu protein (Fragment) OS=Mus musculus GN=Ighm PE=2 SV=1
  743 : Q924Q7_MOUSE        0.52  0.78  110  227    1  120  120    1    2  145  Q924Q7     VH186.2-D-J-C mu protein (Fragment) OS=Mus musculus GN=Ighm PE=2 SV=1
  744 : Q924R6_MOUSE        0.52  0.77  110  227    1  112  118    2    6  137  Q924R6     VH186.2-D-J-C mu protein (Fragment) OS=Mus musculus GN=VH186.2-D-J-C mu PE=2 SV=1
  745 : Q9JL80_MOUSE        0.52  0.75    9  108    1  103  104    2    5  103  Q9JL80     Anti-myosin immunoglobulin light chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  746 : Q9N0W5_RABIT        0.52  0.77    1  108    1  109  109    1    1  109  Q9N0W5     Anti-human A33 light chain variable region (Fragment) OS=Oryctolagus cuniculus PE=2 SV=1
  747 : Q9UL86_HUMAN        0.52  0.76    1  108    1  108  109    2    2  109  Q9UL86     Myosin-reactive immunoglobulin kappa chain variable region (Fragment) OS=Homo sapiens PE=1 SV=1
  748 : U5JE80_MOUSE        0.52  0.77    5  108    1  108  108    1    4  113  U5JE80     Immmunoglobulin light chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  749 : A0N274_MOUSE2GKI    0.51  0.75  110  228   20  140  121    1    2  152  A0N274     Antigen, B-cell receptor (Precursor) OS=Mus musculus PE=1 SV=1
  750 : A0N6R1_9MURI        0.51  0.75    1  107    1  110  111    2    5  110  A0N6R1     Rheumatoid factor RFA28 (Fragment) OS=Mus sp. GN=Ig V PE=2 SV=1
  751 : A0N6R2_9MURI        0.51  0.71    1  107    1  109  111    2    6  109  A0N6R2     Rheumatoid factor RF1-7 (Fragment) OS=Mus sp. GN=Ig V PE=2 SV=1
  752 : A1A540_MOUSE        0.51  0.74    1  105   10  108  105    1    6  108  A1A540     Igk protein OS=Mus musculus GN=Igkv10-96 PE=4 SV=1
  753 : A2NW97_HUMAN        0.51  0.79  110  227   20  134  118    2    3  134  A2NW97     Rheumatoid factor Vh I region (Fragment) OS=Homo sapiens PE=2 SV=1
  754 : F1LZG3_RAT          0.51  0.74    1  108    1  105  108    1    3  108  F1LZG3     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=2
  755 : F6QNX1_ORNAN        0.51  0.68  112  232   21  138  126    3   13  139  F6QNX1     Uncharacterized protein OS=Ornithorhynchus anatinus PE=4 SV=2
  756 : F6S1P2_MACMU        0.51  0.73    1  108    1  104  108    1    4  108  F6S1P2     Uncharacterized protein (Fragment) OS=Macaca mulatta PE=4 SV=1
  757 : F6XJR1_XENTR        0.51  0.73    1  107    1  106  107    1    1  116  F6XJR1     Uncharacterized protein (Fragment) OS=Xenopus tropicalis PE=4 SV=1
  758 : G1LUD7_AILME        0.51  0.70    1  108    1  107  108    1    1  107  G1LUD7     Uncharacterized protein (Fragment) OS=Ailuropoda melanoleuca PE=4 SV=1
  759 : G3SEI0_GORGO        0.51  0.69    1  108    1  102  108    1    6  109  G3SEI0     Uncharacterized protein (Fragment) OS=Gorilla gorilla gorilla PE=4 SV=1
  760 : G3U4C5_LOXAF        0.51  0.72    1  108    1  102  108    1    6  108  G3U4C5     Uncharacterized protein (Fragment) OS=Loxodonta africana PE=4 SV=1
  761 : G3UC44_LOXAF        0.51  0.75    1  108   21  123  108    1    5  123  G3UC44     Uncharacterized protein (Fragment) OS=Loxodonta africana PE=4 SV=1
  762 : G3UG07_LOXAF        0.51  0.73  110  226   17  140  124    1    7  151  G3UG07     Uncharacterized protein (Fragment) OS=Loxodonta africana GN=LOC100665541 PE=4 SV=1
  763 : G3ULD5_LOXAF        0.51  0.69    1  108   21  128  114    2   12  134  G3ULD5     Uncharacterized protein OS=Loxodonta africana PE=4 SV=1
  764 : G3VBT9_SARHA        0.51  0.73    2  108    2  102  107    1    6  109  G3VBT9     Uncharacterized protein (Fragment) OS=Sarcophilus harrisii PE=4 SV=1
  765 : H0XH36_OTOGA        0.51  0.74    1  100    1  106  106    1    6  116  H0XH36     Uncharacterized protein (Fragment) OS=Otolemur garnettii GN=IGKV4-1 PE=4 SV=1
  766 : H8EAI0_CLOTM        0.51  0.75  110  228    2  121  120    1    1  151  H8EAI0     Immunoglobulin V-set domain protein (Fragment) OS=Clostridium thermocellum AD2 GN=AD2_3042 PE=4 SV=1
  767 : H9G6T0_ANOCA        0.51  0.72  110  223    1  112  117    2    8  112  H9G6T0     Uncharacterized protein (Fragment) OS=Anolis carolinensis PE=4 SV=1
  768 : I3L728_PIG          0.51  0.73    2  106   22  124  109    2   10  133  I3L728     Uncharacterized protein OS=Sus scrofa GN=LOC100739851 PE=4 SV=1
  769 : I3M5F0_SPETR        0.51  0.72    1  108    1  104  108    1    4  108  I3M5F0     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  770 : I3NFX5_SPETR        0.51  0.72    1  108    1  104  108    1    4  108  I3NFX5     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  771 : K7FWW0_PELSI        0.51  0.70    1  107   21  131  111    1    4  133  K7FWW0     Uncharacterized protein OS=Pelodiscus sinensis PE=4 SV=1
  772 : K7T9N8_MOUSE        0.51  0.74  118  227    1  112  113    2    4  112  K7T9N8     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  773 : K7TDF6_MOUSE        0.51  0.76  118  227    1  111  113    3    5  111  K7TDF6     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  774 : K7U690_MOUSE        0.51  0.80  118  227    1  113  114    2    5  113  K7U690     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  775 : KV121_HUMAN         0.51  0.76    1  108    1  111  112    2    5  112  P01613     Ig kappa chain V-I region Ni OS=Homo sapiens PE=1 SV=1
  776 : KV15_RABIT          0.51  0.73    2  108    1  108  109    2    3  110  P01696     Ig kappa chain V region K29-213 OS=Oryctolagus cuniculus PE=1 SV=1
  777 : KV1_CANFA           0.51  0.71    1  108    1  107  108    1    1  108  P01618     Ig kappa chain V region GOM OS=Canis familiaris PE=1 SV=1
  778 : KV201_HUMAN         0.51  0.71    1  108    2  114  114    2    7  115  P01614     Ig kappa chain V-II region Cum OS=Homo sapiens PE=1 SV=1
  779 : KV2A7_MOUSE 2VQ1    0.51  0.74    1  108    1  112  113    2    6  113  P01631     Ig kappa chain V-II region 26-10 OS=Mus musculus PE=1 SV=1
  780 : KV301_HUMAN         0.51  0.78    1  108    1  108  109    2    2  108  P01619     Ig kappa chain V-III region B6 OS=Homo sapiens PE=1 SV=1
  781 : KV3A5_MOUSE         0.51  0.73    1  107    1  110  111    2    5  111  P01657     Ig kappa chain V-III region PC 2413 OS=Mus musculus PE=1 SV=1
  782 : KV3AB_MOUSE 1ACY    0.51  0.77    1  108    1  111  112    2    5  111  P01663     Ig kappa chain V-III region PC 4050 OS=Mus musculus PE=1 SV=1
  783 : KVM5_MOUSE  2AEP    0.51  0.78    1  108    1  107  108    1    1  121  P84750     Ig kappa chain V region Mem5 (Fragment) OS=Mus musculus PE=1 SV=1
  784 : L8B0W4_PIG          0.51  0.71  110  232   20  158  139    2   16  481  L8B0W4     IgG heavy chain OS=Sus scrofa GN=IGHG PE=2 SV=1
  785 : Q6LEM8_MOUSE        0.51  0.71    1  108    1  112  113    2    6  112  Q6LEM8     Putative uncharacterized protein (Fragment) OS=Mus musculus PE=2 SV=1
  786 : Q924Q2_MOUSE        0.51  0.76  110  231    1  121  122    1    1  142  Q924Q2     V303-D-J-C mu protein (Fragment) OS=Mus musculus GN=V303-D-J-C mu PE=2 SV=1
  787 : U5JE78_MOUSE        0.51  0.74    2  108    1  111  112    2    6  126  U5JE78     Immmunoglobulin light chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  788 : A0N3V1_MOUSE        0.50  0.76  110  227    1  117  120    4    5  117  A0N3V1     C72-3A1 protein (Fragment) OS=Mus musculus GN=Ighv3-5 PE=2 SV=1
  789 : A0N5T9_9MURI        0.50  0.76  110  227    1  118  119    2    2  118  A0N5T9     Anti-hepatitis B virus core antigen MoAb 13C9 heavy chain variable region (Fragment) OS=Mus sp. GN=Ig VH PE=2 SV=1
  790 : A0N6Q0_9MURI        0.50  0.71  110  224    1  117  117    1    2  117  A0N6Q0     Rheumatoid factor RF10-2 (Fragment) OS=Mus sp. GN=Ig VH PE=2 SV=1
  791 : A0N7D1_9MURI        0.50  0.75    1  108    1  111  112    2    5  115  A0N7D1     SD6 Fab kappa light chain variable region (Fragment) OS=Mus sp. GN=Ig PE=4 SV=1
  792 : A0N7G5_9MURI        0.50  0.74  110  219    3  113  113    3    5  113  A0N7G5     H2 (Fragment) OS=Mus sp. GN=Ig VH PE=2 SV=1
  793 : A2MY50_MOUSE        0.50  0.73    1  108    1  112  113    2    6  114  A2MY50     Anti-acid phosphatase variable light chain 11 (Fragment) OS=Mus musculus PE=2 SV=1
  794 : A2N1N0_MOUSE        0.50  0.78  110  228   20  138  121    2    4  150  A2N1N0     B cell antigen receptor (Precursor) OS=Mus musculus PE=4 SV=1
  795 : A2NB45_HUMAN        0.50  0.73    1  108    1  112  113    2    6  113  A2NB45     Cold agglutinin FS-1 L-chain (Fragment) OS=Homo sapiens PE=2 SV=1
  796 : B5DC72_MOUSE        0.50  0.73    1  108    1  112  113    2    6  114  B5DC72     Variable domain of Fab 54-5C10-A light chain (Fragment) OS=Mus musculus GN=Na PE=2 SV=1
  797 : F1LZK3_RAT          0.50  0.70    1  107    1  101  107    1    6  104  F1LZK3     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=2
  798 : F1M7B3_RAT          0.50  0.71    1   96    1  101  101    1    5  102  F1M7B3     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=2
  799 : F6RVX2_MACMU        0.50  0.71    1   96    1  101  101    1    5  102  F6RVX2     Uncharacterized protein (Fragment) OS=Macaca mulatta PE=4 SV=1
  800 : F6TED1_HORSE        0.50  0.69    1   98    1  107  108    2   11  107  F6TED1     Uncharacterized protein (Fragment) OS=Equus caballus PE=4 SV=1
  801 : F6VKZ3_HORSE        0.50  0.72    1  105    4  102  105    1    6  102  F6VKZ3     Uncharacterized protein (Fragment) OS=Equus caballus PE=4 SV=1
  802 : F7A8G3_MACMU        0.50  0.72    1  108    1  108  108    0    0  108  F7A8G3     Uncharacterized protein (Fragment) OS=Macaca mulatta PE=4 SV=1
  803 : F7CEY4_HORSE        0.50  0.79    1   96    3  104  102    1    6  104  F7CEY4     Uncharacterized protein (Fragment) OS=Equus caballus GN=IGKV4-1 PE=4 SV=1
  804 : F7E8D4_CALJA        0.50  0.73    1  100    1  104  105    2    6  108  F7E8D4     Uncharacterized protein (Fragment) OS=Callithrix jacchus GN=IGKV4-1 PE=4 SV=1
  805 : F7FQF7_MONDO        0.50  0.72    1   96   13  113  101    1    5  113  F7FQF7     Uncharacterized protein (Fragment) OS=Monodelphis domestica PE=4 SV=1
  806 : G1SAC6_NOMLE        0.50  0.72    1   96    1  101  101    1    5  102  G1SAC6     Uncharacterized protein (Fragment) OS=Nomascus leucogenys PE=4 SV=1
  807 : G1TGU6_RABIT        0.50  0.76    1  103    5  104  105    2    7  104  G1TGU6     Uncharacterized protein (Fragment) OS=Oryctolagus cuniculus PE=4 SV=1
  808 : G1THE8_RABIT        0.50  0.74    1  108    1  109  109    1    1  110  G1THE8     Uncharacterized protein (Fragment) OS=Oryctolagus cuniculus PE=4 SV=1
  809 : G3GAU4_HUMAN        0.50  0.75    1  108    1  105  109    2    5  107  G3GAU4     Anti-H1N1 influenza HA kappa chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  810 : G3PH07_GASAC        0.50  0.73  113  224   21  132  113    2    2  136  G3PH07     Uncharacterized protein (Fragment) OS=Gasterosteus aculeatus PE=4 SV=1
  811 : G3UIN4_LOXAF        0.50  0.74    1   96    1  102  102    1    6  115  G3UIN4     Uncharacterized protein (Fragment) OS=Loxodonta africana PE=4 SV=1
  812 : H0XIK9_OTOGA        0.50  0.71    1   95    1  100  100    1    5  102  H0XIK9     Uncharacterized protein (Fragment) OS=Otolemur garnettii PE=4 SV=1
  813 : H2RF78_PANTR        0.50  0.72    1   96    1  101  101    1    5  102  H2RF78     Uncharacterized protein (Fragment) OS=Pan troglodytes GN=LOC749743 PE=4 SV=1
  814 : H9H2J4_MELGA        0.50  0.68  111  217    2  116  120    2   18  126  H9H2J4     Uncharacterized protein (Fragment) OS=Meleagris gallopavo GN=LOC100542723 PE=4 SV=1
  815 : HVM03_MOUSE 1JFQ    0.50  0.75  111  227    1  120  121    2    5  120  P01747     Ig heavy chain V region 36-65 OS=Mus musculus PE=1 SV=1
  816 : HVM11_MOUSE 2FAT    0.50  0.76  110  227   20  137  120    2    4  137  P01755     Ig heavy chain V region S43 OS=Mus musculus PE=1 SV=1
  817 : HVM51_MOUSE         0.50  0.73  110  227    1  118  120    2    4  118  P06330     Ig heavy chain V region AC38 205.12 OS=Mus musculus PE=1 SV=1
  818 : I3M2D8_SPETR        0.50  0.72    1  104    1   99  105    2    7  111  I3M2D8     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
  819 : I3MM99_SPETR        0.50  0.75    1  108   21  130  110    1    2  130  I3MM99     Uncharacterized protein OS=Spermophilus tridecemlineatus PE=4 SV=1
  820 : K7EYR4_PELSI        0.50  0.70    1  107    1  107  107    0    0  107  K7EYR4     Uncharacterized protein (Fragment) OS=Pelodiscus sinensis PE=4 SV=1
  821 : K7T9J8_MOUSE        0.50  0.71  118  227    1  114  115    2    6  114  K7T9J8     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  822 : K7T9M7_MOUSE        0.50  0.70  118  227    1  108  113    2    8  108  K7T9M7     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  823 : K7T9N4_MOUSE        0.50  0.75  118  227    1  112  115    2    8  112  K7T9N4     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  824 : K7T9P1_MOUSE        0.50  0.74  118  227    1  112  113    2    4  112  K7T9P1     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  825 : K7T9T8_MOUSE        0.50  0.73  118  227    1  113  116    2    9  113  K7T9T8     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  826 : K7TD91_MOUSE        0.50  0.74  118  227    1  115  117    3    9  115  K7TD91     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  827 : K7TDD9_MOUSE        0.50  0.75  118  227    1  114  116    3    8  114  K7TDD9     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  828 : K7TDK2_MOUSE        0.50  0.66  118  227    1  113  115    2    7  113  K7TDK2     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  829 : K7TGT1_MOUSE        0.50  0.77  118  227    1  114  115    3    6  114  K7TGT1     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  830 : K7TH54_MOUSE        0.50  0.79  118  227    1  112  113    2    4  112  K7TH54     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  831 : K7TH59_MOUSE        0.50  0.76  110  227    2  122  123    3    7  122  K7TH59     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  832 : K7TH96_MOUSE        0.50  0.70  118  227    1  108  113    2    8  108  K7TH96     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  833 : K7THC0_MOUSE        0.50  0.74  118  227    1  112  113    2    4  112  K7THC0     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  834 : K7TR13_MOUSE        0.50  0.77  118  227    1  114  115    3    6  114  K7TR13     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  835 : K7TR64_MOUSE        0.50  0.73  118  227    1  112  113    2    4  112  K7TR64     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  836 : K7TR97_MOUSE        0.50  0.75  118  227    1  113  115    3    7  113  K7TR97     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  837 : K7TRI2_MOUSE        0.50  0.74  118  227    1  113  115    3    7  113  K7TRI2     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  838 : K7TRN8_MOUSE        0.50  0.71  118  227    1  110  113    2    6  110  K7TRN8     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  839 : K7U5M3_MOUSE        0.50  0.79  118  227    1  112  113    2    4  112  K7U5M3     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  840 : K7U5T0_MOUSE        0.50  0.76  118  227    1  113  115    3    7  113  K7U5T0     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  841 : K7U5Y8_MOUSE        0.50  0.75  118  227    1  111  113    3    5  111  K7U5Y8     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  842 : K7U5Z3_MOUSE        0.50  0.65  118  227    1  113  113    1    3  113  K7U5Z3     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  843 : K7U624_MOUSE        0.50  0.75  118  227    1  113  114    2    5  113  K7U624     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  844 : K7U676_MOUSE        0.50  0.73  118  227    1  113  115    3    7  113  K7U676     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  845 : K9IV85_DESRO        0.50  0.73  110  227   20  139  121    3    4  149  K9IV85     Putative conserved secreted protein (Fragment) OS=Desmodus rotundus PE=2 SV=1
  846 : KV01_RABIT          0.50  0.76    4  108    4  109  107    2    3  110  P01682     Ig kappa chain V region 2717 OS=Oryctolagus cuniculus PE=1 SV=1
  847 : KV02_RABIT          0.50  0.78    1  108    2  114  113    2    5  115  P01683     Ig kappa chain V region 3315 OS=Oryctolagus cuniculus PE=1 SV=1
  848 : KV10_RABIT          0.50  0.76    4  108   10  116  107    1    2  117  P01691     Ig kappa chain V region 12F2 (Fragment) OS=Oryctolagus cuniculus PE=4 SV=1
  849 : KV14_RABIT          0.50  0.78    2  108    2  109  108    1    1  109  P01695     Ig kappa chain V region K16-167 OS=Oryctolagus cuniculus PE=1 SV=1
  850 : KV1A1_MOUSE         0.50  0.70    1  108    1  113  114    2    7  114  P01632     Ig kappa chain V-I region S107A OS=Mus musculus PE=4 SV=1
  851 : KV203_HUMAN         0.50  0.71    1  108    1  111  112    2    5  112  P01616     Ig kappa chain V-II region MIL OS=Homo sapiens PE=1 SV=1
  852 : KV204_HUMAN         0.50  0.71    1  108    1  112  113    2    6  113  P01617     Ig kappa chain V-II region TEW OS=Homo sapiens PE=1 SV=1
  853 : KV205_HUMAN         0.50  0.72    1  108    5  116  113    2    6  117  P06309     Ig kappa chain V-II region GM607 (Fragment) OS=Homo sapiens PE=4 SV=1
  854 : KV2A5_MOUSE 3CFB    0.50  0.72    1  108    1  112  113    2    6  113  P03976     Ig kappa chain V-II region 17S29.1 OS=Mus musculus PE=1 SV=1
  855 : KV2A6_MOUSE         0.50  0.70    1  108    1  112  113    2    6  113  P01630     Ig kappa chain V-II region 7S34.1 OS=Mus musculus PE=1 SV=1
  856 : KV3AG_MOUSE         0.50  0.76    1  108    1  110  112    2    6  110  P01668     Ig kappa chain V-III region PC 7210 OS=Mus musculus PE=1 SV=1
  857 : M0RC23_RAT          0.50  0.70    1   96    1  101  101    1    5  102  M0RC23     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=1
  858 : M3XQD9_MUSPF        0.50  0.67  110  228    3  115  125    4   18  115  M3XQD9     Uncharacterized protein (Fragment) OS=Mustela putorius furo PE=4 SV=1
  859 : Q53VP8_MOUSE        0.50  0.69    1  108    1  112  113    2    6  112  Q53VP8     Kappa chain (Fragment) OS=Mus musculus PE=2 SV=1
  860 : Q5F2I0_MOUSE        0.50  0.74    1  108    1  113  113    1    5  115  Q5F2I0     Kappa light chain variable region (Fragment) OS=Mus musculus GN=IgG1 anti-TS1 VL PE=2 SV=1
  861 : Q683Y8_MOUSE        0.50  0.72  110  227    1  116  119    2    4  116  Q683Y8     Immunoglobulin heavy chain variable region (Fragment) OS=Mus musculus GN=IGHV PE=2 SV=1
  862 : Q7TPE3_MOUSE        0.50  0.74  113  232    1  122  122    1    2  136  Q7TPE3     V23-D-J-IgG1 protein (Fragment) OS=Mus musculus GN=V23-D-J-IgG1 PE=2 SV=1
  863 : Q811U6_MOUSE        0.50  0.77    2  108    1  110  111    2    5  111  Q811U6     Anti-human Fc gamma receptor III 3G8 kappa light chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  864 : Q924P8_MOUSE        0.50  0.74  110  231    1  119  122    2    3  140  Q924P8     V23-D-J-C mu protein (Fragment) OS=Mus musculus GN=Ighv1-53 PE=2 SV=1
  865 : Q924R7_MOUSE        0.50  0.76  110  231    1  122  122    0    0  143  Q924R7     VH186.2-D-J-C mu protein (Fragment) OS=Mus musculus GN=VH186.2-D-J-C mu PE=2 SV=1
  866 : Q99NG4_MOUSE        0.50  0.75  110  228    1  121  123    3    6  121  Q99NG4     Single chain Fv (Fragment) OS=Mus musculus PE=2 SV=1
  867 : Q9Z1C4_MOUSE        0.50  0.75  110  227    1  118  120    2    4  118  Q9Z1C4     Anti-porcine VCAM mAb 3F4 heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  868 : A2IPI1_HUMAN        0.49  0.73    1  108    3  114  113    2    6  118  A2IPI1     HRV Fab N8-VL (Fragment) OS=Homo sapiens PE=2 SV=1
  869 : A2N011_HUMAN        0.49  0.70  110  227    1  127  128    4   11  127  A2N011     Vh1-D-J3-region (Fragment) OS=Homo sapiens PE=2 SV=1
  870 : A2N2G7_HUMAN        0.49  0.71  110  227    1  117  118    1    1  117  A2N2G7     VHC8 protein (Fragment) OS=Homo sapiens GN=VHC8 PE=2 SV=1
  871 : A2P2G9_SHEEP        0.49  0.76  110  227   20  137  121    3    6  137  A2P2G9     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
  872 : B5UB69_MOUSE        0.49  0.75    1  108    1  112  114    2    8  114  B5UB69     EP3-6 light chain variable region (Fragment) OS=Mus musculus GN=Igkv8-19 PE=2 SV=1
  873 : D3ZIL8_RAT          0.49  0.68    1  105    1  110  110    1    5  115  D3ZIL8     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=2
  874 : F1M1G3_RAT          0.49  0.73    1  108    1  108  108    0    0  109  F1M1G3     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=2
  875 : F6VC90_HORSE        0.49  0.75    1  106    1  100  106    1    6  100  F6VC90     Uncharacterized protein (Fragment) OS=Equus caballus PE=4 SV=1
  876 : F7CT45_MONDO        0.49  0.66    2  106   16  111  105    2    9  119  F7CT45     Uncharacterized protein (Fragment) OS=Monodelphis domestica PE=4 SV=1
  877 : F7EPX5_ORNAN        0.49  0.65  110  229   20  141  134    3   26  153  F7EPX5     Uncharacterized protein OS=Ornithorhynchus anatinus GN=LOC100681918 PE=4 SV=1
  878 : F7FQ18_MONDO        0.49  0.72    1  108    1  112  113    2    6  112  F7FQ18     Uncharacterized protein (Fragment) OS=Monodelphis domestica PE=4 SV=1
  879 : G1SAA1_NOMLE        0.49  0.72    1   95    1  100  100    1    5  100  G1SAA1     Uncharacterized protein (Fragment) OS=Nomascus leucogenys PE=4 SV=1
  880 : G1U8X8_RABIT        0.49  0.78    1  107    1  110  110    2    3  111  G1U8X8     Uncharacterized protein (Fragment) OS=Oryctolagus cuniculus PE=4 SV=1
  881 : G3ILT5_CRIGR        0.49  0.70    1  106   21  135  121    2   21  138  G3ILT5     Putative uncharacterized protein OS=Cricetulus griseus GN=I79_024857 PE=4 SV=1
  882 : H9H5F5_MACMU        0.49  0.75    1  107    5  108  107    1    3  112  H9H5F5     Uncharacterized protein (Fragment) OS=Macaca mulatta PE=4 SV=1
  883 : H9H5T8_MACMU        0.49  0.70    1   96    1  101  101    1    5  102  H9H5T8     Uncharacterized protein (Fragment) OS=Macaca mulatta PE=4 SV=1
  884 : HV209_HUMAN         0.49  0.72  110  227   21  146  127    2   10  146  P06331     Ig heavy chain V-II region ARH-77 OS=Homo sapiens PE=4 SV=1
  885 : HVM01_MOUSE         0.49  0.72  110  227    1  121  123    2    7  121  P01745     Ig heavy chain V region MPC 11 OS=Mus musculus PE=4 SV=1
  886 : HVM02_MOUSE         0.49  0.74  110  227   20  140  122    2    5  140  P01746     Ig heavy chain V region 93G7 OS=Mus musculus PE=2 SV=1
  887 : K7EEU0_ORNAN        0.49  0.66  110  229   20  141  134    3   26  155  K7EEU0     Uncharacterized protein OS=Ornithorhynchus anatinus PE=4 SV=1
  888 : K7EYM8_PELSI        0.49  0.72    1  107    3  109  107    0    0  114  K7EYM8     Uncharacterized protein (Fragment) OS=Pelodiscus sinensis PE=4 SV=1
  889 : K7FU25_PELSI        0.49  0.71    1  108   21  126  112    2   10  131  K7FU25     Uncharacterized protein OS=Pelodiscus sinensis PE=4 SV=1
  890 : K7T9I8_MOUSE        0.49  0.74  118  227    1  112  113    3    4  112  K7T9I8     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  891 : K7THF9_MOUSE        0.49  0.71  118  227    1  111  113    2    5  111  K7THF9     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  892 : K7TQX5_MOUSE        0.49  0.73  118  227    1  112  113    2    4  112  K7TQX5     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  893 : K7TQZ6_MOUSE        0.49  0.76  118  227    1  111  114    3    7  111  K7TQZ6     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  894 : K7TRM9_MOUSE        0.49  0.69  118  227    1  111  114    2    7  111  K7TRM9     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  895 : K7U5T7_MOUSE        0.49  0.65  118  227    1  116  118    2   10  116  K7U5T7     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  896 : K9IVC6_DESRO        0.49  0.73  110  227   20  133  119    2    6  147  K9IVC6     Putative secreted protein (Fragment) OS=Desmodus rotundus PE=2 SV=1
  897 : K9IVD0_DESRO        0.49  0.73  110  227   26  139  119    2    6  152  K9IVD0     Uncharacterized protein (Fragment) OS=Desmodus rotundus PE=2 SV=1
  898 : KV17_RABIT          0.49  0.70    1  102    2  104  104    2    3  104  P01698     Ig kappa chain V region XP-1 (Fragment) OS=Oryctolagus cuniculus PE=1 SV=1
  899 : KV2A4_MOUSE         0.49  0.72    1  108    1  112  113    2    6  112  P01629     Ig kappa chain V-II region 2S1.3 OS=Mus musculus PE=1 SV=1
  900 : KVX01_RAT           0.49  0.75    1  108    1  108  109    2    2  109  P01681     Ig kappa chain V region S211 OS=Rattus norvegicus PE=1 SV=1
  901 : M7B658_CHEMY        0.49  0.70    4  107    1  107  107    2    3  116  M7B658     Ig kappa chain V-I region Walker OS=Chelonia mydas GN=UY3_10239 PE=4 SV=1
  902 : M7BAM3_CHEMY        0.49  0.73    1  107    1  107  107    0    0  107  M7BAM3     Ig kappa chain V-III region VG (Fragment) OS=Chelonia mydas GN=UY3_10240 PE=4 SV=1
  903 : Q91VA2_MOUSE        0.49  0.76  110  231    1  122  122    0    0  143  Q91VA2     VH186.2-D-J-C mu protein (Fragment) OS=Mus musculus GN=VH186.2-D-J-C mu PE=2 SV=1
  904 : Q924P5_MOUSE        0.49  0.73  110  231    1  123  123    1    1  144  Q924P5     VH186.2-D-J-C mu protein (Fragment) OS=Mus musculus GN=VH186.2-D-J-C mu PE=2 SV=1
  905 : Q924P6_MOUSE        0.49  0.73  110  231    1  122  124    2    4  143  Q924P6     VH186.2-D-J-C mu protein (Fragment) OS=Mus musculus GN=VH186.2-D-J-C mu PE=2 SV=1
  906 : Q924Q4_MOUSE        0.49  0.77  110  231    1  120  122    2    2  141  Q924Q4     VH186.2-D-J-C mu protein (Fragment) OS=Mus musculus GN=VH186.2-D-J-C mu PE=2 SV=1
  907 : Q924Q5_MOUSE        0.49  0.74  110  231    1  122  124    2    4  143  Q924Q5     VH186.2-D-J-C mu protein (Fragment) OS=Mus musculus GN=VH186.2-D-J-C mu PE=2 SV=1
  908 : Q924R5_MOUSE1KTR    0.49  0.73  110  231    1  118  123    2    6  139  Q924R5     VH186.2-D-J-C mu protein (Fragment) OS=Mus musculus GN=VH186.2-D-J-C mu PE=1 SV=1
  909 : Q924R8_MOUSE        0.49  0.74  110  231    1  125  126    2    5  146  Q924R8     VH186.2-D-J-C mu protein (Fragment) OS=Mus musculus GN=Ighm PE=2 SV=1
  910 : Q9GYZ2_MOUSE        0.49  0.77  110  227    1  119  120    2    3  119  Q9GYZ2     Monoclonal anti-idiotypic Schistosoma japonicum antibody NP30 heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  911 : Q9UL73_HUMAN        0.49  0.70  110  227    1  119  121    3    5  119  Q9UL73     Myosin-reactive immunoglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  912 : Q9UL89_HUMAN        0.49  0.73  114  227    1  116  117    3    4  116  Q9UL89     Myosin-reactive immunoglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  913 : U5JE27_MOUSE        0.49  0.70  122  232    1  114  114    2    3  115  U5JE27     Immmunoglobulin heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  914 : A0N6Q8_9MURI        0.48  0.71  110  224    1  118  122    5   11  118  A0N6Q8     Rheumatoid factor RFA28-A (Fragment) OS=Mus sp. GN=Ig VH PE=2 SV=1
  915 : A0N6Y4_9MURI        0.48  0.77  110  227    1  116  120    3    6  116  A0N6Y4     F30C7 heavy chain variable region (Fragment) OS=Mus sp. GN=Ig VH PE=2 SV=1
  916 : A2P2G0_SHEEP        0.48  0.75  110  227   20  132  118    3    5  132  A2P2G0     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
  917 : A2P2G1_SHEEP        0.48  0.75  110  227   20  141  123    3    6  141  A2P2G1     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
  918 : A2P2G2_SHEEP        0.48  0.75  110  227   20  140  122    2    5  140  A2P2G2     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
  919 : A2P2G8_SHEEP        0.48  0.73  110  227   20  139  122    3    6  139  A2P2G8     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
  920 : A2P2H0_SHEEP        0.48  0.75  110  227   20  139  122    3    6  139  A2P2H0     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
  921 : F7B4K6_ORNAN        0.48  0.75    1  106    1  105  106    1    1  108  F7B4K6     Uncharacterized protein (Fragment) OS=Ornithorhynchus anatinus PE=4 SV=1
  922 : F7CAG8_HORSE        0.48  0.72    1   96    5  105  101    1    5  106  F7CAG8     Uncharacterized protein (Fragment) OS=Equus caballus PE=4 SV=1
  923 : F7HD19_MACMU        0.48  0.70    1   99    1  103  104    2    6  103  F7HD19     Uncharacterized protein (Fragment) OS=Macaca mulatta PE=4 SV=1
  924 : G7PN09_MACFA        0.48  0.69    1   95    3  102  100    1    5  102  G7PN09     Putative uncharacterized protein (Fragment) OS=Macaca fascicularis GN=EGM_05139 PE=4 SV=1
  925 : G7PN16_MACFA        0.48  0.69    1   99    1  103  104    2    6  103  G7PN16     Putative uncharacterized protein (Fragment) OS=Macaca fascicularis GN=EGM_05147 PE=4 SV=1
  926 : G8F1V7_MACMU        0.48  0.69    1   99    1  103  104    2    6  103  G8F1V7     Putative uncharacterized protein (Fragment) OS=Macaca mulatta GN=EGK_21496 PE=4 SV=1
  927 : G8F222_MACMU        0.48  0.70    1   95    4  104  101    1    6  104  G8F222     Putative uncharacterized protein (Fragment) OS=Macaca mulatta GN=EGK_21131 PE=4 SV=1
  928 : H0XH74_OTOGA        0.48  0.67    1  105    1  110  110    1    5  114  H0XH74     Uncharacterized protein (Fragment) OS=Otolemur garnettii GN=IGKV2D-26 PE=4 SV=1
  929 : H0XNS3_OTOGA        0.48  0.68    1  106   10  114  111    2   11  115  H0XNS3     Uncharacterized protein OS=Otolemur garnettii PE=4 SV=1
  930 : H2ZSM2_LATCH        0.48  0.71    1  104    1  104  104    0    0  106  H2ZSM2     Uncharacterized protein (Fragment) OS=Latimeria chalumnae PE=4 SV=1
  931 : K7T921_MOUSE        0.48  0.73  118  227    1  112  113    2    4  112  K7T921     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  932 : K7TGP2_MOUSE        0.48  0.74  118  227    1  117  119    3   11  117  K7TGP2     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  933 : K7TH64_MOUSE        0.48  0.72  119  227    1  114  115    2    7  114  K7TH64     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  934 : K7TRE7_MOUSE        0.48  0.70  118  227    1  113  118    2   13  113  K7TRE7     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  935 : K7TRL7_MOUSE        0.48  0.70  118  227    1  113  115    2    7  113  K7TRL7     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  936 : K7U6C3_MOUSE        0.48  0.70  118  227    1  114  115    2    6  114  K7U6C3     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  937 : K7U6E5_MOUSE        0.48  0.78  118  227    1  113  114    2    5  113  K7U6E5     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  938 : L7N0G5_CANFA        0.48  0.69    1   96    1  101  101    1    5  102  L7N0G5     Uncharacterized protein (Fragment) OS=Canis familiaris PE=4 SV=1
  939 : L7N2N8_XENTR        0.48  0.73    1  106    1  102  106    1    4  108  L7N2N8     Uncharacterized protein (Fragment) OS=Xenopus tropicalis PE=4 SV=1
  940 : M0R7M5_RAT          0.48  0.68    1  105    1  110  110    1    5  115  M0R7M5     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=1
  941 : Q5F2I1_MOUSE        0.48  0.74  110  226    1  120  123    2    9  120  Q5F2I1     Gamma heavy chain variable region (Fragment) OS=Mus musculus GN=IgG1 anti-TS1 VH PE=2 SV=1
  942 : Q65ZL3_9MURI        0.48  0.73  110  228   20  140  121    1    2  140  Q65ZL3     Tg10H (Fragment) OS=Mus sp. GN=Tg10H PE=2 SV=1
  943 : Q91V67_MOUSE        0.48  0.73  110  231    1  122  124    2    4  143  Q91V67     V304-D-J-C mu protein (Fragment) OS=Mus musculus GN=VH186.2-D-J-C mu PE=2 SV=1
  944 : Q924Q0_MOUSE2FD6    0.48  0.77  110  231    1  122  124    2    4  143  Q924Q0     V165-D-J-C mu protein (Fragment) OS=Mus musculus GN=V165-D-J-C mu PE=1 SV=1
  945 : Q924Q8_MOUSE        0.48  0.73  110  231    1  125  128    2    9  146  Q924Q8     VH186.2-D-J-C mu protein (Fragment) OS=Mus musculus GN=Ighm PE=2 SV=1
  946 : Q924R3_MOUSE        0.48  0.73  110  231    1  124  126    2    6  145  Q924R3     VH186.2-D-J-C mu protein (Fragment) OS=Mus musculus GN=Ighm PE=2 SV=1
  947 : Q9UL95_HUMAN2D7T    0.48  0.72  110  227    1  125  128    2   13  125  Q9UL95     Myosin-reactive immunoglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  948 : A2MY48_MOUSE        0.47  0.74  110  227    1  120  121    2    4  120  A2MY48     Anti-acid phosphatase variable light chain 11 (Fragment) OS=Mus musculus PE=2 SV=1
  949 : A2P2G4_SHEEP        0.47  0.72  110  227   20  141  123    3    6  141  A2P2G4     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
  950 : B5UB68_MOUSE        0.47  0.73  110  227    1  117  119    3    3  117  B5UB68     EP3-6 heavy chain variable region (Fragment) OS=Mus musculus GN=EP3-6VH PE=2 SV=1
  951 : E2QXH1_CANFA        0.47  0.74    1  108    3  110  114    2   12  120  E2QXH1     Uncharacterized protein (Fragment) OS=Canis familiaris GN=IGKV4-1 PE=4 SV=2
  952 : G1QFT3_MYOLU        0.47  0.73  110  217   20  133  116    4   10  143  G1QFT3     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
  953 : G3UJP8_LOXAF        0.47  0.79  110  219    3  113  113    3    5  113  G3UJP8     Uncharacterized protein (Fragment) OS=Loxodonta africana PE=4 SV=1
  954 : G3UKB2_LOXAF        0.47  0.65    1  108    1  110  116    2   14  116  G3UKB2     Uncharacterized protein (Fragment) OS=Loxodonta africana GN=LOC100667242 PE=4 SV=1
  955 : G5E6I6_BOVIN        0.47  0.72    1  108    1  112  113    2    6  113  G5E6I6     Uncharacterized protein (Fragment) OS=Bos taurus PE=4 SV=1
  956 : H0XHP3_OTOGA        0.47  0.69    1  108    1  112  113    2    6  113  H0XHP3     Uncharacterized protein (Fragment) OS=Otolemur garnettii PE=4 SV=1
  957 : H2M8H7_ORYLA        0.47  0.71  113  223    2  119  119    2    9  119  H2M8H7     Uncharacterized protein (Fragment) OS=Oryzias latipes PE=4 SV=1
  958 : H2UG38_TAKRU        0.47  0.67  113  227    4  122  122    2   10  122  H2UG38     Uncharacterized protein (Fragment) OS=Takifugu rubripes PE=4 SV=1
  959 : HVM00_MOUSE         0.47  0.76  110  223    1  114  116    2    4  114  P01741     Ig heavy chain V region OS=Mus musculus PE=1 SV=1
  960 : HVM15_MOUSE         0.47  0.73  110  227   20  136  119    2    3  136  P01759     Ig heavy chain V region BCL1 OS=Mus musculus PE=4 SV=1
  961 : HVM43_MOUSE         0.47  0.76  110  227   20  144  126    2    9  144  P01819     Ig heavy chain V region MOPC 141 OS=Mus musculus PE=4 SV=1
  962 : HVM48_MOUSE         0.47  0.75  110  227   20  138  119    1    1  138  P03980     Ig heavy chain V region TEPC 1017 OS=Mus musculus PE=4 SV=1
  963 : HVM50_MOUSE         0.47  0.73  110  227    1  120  122    2    6  120  P06329     Ig heavy chain V region AC38 15.3 OS=Mus musculus PE=1 SV=1
  964 : I3JIU6_ORENI        0.47  0.70    1  101    1  102  102    1    1  112  I3JIU6     Uncharacterized protein (Fragment) OS=Oreochromis niloticus PE=4 SV=1
  965 : K7T9K9_MOUSE        0.47  0.73  118  227    1  113  115    3    7  113  K7T9K9     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  966 : K7TGT6_MOUSE        0.47  0.74  118  227    1  109  113    3    7  109  K7TGT6     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  967 : K7TGU3_MOUSE        0.47  0.76  118  227    1  109  113    3    7  109  K7TGU3     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  968 : K9J4H4_DESRO        0.47  0.72  110  227   20  139  123    2    8  153  K9J4H4     Putative secreted protein (Fragment) OS=Desmodus rotundus PE=2 SV=1
  969 : KV16_RABIT          0.47  0.70    2  108    1  113  113    3    6  114  P01697     Ig kappa chain V region AH80-5 OS=Oryctolagus cuniculus PE=1 SV=1
  970 : KV202_HUMAN         0.47  0.71    1  108    1  112  113    2    6  113  P01615     Ig kappa chain V-II region FR OS=Homo sapiens PE=1 SV=1
  971 : KV3A7_MOUSE         0.47  0.76    1  108    1  111  112    2    5  112  P01659     Ig kappa chain V-III region TEPC 124 OS=Mus musculus PE=1 SV=1
  972 : M3Z565_MUSPF        0.47  0.71    1  104    1  109  109    1    5  114  M3Z565     Uncharacterized protein (Fragment) OS=Mustela putorius furo PE=4 SV=1
  973 : Q53VQ5_MOUSE        0.47  0.73  110  221    1  119  120    3    9  119  Q53VQ5     VH-D-JH region (Fragment) OS=Mus musculus PE=2 SV=1
  974 : Q96QS0_HUMAN        0.47  0.75  110  232   20  154  135    2   12  159  Q96QS0     Putative matrix cell adhesion molecule-3 OS=Homo sapiens PE=1 SV=1
  975 : Q9UL80_HUMAN        0.47  0.72    1  108    1  113  113    1    5  114  Q9UL80     Myosin-reactive immunoglobulin light chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  976 : Q9UL94_HUMAN        0.47  0.74  110  227    1  119  121    2    5  119  Q9UL94     Myosin-reactive immunoglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
  977 : U3KK84_FICAL        0.47  0.62  111  232    2  120  130    3   19  124  U3KK84     Uncharacterized protein (Fragment) OS=Ficedula albicollis PE=4 SV=1
  978 : U3KKA6_FICAL        0.47  0.67  114  228    1  113  116    3    4  122  U3KKA6     Uncharacterized protein (Fragment) OS=Ficedula albicollis PE=4 SV=1
  979 : A0N1R6_MOUSE        0.46  0.76  110  227   20  134  119    2    5  134  A0N1R6     CC49 Fab (Precursor) OS=Mus musculus PE=2 SV=1
  980 : A0N587_9MURI        0.46  0.72  110  227   20  139  120    2    2  139  A0N587     Anti-CD4 mAb M-T151 variable region heavy chain (Fragment) OS=Mus sp. GN=Ig VH PE=2 SV=1
  981 : A2MY49_MOUSE        0.46  0.71  110  227    1  116  119    2    4  116  A2MY49     Anti-acid phosphatase variable heavy chain 18 (Fragment) OS=Mus musculus PE=2 SV=1
  982 : A2NV55_HUMAN        0.46  0.65  110  227   20  146  130    5   15  146  A2NV55     Precursor (AA -19 to 113) (Precursor) OS=Homo sapiens PE=2 SV=1
  983 : A2NYU9_HUMAN        0.46  0.67  110  227    1  122  123    3    6  122  A2NYU9     Heavy chain Fab (Fragment) OS=Homo sapiens PE=2 SV=1
  984 : A2P2H8_SHEEP        0.46  0.69  110  227   20  140  125    3   11  140  A2P2H8     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
  985 : A2P2I0_SHEEP        0.46  0.73  110  227   20  142  124    3    7  142  A2P2I0     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
  986 : F1LYU4_RAT          0.46  0.75   11  105   10  107   99    2    5  107  F1LYU4     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=2
  987 : F1M6G9_RAT          0.46  0.66    1  107   20  131  112    1    5  132  F1M6G9     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=2
  988 : F6XWB2_MOUSE        0.46  0.65    1  107    1  112  112    1    5  114  F6XWB2     Uncharacterized protein OS=Mus musculus GN=Igkv1-115 PE=4 SV=1
  989 : F7H884_MACMU        0.46  0.68    1  108    1  113  114    2    7  114  F7H884     Uncharacterized protein (Fragment) OS=Macaca mulatta GN=LOC708249 PE=4 SV=1
  990 : G1PNR8_MYOLU        0.46  0.74  110  226    1  121  122    3    6  122  G1PNR8     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
  991 : G1PYP0_MYOLU        0.46  0.68  110  218   20  129  114    4    9  142  G1PYP0     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
  992 : G1Q1X4_MYOLU        0.46  0.76  110  225   20  132  118    2    7  134  G1Q1X4     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
  993 : G3UDE8_LOXAF        0.46  0.71    1  108    1  114  114    1    6  114  G3UDE8     Uncharacterized protein (Fragment) OS=Loxodonta africana PE=4 SV=1
  994 : HV01_XENLA          0.46  0.70  113  227   21  136  119    3    7  136  P20956     Ig heavy chain V region XIG8 (Fragment) OS=Xenopus laevis PE=2 SV=1
  995 : HVM46_MOUSE         0.46  0.71  110  227   19  137  122    4    7  137  P01822     Ig heavy chain V region MOPC 315 OS=Mus musculus PE=1 SV=2
  996 : HVM47_MOUSE 1J1O    0.46  0.73  110  227    1  113  118    3    5  113  P01823     Ig heavy chain V region 36-60 OS=Mus musculus PE=1 SV=1
  997 : K7T9P5_MOUSE        0.46  0.68  118  227    1  113  113    2    3  113  K7T9P5     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  998 : K7TD45_MOUSE        0.46  0.71  118  227    1  107  113    3    9  107  K7TD45     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
  999 : K7TDG8_MOUSE        0.46  0.75  118  227    1  112  113    3    4  112  K7TDG8     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
 1000 : K7TH41_MOUSE        0.46  0.75  118  227    1  112  113    3    4  112  K7TH41     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
 1001 : K7TH43_MOUSE        0.46  0.67  118  227    1  112  115    2    8  112  K7TH43     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
 1002 : K7THB2_MOUSE        0.46  0.68  118  227    1  111  114    2    7  111  K7THB2     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
 1003 : K7TRK1_MOUSE        0.46  0.70  118  227    1  112  114    2    6  112  K7TRK1     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
 1004 : K7U5X0_MOUSE        0.46  0.71  118  227    1  115  118    4   11  115  K7U5X0     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
 1005 : KV2A1_MOUSE         0.46  0.69    1  108    1  112  113    2    6  112  P01626     Ig kappa chain V-II region MOPC 167 OS=Mus musculus PE=1 SV=1
 1006 : KV2A3_MOUSE         0.46  0.69    1  108    1  112  113    2    6  113  P01628     Ig kappa chain V-II region MOPC 511 OS=Mus musculus PE=1 SV=1
 1007 : M0R813_RAT          0.46  0.66    1  107    1  112  112    1    5  114  M0R813     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=1
 1008 : Q53VQ9_MOUSE        0.46  0.71  110  221    1  119  120    3    9  119  Q53VQ9     VH-D-JH region (Fragment) OS=Mus musculus PE=2 SV=1
 1009 : Q53VR3_MOUSE        0.46  0.71  110  221    1  119  120    3    9  119  Q53VR3     VH-D-JH region (Fragment) OS=Mus musculus PE=2 SV=1
 1010 : Q683Y7_MOUSE        0.46  0.68  110  227    1  116  119    2    4  116  Q683Y7     Immunoglobulin heavy chain variable region (Fragment) OS=Mus musculus GN=IGHV PE=2 SV=1
 1011 : Q6N097_HUMAN        0.46  0.69  110  232   20  156  140    2   20  481  Q6N097     Putative uncharacterized protein DKFZp686H20196 OS=Homo sapiens GN=DKFZp686H20196 PE=2 SV=1
 1012 : Q9JL81_MOUSE        0.46  0.71  118  227    1  114  115    2    6  114  Q9JL81     Anti-myosin immunoglobulin heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
 1013 : U5JE44_MOUSE        0.46  0.72    2  108    1  111  112    2    6  126  U5JE44     Immmunoglobulin light chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
 1014 : A0N5G4_HUMAN        0.45  0.67  117  232    1  119  123    4   11  119  A0N5G4     Rheumatoid factor G9 heavy chain (Fragment) OS=Homo sapiens GN=VH4 PE=2 SV=1
 1015 : A2N0S9_HUMAN        0.45  0.70  118  228    1  114  116    4    7  116  A2N0S9     VH6DJ protein (Fragment) OS=Homo sapiens GN=VH6DJ PE=2 SV=1
 1016 : A2NB44_HUMAN        0.45  0.66  110  222    1  114  116    3    5  114  A2NB44     Cold agglutinin FS-2 H-chain (Fragment) OS=Homo sapiens GN=IGH@ PE=2 SV=1
 1017 : A2P2G5_SHEEP        0.45  0.72  110  227   20  141  123    3    6  141  A2P2G5     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
 1018 : A2P2G6_SHEEP        0.45  0.71  110  227   20  139  122    3    6  139  A2P2G6     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
 1019 : A2P2G7_SHEEP        0.45  0.72  110  227   20  140  122    3    5  140  A2P2G7     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
 1020 : A2P2H4_SHEEP        0.45  0.73  110  227   20  138  120    2    3  138  A2P2H4     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
 1021 : A2P2I2_SHEEP        0.45  0.68  110  227   20  145  127    3   10  145  A2P2I2     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
 1022 : F1LYF1_RAT          0.45  0.68    1  107    1  112  112    1    5  115  F1LYF1     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=2
 1023 : F1M195_RAT          0.45  0.69    2  108    2  114  113    1    6  118  F1M195     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=2
 1024 : F6ZNU9_ORNAN        0.45  0.66  110  227   20  143  126    3   10  143  F6ZNU9     Uncharacterized protein OS=Ornithorhynchus anatinus PE=4 SV=1
 1025 : F7E5M1_CALJA        0.45  0.74  110  226   20  135  119    2    5  136  F7E5M1     Uncharacterized protein OS=Callithrix jacchus PE=4 SV=1
 1026 : F7EBH2_ORNAN        0.45  0.63  110  226   19  134  120    3    7  135  F7EBH2     Uncharacterized protein (Fragment) OS=Ornithorhynchus anatinus PE=4 SV=1
 1027 : G1Q136_MYOLU        0.45  0.69  110  219    3  114  118    3   14  114  G1Q136     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
 1028 : G1Q853_MYOLU        0.45  0.68  110  217   15  128  118    5   14  139  G1Q853     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
 1029 : G1QB60_MYOLU        0.45  0.68  110  219   20  137  120    4   12  137  G1QB60     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
 1030 : H0VCV9_CAVPO        0.45  0.70    1  108    1  108  114    2   12  115  H0VCV9     Uncharacterized protein (Fragment) OS=Cavia porcellus GN=IGKV4-1 PE=4 SV=1
 1031 : H0XS43_OTOGA        0.45  0.65    1  106    1  105  111    2   11  114  H0XS43     Uncharacterized protein (Fragment) OS=Otolemur garnettii PE=4 SV=1
 1032 : H9GQK2_ANOCA        0.45  0.66  110  229    1  127  136    4   25  135  H9GQK2     Uncharacterized protein (Fragment) OS=Anolis carolinensis PE=4 SV=1
 1033 : HV1A_RABIT          0.45  0.64  113  226    3  116  120    4   12  116  P01826     Ig heavy chain V-A1 region BS-5 OS=Oryctolagus cuniculus PE=1 SV=1
 1034 : I3MKU1_SPETR        0.45  0.66  113  232    1  109  122    4   15  125  I3MKU1     Uncharacterized protein (Fragment) OS=Spermophilus tridecemlineatus PE=4 SV=1
 1035 : O95973_HUMAN        0.45  0.72  110  232   20  142  127    4    8  150  O95973     VH4 heavy chain variable region (Precursor) OS=Homo sapiens GN=IGM PE=1 SV=1
 1036 : Q53VQ1_MOUSE        0.45  0.72  110  221    1  115  117    4    7  115  Q53VQ1     VH-D-JH region (Fragment) OS=Mus musculus PE=2 SV=1
 1037 : Q6LBQ5_MOUSE        0.45  0.72  111  227   20  136  119    3    4  136  Q6LBQ5     VH gene product (Fragment) OS=Mus musculus PE=4 SV=1
 1038 : Q7Z3Y6_HUMAN        0.45  0.68  110  217    1  116  117    3   10  116  Q7Z3Y6     Rearranged VH4-34 V gene segment (Fragment) OS=Homo sapiens GN=VH4-34 PE=4 SV=1
 1039 : Q920E8_MOUSE        0.45  0.69  110  226    1  120  124    4   11  120  Q920E8     Pterin-mimicking anti-idiotope heavy chain variable region (Fragment) OS=Mus musculus PE=4 SV=1
 1040 : A2IPH5_HUMAN        0.44  0.63  113  227    1  123  126    4   14  123  A2IPH5     HRV Fab N28-VH (Fragment) OS=Homo sapiens PE=2 SV=1
 1041 : A2MYC6_9MURI        0.44  0.73  110  227    1  125  127    4   11  125  A2MYC6     MA-15 heavy chain (Fragment) OS=Mus sp. PE=2 SV=1
 1042 : A2N0T1_HUMAN        0.44  0.68  118  228    1  117  117    4    6  119  A2N0T1     VH6DJ protein (Fragment) OS=Homo sapiens GN=VH6DJ PE=2 SV=1
 1043 : A2NYU8_HUMAN        0.44  0.72  110  227    1  116  120    3    6  116  A2NYU8     Heavy chain Fab (Fragment) OS=Homo sapiens PE=2 SV=1
 1044 : A2P2H6_SHEEP        0.44  0.71  110  227   20  144  126    2    9  144  A2P2H6     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
 1045 : A2P2H9_SHEEP        0.44  0.74  110  227   20  140  122    3    5  140  A2P2H9     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
 1046 : A2P2I3_SHEEP        0.44  0.71  110  227   20  142  126    3   11  142  A2P2I3     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
 1047 : B5UB60_MOUSE        0.44  0.70  110  227    1  119  123    3    9  119  B5UB60     CP1-5 heavy chain variable region (Fragment) OS=Mus musculus GN=CP1-5VH PE=2 SV=1
 1048 : B5UB62_MOUSE        0.44  0.69  110  227    1  119  123    3    9  119  B5UB62     CP1-10 heavy chain variable region (Fragment) OS=Mus musculus GN=CP1-10VH PE=2 SV=1
 1049 : F1D885_MACMU        0.44  0.64  110  228   12  144  134    4   16  162  F1D885     Anti-quaternary epitope monoclonal antibody heavy chain (Fragment) OS=Macaca mulatta PE=2 SV=1
 1050 : F1D887_MACMU        0.44  0.64  110  232   12  148  137    2   14  162  F1D887     Anti-quaternary epitope monoclonal antibody heavy chain (Fragment) OS=Macaca mulatta PE=2 SV=1
 1051 : F7FT14_MONDO        0.44  0.63    3   96    1  114  114    1   20  115  F7FT14     Uncharacterized protein (Fragment) OS=Monodelphis domestica PE=4 SV=1
 1052 : G3N1H5_BOVIN        0.44  0.74  110  227   20  132  119    3    7  132  G3N1H5     Uncharacterized protein OS=Bos taurus GN=LOC100300806 PE=4 SV=1
 1053 : G3RB23_GORGO        0.44  0.66    1  106    1  105  111    2   11  105  G3RB23     Uncharacterized protein (Fragment) OS=Gorilla gorilla gorilla PE=4 SV=1
 1054 : H2LBT0_ORYLA        0.44  0.69    1  108    1  105  108    1    3  105  H2LBT0     Uncharacterized protein (Fragment) OS=Oryzias latipes PE=4 SV=1
 1055 : HV2A_RABIT          0.44  0.69  115  226    5  114  114    4    6  114  P01827     Ig heavy chain V-A2 region BS-1 OS=Oryctolagus cuniculus PE=1 SV=1
 1056 : HV2B_RABIT          0.44  0.64  115  226    5  117  117    4    9  117  P01828     Ig heavy chain V-A2 region K-25 OS=Oryctolagus cuniculus PE=1 SV=1
 1057 : I3JIV1_ORENI        0.44  0.70    8  108    7  109  103    1    2  109  I3JIV1     Uncharacterized protein (Fragment) OS=Oreochromis niloticus PE=4 SV=1
 1058 : K7T947_MOUSE        0.44  0.69  118  227    1  113  116    2    9  113  K7T947     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
 1059 : K7TDJ4_MOUSE        0.44  0.70  118  227    1  113  115    2    7  113  K7TDJ4     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
 1060 : K7TR77_MOUSE        0.44  0.73  118  227    1  111  114    2    7  111  K7TR77     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
 1061 : Q8CGS2_MOUSE3BGF    0.44  0.74  110  227    3  121  119    1    1  121  Q8CGS2     Anti-deoxynivalenol scFv lambda heavy chain variable region (Fragment) OS=Mus musculus PE=1 SV=1
 1062 : Q8VIJ1_MOUSE        0.44  0.69  110  227    1  123  128    4   15  123  Q8VIJ1     Anti-DNA heavy chain (Fragment) OS=Mus musculus GN=J558 PE=2 SV=1
 1063 : Q9UL96_HUMAN        0.44  0.68  110  227    1  121  124    4    9  121  Q9UL96     Myosin-reactive immunoglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
 1064 : Q9Z1C6_MOUSE        0.44  0.71  110  227    1  117  120    2    5  117  Q9Z1C6     Anti-porcine VCAM mAb 2A2 heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
 1065 : U5JE79_MOUSE        0.44  0.66  122  232    1  118  120    2   11  131  U5JE79     Immmunoglobulin heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
 1066 : A2IPH2_HUMAN        0.43  0.63  113  227    1  123  126    4   14  123  A2IPH2     HRV Fab N6-VH (Fragment) OS=Homo sapiens PE=2 SV=1
 1067 : A2IPH3_HUMAN        0.43  0.63  113  227    1  123  126    4   14  123  A2IPH3     HRV Fab N27-VH (Fragment) OS=Homo sapiens PE=2 SV=1
 1068 : A2N0S6_HUMAN        0.43  0.69  118  228    1  118  118    3    7  120  A2N0S6     VH6DJ protein (Fragment) OS=Homo sapiens GN=VH6DJ PE=2 SV=1
 1069 : A2N0T0_HUMAN        0.43  0.66  118  228    1  118  119    4    9  120  A2N0T0     VH6DJ protein (Fragment) OS=Homo sapiens GN=VH6DJ PE=2 SV=1
 1070 : A2NYU6_HUMAN        0.43  0.64  110  227    1  127  128    4   11  127  A2NYU6     Heavy chain Fab (Fragment) OS=Homo sapiens PE=2 SV=1
 1071 : A2NYU7_HUMAN        0.43  0.64  110  227    1  127  128    4   11  127  A2NYU7     Heavy chain Fab (Fragment) OS=Homo sapiens PE=2 SV=1
 1072 : A2P2H1_SHEEP        0.43  0.71  110  227   20  138  120    3    3  138  A2P2H1     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
 1073 : A2P2H3_SHEEP        0.43  0.72  110  227   20  140  123    3    7  140  A2P2H3     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
 1074 : A2P2H5_SHEEP        0.43  0.67  110  227   20  140  127    3   15  140  A2P2H5     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
 1075 : A2P2I4_SHEEP        0.43  0.69  110  227   20  143  128    3   14  143  A2P2I4     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
 1076 : F1D886_MACMU        0.43  0.66  110  232   12  149  138    2   15  163  F1D886     Anti-quaternary epitope monoclonal antibody heavy chain (Fragment) OS=Macaca mulatta PE=2 SV=1
 1077 : G1PYV8_MYOLU        0.43  0.70  110  224   20  141  123    3    9  144  G1PYV8     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
 1078 : G1Q2B0_MYOLU        0.43  0.65  110  223   20  138  125    4   17  142  G1Q2B0     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
 1079 : G1Q8K8_MYOLU        0.43  0.70  110  224   20  132  117    3    6  135  G1Q8K8     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
 1080 : G1Q951_MYOLU        0.43  0.66  110  228   20  140  128    6   16  140  G1Q951     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
 1081 : G1QD96_MYOLU        0.43  0.66  110  230   20  139  125    4    9  139  G1QD96     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
 1082 : G3U707_LOXAF        0.43  0.69    1  106    1  105  111    2   11  114  G3U707     Uncharacterized protein (Fragment) OS=Loxodonta africana PE=4 SV=1
 1083 : HV101_HUMAN         0.43  0.68  110  227    1  117  120    5    5  117  P01742     Ig heavy chain V-I region EU OS=Homo sapiens PE=1 SV=1
 1084 : HV201_HUMAN         0.43  0.67  110  227    1  126  127    4   10  126  P01814     Ig heavy chain V-II region OU OS=Homo sapiens PE=1 SV=1
 1085 : HV2C_RABIT          0.43  0.65  115  227   24  136  118    3   10  136  P01829     Ig heavy chain V-A2 region P-MU-3 OS=Oryctolagus cuniculus PE=4 SV=1
 1086 : K7FFG6_PELSI        0.43  0.60  113  227    4  127  124    2    9  127  K7FFG6     Uncharacterized protein (Fragment) OS=Pelodiscus sinensis PE=4 SV=1
 1087 : K7T9U2_MOUSE        0.43  0.70  118  227    1  112  116    3   10  112  K7T9U2     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
 1088 : K7TDP3_MOUSE        0.43  0.70  118  227    1  111  115    5    9  111  K7TDP3     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
 1089 : K7TGR5_MOUSE        0.43  0.67  118  227    1  112  115    4    8  112  K7TGR5     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
 1090 : M0RAB8_RAT          0.43  0.66    1  107    1  115  115    2    8  116  M0RAB8     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=1
 1091 : Q53VR7_MOUSE        0.43  0.70  110  221    1  120  122    4   12  120  Q53VR7     VH-D-JH region (Fragment) OS=Mus musculus PE=2 SV=1
 1092 : Q9UL75_HUMAN        0.43  0.67  110  227    1  122  125    4   10  122  Q9UL75     Myosin-reactive immunoglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
 1093 : A0N589_9MURI        0.42  0.69  110  227   19  137  122    2    7  137  A0N589     Anti-CD4 mAb M-T310 variable region heavy chain (Fragment) OS=Mus sp. GN=Ig VH PE=2 SV=1
 1094 : A0N5U0_9MURI        0.42  0.72  110  227    1  119  123    4    9  119  A0N5U0     Anti-hepatitis B virus core antigen MoAb 14B8 heavy chain variable region (Fragment) OS=Mus sp. GN=Ig VH PE=2 SV=1
 1095 : A2N0T8_HUMAN        0.42  0.66  118  228    1  114  116    4    7  116  A2N0T8     VH6DJ protein (Fragment) OS=Homo sapiens GN=VH6DJ PE=2 SV=1
 1096 : A2NYV0_HUMAN        0.42  0.67  110  227    1  122  125    3   10  122  A2NYV0     Heavy chain Fab (Fragment) OS=Homo sapiens PE=2 SV=1
 1097 : F6W517_ORNAN        0.42  0.62  113  231    2  114  120    2    8  117  F6W517     Uncharacterized protein (Fragment) OS=Ornithorhynchus anatinus PE=4 SV=1
 1098 : F7CW73_XENTR        0.42  0.64  113  225    4  122  123    4   14  125  F7CW73     Uncharacterized protein (Fragment) OS=Xenopus tropicalis PE=4 SV=1
 1099 : G1PZ95_MYOLU        0.42  0.67  110  227   20  141  126    5   12  144  G1PZ95     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
 1100 : G1QDI2_MYOLU        0.42  0.69  110  227    1  121  127    3   15  121  G1QDI2     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
 1101 : G3MZH0_BOVIN        0.42  0.71  110  227   20  132  119    3    7  132  G3MZH0     Uncharacterized protein OS=Bos taurus GN=LOC100300806 PE=4 SV=1
 1102 : G3S1A4_GORGO        0.42  0.66    1  108    1  107  113    2   11  112  G3S1A4     Uncharacterized protein (Fragment) OS=Gorilla gorilla gorilla PE=4 SV=1
 1103 : G3TXG5_LOXAF        0.42  0.71  110  217    1  115  120    2   17  125  G3TXG5     Uncharacterized protein (Fragment) OS=Loxodonta africana PE=4 SV=1
 1104 : G3UDY8_LOXAF        0.42  0.73  110  228   20  142  124    3    6  142  G3UDY8     Uncharacterized protein OS=Loxodonta africana PE=4 SV=1
 1105 : H0VLG7_CAVPO        0.42  0.63    1  108    1  107  113    2   11  113  H0VLG7     Uncharacterized protein (Fragment) OS=Cavia porcellus PE=4 SV=1
 1106 : HV105_HUMAN         0.42  0.61  110  228    1  123  127    4   12  124  P01760     Ig heavy chain V-I region WOL OS=Homo sapiens PE=1 SV=1
 1107 : M3WRW6_FELCA        0.42  0.65    1  108    1  107  113    2   11  114  M3WRW6     Uncharacterized protein (Fragment) OS=Felis catus PE=4 SV=1
 1108 : M3X1A8_FELCA        0.42  0.67    1  108    1  107  113    2   11  113  M3X1A8     Uncharacterized protein (Fragment) OS=Felis catus PE=4 SV=1
 1109 : A2N0S5_HUMAN        0.41  0.67  118  228    1  112  115    4    7  114  A2N0S5     VH6DJ protein (Fragment) OS=Homo sapiens GN=VH6DJ PE=2 SV=1
 1110 : A2N0S8_HUMAN        0.41  0.67  119  228    2  118  118    4    9  120  A2N0S8     VH6DJ protein (Fragment) OS=Homo sapiens GN=VH6DJ PE=2 SV=1
 1111 : A2N0T5_HUMAN        0.41  0.67  118  228    1  113  116    4    8  115  A2N0T5     VH6DJ protein (Fragment) OS=Homo sapiens GN=VH6DJ PE=2 SV=1
 1112 : A2N0T7_HUMAN        0.41  0.66  118  228    1  112  116    4    9  114  A2N0T7     VH6DJ protein (Fragment) OS=Homo sapiens GN=VH6DJ PE=2 SV=1
 1113 : A2N0T9_HUMAN        0.41  0.68  118  228    1  113  114    3    4  115  A2N0T9     VH6DJ protein (Fragment) OS=Homo sapiens GN=VH6DJ PE=2 SV=1
 1114 : A2N0U0_HUMAN        0.41  0.65  118  228    1  112  114    4    5  114  A2N0U0     VH6DJ protein (Fragment) OS=Homo sapiens GN=VH6DJ PE=2 SV=1
 1115 : A2N0U1_HUMAN        0.41  0.66  118  228    1  112  116    4    9  114  A2N0U1     VH6DJ protein (Fragment) OS=Homo sapiens GN=VH6DJ PE=2 SV=1
 1116 : A2N0U2_HUMAN        0.41  0.66  118  228    1  112  114    4    5  114  A2N0U2     VH6DJ protein (Fragment) OS=Homo sapiens GN=VH6DJ PE=2 SV=1
 1117 : A2N0U6_HUMAN        0.41  0.66  118  228    1  114  117    4    9  116  A2N0U6     VH6DJ protein (Fragment) OS=Homo sapiens GN=VH6DJ PE=2 SV=1
 1118 : A2P2G3_SHEEP        0.41  0.68  110  227   20  142  124    2    7  142  A2P2G3     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
 1119 : A2P2H2_SHEEP        0.41  0.67  110  227   20  144  128    3   13  144  A2P2H2     VH region (Precursor) OS=Ovis aries GN=VH PE=2 SV=1
 1120 : B5DC71_MOUSE        0.41  0.73  110  227    1  118  120    3    4  118  B5DC71     Variable domain of Fab 54-5C10-A heavy chain (Fragment) OS=Mus musculus GN=Na PE=2 SV=1
 1121 : F1D884_MACMU        0.41  0.62  110  232   12  150  141    3   20  164  F1D884     Anti-quaternary epitope monoclonal antibody heavy chain (Fragment) OS=Macaca mulatta PE=2 SV=1
 1122 : F6T196_ORNAN        0.41  0.62  113  228    2  120  124    3   13  121  F6T196     Uncharacterized protein (Fragment) OS=Ornithorhynchus anatinus PE=4 SV=1
 1123 : F7ANK9_XENTR        0.41  0.63  113  225    4  119  123    4   17  121  F7ANK9     Uncharacterized protein (Fragment) OS=Xenopus tropicalis PE=4 SV=1
 1124 : G3MWT1_BOVIN        0.41  0.69  110  229   20  129  123    4   16  137  G3MWT1     Uncharacterized protein OS=Bos taurus GN=LOC101905477 PE=4 SV=1
 1125 : G3U8G9_LOXAF        0.41  0.66  110  229    1  111  123    5   15  116  G3U8G9     Uncharacterized protein (Fragment) OS=Loxodonta africana PE=4 SV=1
 1126 : G3UDL9_LOXAF        0.41  0.72  110  231   20  133  123    4   10  137  G3UDL9     Uncharacterized protein OS=Loxodonta africana PE=4 SV=1
 1127 : G8F145_MACMU        0.41  0.68  110  219    1  111  117    3   13  119  G8F145     Putative uncharacterized protein (Fragment) OS=Macaca mulatta GN=EGK_20223 PE=4 SV=1
 1128 : H9H3X7_MACMU        0.41  0.72  110  219    1  113  116    4    9  121  H9H3X7     Uncharacterized protein (Fragment) OS=Macaca mulatta PE=4 SV=1
 1129 : HV108_HUMAN         0.41  0.69  111  227    2  120  121    3    6  120  P80421     Ig heavy chain V-I region DOT OS=Homo sapiens PE=1 SV=1
 1130 : HV202_HUMAN         0.41  0.63  110  227    1  120  126    5   14  120  P01815     Ig heavy chain V-II region COR OS=Homo sapiens PE=1 SV=1
 1131 : HV203_HUMAN         0.41  0.63  110  227    1  119  123    5    9  119  P01816     Ig heavy chain V-II region DAW OS=Homo sapiens PE=1 SV=1
 1132 : HV207_HUMAN 7FAB    0.41  0.66  110  227    1  117  120    3    5  117  P01825     Ig heavy chain V-II region NEWM OS=Homo sapiens PE=1 SV=1
 1133 : I3JIV3_ORENI        0.41  0.69    8  108    7  106  103    2    5  107  I3JIV3     Uncharacterized protein (Fragment) OS=Oreochromis niloticus PE=4 SV=1
 1134 : I3K3L5_ORENI        0.41  0.70  111  223    2  115  115    3    3  124  I3K3L5     Uncharacterized protein (Fragment) OS=Oreochromis niloticus PE=4 SV=1
 1135 : K7ET38_PONAB        0.41  0.67  110  232   20  130  123    4   12  130  K7ET38     Uncharacterized protein OS=Pongo abelii PE=4 SV=1
 1136 : K7EVE2_PONAB        0.41  0.66  110  232   20  130  123    4   12  131  K7EVE2     Uncharacterized protein OS=Pongo abelii PE=4 SV=1
 1137 : K7TDK7_MOUSE        0.41  0.68  118  227    1  114  117    2   10  114  K7TDK7     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
 1138 : K7TRE2_MOUSE        0.41  0.71  118  227    1  113  117    4   11  113  K7TRE2     IgM heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
 1139 : L5M8S2_MYODS        0.41  0.59  111  206   22  148  127    2   31  156  L5M8S2     Ig heavy chain V-III region VH26 OS=Myotis davidii GN=MDA_GLEAN10001099 PE=4 SV=1
 1140 : M0R6U4_RAT          0.41  0.67    1  106    1  105  111    2   11  115  M0R6U4     Uncharacterized protein (Fragment) OS=Rattus norvegicus PE=4 SV=1
 1141 : Q8IZD7_HUMAN        0.41  0.64  110  227    1  130  130    4   12  130  Q8IZD7     Anti-thyroglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
 1142 : A2N0T2_HUMAN        0.40  0.64  122  228    1  114  116    5   11  116  A2N0T2     VH6DJ protein (Fragment) OS=Homo sapiens GN=VH6DJ PE=2 SV=1
 1143 : G1QCT2_MYOLU        0.40  0.68  110  232   20  137  127    3   13  139  G1QCT2     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
 1144 : G1QG49_MYOLU        0.40  0.67  110  227   20  146  133    3   21  146  G1QG49     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
 1145 : G3N1R1_BOVIN        0.40  0.69  110  230   20  132  125    4   16  137  G3N1R1     Uncharacterized protein OS=Bos taurus GN=LOC100300806 PE=4 SV=1
 1146 : G3TZY3_LOXAF        0.40  0.72  110  228   20  145  127    3    9  145  G3TZY3     Uncharacterized protein OS=Loxodonta africana PE=4 SV=1
 1147 : HV206_HUMAN 1ZVO    0.40  0.62  111  227    2  129  132    4   19  129  P01824     Ig heavy chain V-II region WAH OS=Homo sapiens PE=1 SV=1
 1148 : K7T9M5_MOUSE        0.40  0.68  118  227    1  114  117    2   10  114  K7T9M5     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
 1149 : K7TH57_MOUSE        0.40  0.61  118  227    1  115  119    6   13  115  K7TH57     IgA heavy chain variable region (Fragment) OS=Mus musculus PE=2 SV=1
 1150 : Q96JD1_HUMAN1PW3    0.40  0.59    8  107    7  110  104    2    4  112  Q96JD1     Amyloid lambda 6 light chain variable region PIP (Fragment) OS=Homo sapiens PE=1 SV=1
 1151 : A0N6Q7_9MURI        0.39  0.68  110  221    1  120  122    4   12  120  A0N6Q7     Rheumatoid factor RF3-2CR2A (Fragment) OS=Mus sp. GN=Ig VH PE=2 SV=1
 1152 : A2N0S7_HUMAN        0.39  0.64  118  228    1  118  122    5   15  120  A2N0S7     VH6DJ protein (Fragment) OS=Homo sapiens GN=VH6DJ PE=2 SV=1
 1153 : A2N0T6_HUMAN        0.39  0.64  118  228    1  117  120    4   12  119  A2N0T6     VH6DJ protein (Fragment) OS=Homo sapiens GN=VH6DJ PE=2 SV=1
 1154 : A2N2G8_HUMAN        0.39  0.57   12  105   10  107   99    4    6  108  A2N2G8     VLC8 protein (Fragment) OS=Homo sapiens GN=VLC8 PE=2 SV=1
 1155 : G1PYJ6_MYOLU        0.39  0.67  116  227    1  112  118    3   12  112  G1PYJ6     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
 1156 : G1Q8L6_MYOLU        0.39  0.58  110  229    1  117  129    5   21  127  G1Q8L6     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
 1157 : G1QDT6_MYOLU        0.39  0.59    8  106    7  103  103    4   10  105  G1QDT6     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
 1158 : G3UDL4_LOXAF        0.39  0.65  110  224    1  120  125    4   15  124  G3UDL4     Uncharacterized protein (Fragment) OS=Loxodonta africana PE=4 SV=1
 1159 : HV106_HUMAN         0.39  0.64  110  228    1  123  127    4   12  124  P01761     Ig heavy chain V-I region SIE OS=Homo sapiens PE=1 SV=1
 1160 : HV107_HUMAN         0.39  0.66  110  227    1  125  128    2   13  125  P06326     Ig heavy chain V-I region Mot OS=Homo sapiens PE=1 SV=1
 1161 : Q811U5_MOUSE2R0W    0.39  0.68  110  227    1  118  122    4    8  118  Q811U5     Anti-human Fc gamma receptor III 3G8 gamma heavy chain variable region (Fragment) OS=Mus musculus PE=1 SV=1
 1162 : S6BGF5_HUMAN        0.39  0.70  110  232   20  152  136    2   16  240  S6BGF5     IgG H chain OS=Homo sapiens PE=2 SV=1
 1163 : A2KUC4_HUMAN        0.38  0.57    8  107    5  108  104    3    4  112  A2KUC4     UGa8L (Fragment) OS=Homo sapiens GN=IGLV PE=4 SV=1
 1164 : F7F0D6_MACMU        0.38  0.62  110  232    4  138  138    4   18  466  F7F0D6     Uncharacterized protein (Fragment) OS=Macaca mulatta GN=IGHM PE=4 SV=1
 1165 : G1QF95_MYOLU        0.38  0.63  110  232   20  154  140    2   22  159  G1QF95     Uncharacterized protein OS=Myotis lucifugus PE=4 SV=1
 1166 : HV205_HUMAN         0.38  0.66  110  227    1  121  125    5   11  121  P01818     Ig heavy chain V-II region HE OS=Homo sapiens PE=1 SV=1
 1167 : A2N0T3_HUMAN        0.37  0.58  118  228    1  113  117    5   10  115  A2N0T3     VH6DJ protein (Fragment) OS=Homo sapiens GN=VH6DJ PE=2 SV=1
 1168 : G1QCT5_MYOLU        0.37  0.67  110  227    1  127  130    2   15  127  G1QCT5     Uncharacterized protein (Fragment) OS=Myotis lucifugus PE=4 SV=1
 1169 : H0WLF1_OTOGA        0.37  0.56   11  108   10  106  102    3    9  111  H0WLF1     Uncharacterized protein (Fragment) OS=Otolemur garnettii GN=IGLV6-57 PE=4 SV=1
 1170 : Q9UL74_HUMAN        0.37  0.59  119  227    1  118  123    6   19  118  Q9UL74     Myosin-reactive immunoglobulin heavy chain variable region (Fragment) OS=Homo sapiens PE=2 SV=1
 1171 : F7E066_ORNAN        0.36  0.58  110  229    1  115  129    7   23  115  F7E066     Uncharacterized protein (Fragment) OS=Ornithorhynchus anatinus PE=4 SV=1
 1172 : IGW3_HETFR          0.36  0.59  110  227    1  115  120    3    7  118  P83907     IgW heavy chain V region W26 (Fragment) OS=Heterodontus francisci PE=2 SV=1
 1173 : HV204_HUMAN         0.34  0.64  110  227    1  125  129    4   15  125  P01817     Ig heavy chain V-II region MCE OS=Homo sapiens PE=1 SV=1
 1174 : HV208_HUMAN         0.34  0.58  110  232   20  145  137    5   25  147  P04438     Ig heavy chain V-II region SESS OS=Homo sapiens PE=2 SV=1
 1175 : S7MNN9_MYOBR        0.33  0.57  110  227   26  159  136    4   20  163  S7MNN9     Ig heavy chain V-II region WAH OS=Myotis brandtii GN=D623_10002034 PE=4 SV=1
 1176 : K7F561_PELSI        0.31  0.55  110  232    1  125  139    6   30  125  K7F561     Uncharacterized protein (Fragment) OS=Pelodiscus sinensis PE=4 SV=1
 1177 : A0N8U8_HETFR        0.30  0.47    4  108   20  133  121    6   23  242  A0N8U8     Variable region OS=Heterodontus francisci PE=4 SV=1
## ALIGNMENTS    1 -   70
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....1....:....2....:....3....:....4....:....5....:....6....:....7
     1    1 L D              0   0  183  420   16    D  D             D                D  D                              
     2    2 L I        -     0   0   32  462   11    I  I             I                I  I                              
     3    3 L E        -     0   0  117  463   68    V  Q             Q                Q  Q                              
     4    4 L L  E     -K   25   0D  10  474    7    L  M             M                M  M                              
     5    5 L T  E     -K   24   0D  64  475    8    T  T             T                T  T                              
     6    6 L Q  E     -K   23   0D  13  475    0    Q  Q             Q                Q  Q                              
     7    7 L T  E    S+K   22   0D  64  475   34    S  S             S                S  S                              
     8    8 L P        -     0   0   46  480    9    P  P             P                P  P                              
     9    9 L V  S    S+     0   0   96  484   67    A  D             A                A  A                              
    10   10 L S  E     -n  104   0E  60  485   43    S  Y             S                S  S                              
    11   11 L L  E     -n  105   0E  58  489   21    L  L             L                L  L                              
    12   12 L S  E     +n  106   0E  60  490   42    S  S             S                S  S                              
    13   13 L A  E     -n  107   0E   0  490   58    A  A             A                A  A                              
    14   14 L S    >   -     0   0   47  491   29    S  S             S                S  S                              
    15   15 L V  T 3  S+     0   0   76  491   66    V  V             V                V  V                              
    16   16 L G  T 3  S+     0   0   42  491    4    G  G             G                G  G                              
    17   17 L E    <   -     0   0   71  491   35    E  E             E                E  E                              
    18   18 L T        -     0   0   69  491   62    T  T             T                T  T                              
    19   19 L V  E     - L   0  75D  11  491   37    V  V             V                V  V                              
    20   20 L T  E     - L   0  74D  67  490   30    T  T             T                T  T                              
    21   21 L I  E     - L   0  73D   1  489   17    I  I             I                I  I                              
    22   22 L T  E     -KL   7  72D  29  489   58    T  T             T                T  T                              
    23   23 L a  E     -KL   6  71D   0  490    1    C  C             C                C  C                              
    24   24 L R  E     -KL   5  70D 110  490   45    R  R             R                R  R                              
    25   25 L A  E     -K    4   0D  10  490   29    A  A             A                A  A                              
    26   26 L S  S    S+     0   0   66  490    4    S  S             S                S  S                              
    27   27 L E  S    S-     0   0  101  490   38    E  E             G                G  G                              
    28   28 L N        +     0   0   83  490   45    N  N             N                N  N                              
    29   29 L I    >   -     0   0    5  491   32    I  I             I                I  I                              
    30   30 L Y  T 3   -     0   0  155  491   81    Y  Y             H                H  H                              
    31   31 L S  T 3  S+     0   0   53  467   65    S  S             N                N  N                              
    32   32 L Y    <   +     0   0   63  490   52    Y  Y             Y                Y  Y                              
    33   33 L L  E     -O   90   0E   0  490    7    L  L             L                L  L                              
    34   34 L A  E     -O   89   0E   0  490   71    L  A             A                A  A                              
    35   35 L W  E     -OP  88  48E   1  491    0    W  W             W                W  W                              
    36   36 L Y  E     -OP  87  46E   0  491    9    Y  Y             Y                Y  Y                              
    37   37 L Q  E     -OP  86  45E   7  491   28    Q  Q             Q                Q  Q                              
    38   38 L Q  E     -O   85   0E  21  491    4    Q  Q             Q                Q  Q                              
    39   39 L K    >   -     0   0   51  490    9    K  K             K                K  K                              
    40   40 L Q  T 3  S+     0   0  190  491   19    Q  Q             Q                Q  P                              
    41   41 L G  T 3  S+     0   0   86  491   10    G  G             G                G  G                              
    42   42 L K  S <  S-     0   0  126  490   54    K  K             K                K  K                              
    43   43 L S        -     0   0   21  490   55    S  S             S                S  S                              
    44   44 L P        -     0   0    4  490   11    P  P             P                P  P                              
    45   45 L Q  E     -P   37   0E  74  490   32    Q  Q             Q                Q  Q                              
    46   46 L F  E     +P   36   0E  25  490   42    L  L             L                L  L                              
    47   47 L L  E     +     0   0E   4  490    9    L  L             L                L  L                              
    48   48 L V  E     -PQ  35  54E   0  491    5    V  V             V                V  V                              
    49   49 L Y  E >> S+ Q   0  53E  39  491   17    Y  Y             Y                Y  Y                              
    50   50 L N  T 34 S-     0   0   52  491   91    N  D             N                N  N                              
    51   51 L A  T 34 S+     0   0    3  491   45    A  A             A                A  A                              
    52   52 L K  T <4 S+     0   0  148  491   25    K  K             K                K  K                              
    53   53 L T  E  <  -Q   49   0E  47  491   67    T  T             T                T  T                              
    54   54 L L  E     -Q   48   0E  60  491   60    L  L             L                L  L                              
    55   55 L G    >   -     0   0    9  490   71    A  V             A                A  A                              
    56   56 L E  T 3  S+     0   0  192  490   35    E  E             D                D  D                              
    57   57 L G  T 3  S+     0   0   70  491    5    G  G             G                G  G                              
    58   58 L V    <   -     0   0   25  489   11    V  V             V                V  V                              
    59   59 L P    >   -     0   0   47  490    7    P  P             P                P  P                              
    60   60 L S  T 3  S+     0   0  115  491   57    S  S             S                S  S                              
    61   61 L R  T 3  S+     0   0   44  491    4    R  R             R                R  R                              
    62   62 L F  E <   +M   75   0D   5  491    1    F  F             F                F  F                              
    63   63 L S  E     -M   74   0D  55  490   22    S  S             S                S  S                              
    64   64 L G  E     +M   73   0D  13  491    2    G  G             G                G  G                              
    65   65 L S  E     +M   72   0D  63  491    5    S  S             S                S  S                              
    66   66 L G  E     -M   71   0D  36  491   14    G  G             G                G  G                              
    67   67 L S  E >   +M   70   0D  79  491    9    S  S             S                S  S                              
    68   68 L G  T 3  S-     0   0   16  491   13    G  G             G                G  G                              
    69   69 L T  T 3  S+     0   0   67  488   13    T  T             T                T  T                              
    70   70 L Q  E <   +LM  24  67D 110  489   27    Q  Q             Q                Q  Q                              
    71   71 L F  E     -LM  23  66D   2  491    6    F  F             Y                Y  Y                              
    72   72 L S  E     -LM  22  65D  26  491   30    S  S             S                S  S                              
    73   73 L L  E     -LM  21  64D   0  491    2    L  L             L                L  L                              
    74   74 L K  E     -LM  20  63D  97  491   39    K  K             K                K  K                              
    75   75 L I  E     -LM  19  62D   0  491    1    I  I             I                I  I                              
    76   76 L N  S    S-     0   0   86  491   30    N  N             N                N  N                              
    77   77 L S  S    S-     0   0   58  491   62    S  S             S                S  S                              
    78   78 L L        -     0   0    0  491   27    L  L             L                L  L                              
    79   79 L L    >   -     0   0   67  491   31    Q  Q             Q                Q  Q                              
    80   80 L P  G >  S+     0   0   92  491   58    P  P             P                P  P                              
    81   81 L E  G 3  S+     0   0  102  491   13    E  E             E                E  E                              
    82   82 L D  G <  S+     0   0    1  491    5    D  D             D                D  D                              
    83   83 L F    <   +     0   0   29  490   72    F  F             F                F  F                              
    84   84 L G  E    S- R   0 105E  17  491   23    G  G             G                G  G                              
    85   85 L S  E     -OR  38 104E  24  491   63    S  S             S                S  S                              
    86   86 L Y  E     -OR  37 103E   0  491    0    Y  Y             Y                Y  Y                              
    87   87 L Y  E     -O   36   0E   5  490    4    F  Y             Y                Y  Y                              
    88   88 L a  E     -O   35   0E   0  491    0    C  C             C                C  C                              
    89   89 L Q  E     -OS  34  99E   0  489   48    Q  Q             Q                .  .                              
    90   90 L H  E     -O   33   0E  22  483   26    H  H             H                Q  Q                              
    91   91 L H        +     0   0    0  421   89    H  H             F                H  H                              
    92   92 L Y  S    S+     0   0  104  454   88    F  Y             W                F  F                              
    93   93 L G  S    S-     0   0   34  422   71    G  .             S                W  W                              
    94   94 L T  S    S-     0   0  104  446   88    T  G             T                S  S                              
    95   95 L P  S    S+     0   0    7  443   51    .  I             P                T  T                              
    96   96 L P  S    S-     0   0   55  421   75    P  P                              P  P                              
    97   97 L L        -     0   0   21  160   88    W  F                              W  W                              
    98   98 L T        -     0   0   40  288   41    T  T                              T  T                              
    99   99 L F  B     -S   89   0E  18  290   29    F  F                              F  F                              
   100  100 L G        -     0   0    3  294   39    G  G                              G  G                              
   101  101 L G        -     0   0   52  307   63    G  S                              G  G                              
   102  102 L G        -     0   0   11  306   43    G  G                              G  G                              
   103  103 L T  E     - R   0  86E   0  366   18    T  T                              T  T                              
   104  104 L K  E     -nR  10  85E  98  363   58    S  K                              K  K                              
   105  105 L L  E     -nR  11  84E   4  343   37    L  L                              L  L                              
   106  106 L E  E     -n   12   0E 108  326   51    E  E                              E  E                              
   107  107 L I  E      n   13   0E 113  301   50    I  I                              I  I                              
   108  108 L K              0   0  145  268   18    K  K                              K  K                              
   109      ! !              0   0    0   0     0  
   110    1 H E              0   0  194  408   30  E                   EQ       Q       E            E    QQ      E      
   111    2 H V        +     0   0   19  465   12  V                   VV       V       V            V    VV      V      
   112    3 H K  E     -A  134   0A 111  467   31  K                   KK       K       Q            I    QK      Q      
   113    4 H L  E     -A  133   0A   3  489    1  L                   LL       L       L            L    LL      L      
   114    5 H Q  E     -A  132   0A  83  493   70  V                   VQ       L       V            V    QL      V      
   115    6 H E  E     +A  131   0A   5  498   21  E                   EE       E       E            E    QE      E      
   116    7 H S  E     +A  130   0A  69  501   13  S                   SS S     S       S            S    SS      S      
   117    8 H G        +     0   0   36  505    4  G                   GG G     G       G            G    GG      G      
   118    9 H G        +     0   0   29  672   48  G  GG G GGG G GGG G GGGGGGGGGGGGGGGG GG GGGGGGGGGGGG GGGGGGGG GGGGGGGG
   119   10 H D        -     0   0   96  677   40  G  DG D DDD G DDG G GGGDGDDDDGDGGDGG DG GGGDGDGGDGGDDGDDGGGGG GGGGGGGG
   120   11 H L  E     +e  224   0B  79  675   16  L  LL L LLL L LLL L LLLLLLLLLLLLLLLL LL LLLLLLLLLLLLLLLLLLLLL LLLLLLLL
   121   12 H V  E     -e  225   0B  16  677   33  V  VV V VVV V VVV V VVVVVVVVVVVVVVVV VV VVVVVVVVVLVVVVVVVVVVV VVVVVVVV
   122   13 H Q    >   -     0   0  114  679   51  Q  KK K KKK K KKQ Q QQQKQKKKKKKKKKKQ KK KQKKKKQKKKKKKQKKKKKQK QKQQQQKQ
   123   14 H P  T 3  S+     0   0   66  678    9  P  PP P PPP P PPP P PPPPPPPPPPPPPPPP PP PPPPPPPPPPPPPPPPPPPPP PPPPPPPP
   124   15 H G  T 3  S+     0   0   58  682   32  GG GG G GGG G GGGGG GGGGGGGGGGGGGGGG GG GGGGGGGGGGGGGGGGGGGGG GGGGGGGG
   125   16 H G    <   -     0   0   25  684   63  GG GG G GGG GGGGGGG GGGGGGGGGGGGGGGG GG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
   126   17 H S        +     0   0   78  683   31  SS SS S SSS SSSSSSS SSSSSSSSSSSSSSSS SS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSS
   127   18 H L  E     - B   0 192A  25  685   25  LL LL L LLL LLLLLLL LLLLLLLLLLLLLLLL LL LLLLLLLLLLLLLLLLLLLLLLLLLRRLLL
   128   19 H K  E     - B   0 191A  93  683   56  KK KK K KKK KKKKKKK KKKKKKKKKKKKKKKK KK KKKKKKKKKTKKKKKKKKKKKKKKKKKKKK
   129   20 H L  E     - B   0 190A   0  688   14  LL LL LLLLLLLLLLLLL LLLLLLLLLLLLLLLL LL LLLLLLLLLLLLLLLVLLLLLLVLLLLLLL
   130   21 H S  E     -AB 116 189A  28  688   37  SS SS SSSSSSSSSSSSS SSSSSSSSSSSSSSSS SS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSS
   131   22 H b  E     -AB 115 188A   0  688    0  CC CC CCCCCCCCCCCCC CCCCCCCCCCCCCCCC CC CCCCCCCCCCCCGCCCCCCCCCCCCCCCCC
   132   23 H A  E     -AB 114 187A  52  688   66  AA AA AAAAAAAAAAAAA AAAAAAAAAAAAAAAA AA AAAAAAAAAAAAAAAAAAAAAAVAAAAAAA
   133   24 H A  E     +A  113   0A   8  688   49  AA AA AAAAAAAAAAAAA AAAAAAAAAAAAAAAA AA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
   134   25 H S  E     +A  112   0A  58  688   12  SS SS SSSSSSSSSPSSS SSSSSSSSSSSSSSSS SS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSS
   135   26 H G  S    S+     0   0   56  688    4  GG GG GGGGGGGGGGGGG GGGGGGGGGGGGGGGG GG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
   136   27 H F  S    S-     0   0   33  686   34  FF FF FFFFFFFFFFFFF FFFFFFFFFFFFFFFF FF FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
   137   28 H T    >   -     0   0   93  687   50  TA TA TTTTTTTTTTTTT TTTTTTTTTTTTTTTT TT TTTTTTTTTTTTSTTTTTTTTPTSTTTTTT
   138   29 H F  G >  S+     0   0    2  688   41  FF FF FFFFFFFFFFFFF FFFFFFFFFFFFFFFF FF FFFFFFFFFFFFFFFFFFFFFFFFLFFLFL
   139   30 H S  G 3  S+     0   0   57  688   55  SS SS SSSSSSSSSSSSS SSSSSSSSSSSSSSSS SS SSSSSSSSSSSSSSSSSSSSSSSNSSSSSS
   140   31 H S  G <  S+     0   0   71  688   60  SS SS SSSSSSSDSSSSS SNSSSSSSSTSDDSDS SS SSDSNSSSSDSSDSSSRDDSSSSNHTSHDH
   141   32 H Y  S <  S-     0   0   44  688   41  YY YY YYYYYYYYYYYYY YYYYYYYYYYYYYYYY YY YYYYYYYYYYYYYYYYYFYYYYYYCFFCYC
   142   33 H T        -     0   0   30  688   91  TD GD GTGGGGGYGGGGG TGGAGGGGATGYYGYG GA TGYGAGGAGYTGAGGGVYYGAAGDGGGGYG
   143   34 H M  E     -FG 207 160C   0  672   46  MM MM MMMMMMMMMMMMM MMMMMMMMMMMMMMMM MM MMMMMMMMMMMMMMMMMMMMMMMMMMMMMM
   144   35 H S  E     -FG 206 159C   0  685   73  SS SS SSSSSSSYSSSSS SSSSSSSSSSSYYSYS SS SSYSSSSSPYSSSSSSSYYSSSSSSHHSYS
   145   36 H W  E     +FG 205 158C   0  688    0  WW WW WWWWWWWWWWWWW WWWWWWWWWWWWWWWW WW WWWWWWWWWWWWWWWWWWWWWWWWWWWWWW
   146   37 H V  E     -FG 204 156C   0  688   19  VV VV VVVVVVVVVVVVV IVVVVVVVVVVVVVVV VV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVV
   147   38 H R  E     -FG 203 155C  10  688   17  RR RR RRRRRRRRRRRRR RRRRRRRRRRRRRRRR RR RRRRRRRRRRRRRRRRRRRRRRRRRRRRRR
   148   39 H Q  E     -FG 202 154C   9  688    3  QQ QQ QQQQQQQQQQQQQ QQQQQQQQQQQQQQQQ QQ QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ
   149   40 H T    >   -     0   0    9  688   68  TT TT TTTTTTTTTTTTT TTTSTTTTSTTTTTTT TT TTTTTTTTTTTTTTTTTTTTSTTTTAATTT
   150   41 H P  T 3  S+     0   0   80  687   10  PP PP PPPPPPPPPPPPP PPPPPPPPPPPPPPPP PP PPPPPPPPPPPPPPPPPPPPPPPPPPPPPP
   151   42 H E  T 3  S-     0   0  151  688   26  EE DE DEDDDDDEDDDDD EDDEDDDDEEDEEDED DE EDEDEDDEDEEDEDDDEEEDEEDEDEEDED
   152   43 H K    <   +     0   0  121  688   32  KK KK KKKKKKKKKKKKK KKKKKKKKKKKKKKKK KK KKKKKKKKKKKRKKKKKKKKKKKKKKKKKK
   153   44 H R        -     0   0  113  687   43  RR RR RRRRRRRRRRRRR RRRRRRRRRRRRRRRR RR RRRRRRRRRRRRRRRRRRRRRRRRRGGRRR
   154   45 H L  E     -G  148   0C   9  688   14  LL LL LLLLLLLLLLLLL LLLLLLLLLLLLLLLL LL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLL
   155   46 H E  E     -G  147   0C  44  687    5  EE EE EEEEEEEEEEEEE EEEEEEEEEEEEEEEE EX EEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
   156   47 H W  E     +G  146   0C  15  687   11  WW WW WWWWWWWWWWLWL WFLWLWWWWWWWWWWL WX WLWWWWLWWWWWWLWWWWWLWWLWLWWLWL
   157   48 H V  E     -     0   0C   0  687   28  VV VV VVVVVVVVVVVVV VVVVVVVVVVVVVVVV VV VVVVVVVVVVVVVVVVVVVVVVVVVVVVVV
   158   49 H A  E     -G  145   0C   0  688   38  AA AA AAAAAAAAAAAAA AAAAAAAAAAAAAAAA AA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
   159   50 H S  E     -GH 144 168C   0  688   94  YY TY TTTTTTTTTTTTT YNTETTTTETTTTTTT TT TTTTTTTTTTTTTTTTTTTTETTYTYYTTT
   160   51 H I  E     -GH 143 167C   4  675   18  II II IIIIIIIIIIIII IIIIIIIIIIIIIIII II IIIIFIIIIIIIIIIIIIIIIIIIIIIIII
   161   52 H N    >   -     0   0   47  682   84  SS SS SSNSSSSSSSNSN SNNSNSSSSSSSSSSN SS SNSSSSNSSSSSSNSTSSSDSINSNSSYSY
   162   53 H N  T 3  S+     0   0   65  684   88  NS SS SSNSSSSDSSSSS DGSNSSSSNSSDDSDS SS SSDGSSSSSDSGSSGSSDDSSSHTHSSHDH
   163   54 H G  T 3  S-     0   0   65  686   68  GG GG GGGGGGGGGGNGN GNNGNGGGGGGGGGGN GG GNGGDGNGGGGGGNGGGGGYGGKGGGGGGG
   164   55 H G  S <  S+     0   0   30  687   43  GG GG GGGGGGGGGGGGG GGGGGGGGGGGGGGGG GG GGGGGGGGGGGGGGGGGGGGGGGDGSSGGG
   165   56 H G  S    S+     0   0   74  688   63  GG SG SSSSSSSSSSGSG GGGGGSSSGSSSSSSG SS SGSSSSGSSSGSSGSSSSSFSVDGGSSGSG
   166   57 H R        +     0   0  163  505   86  SS YS YYYYYYYYYYSYS SKSYSYYYYYYYYYYS YY YSYYYYSYYYNYYSYYYYYTYYSNDTTGYG
   167   58 H T  E     -H  160   0C  62  677   52  TT TT TTTTTTTTTTTTT TTTTTTTTTTTTTTTT TT TTTTTTTTTTTTTTTTTTTTTTTTTIITTT
   168   59 H Y  E     +H  159   0C  53  686   85  YY YY YYYYYYYYYYYYY YYYYYYYYYYYYYYYY YY YYYYYYYYYYYYYYYYYSYYYYYYYYYYYY
   169   60 H Y        -     0   0   44  688    9  YY YY YYYYYYYYYYYYY YYYYYYYYYYYYYYYY YY YYYYYYYYYYYYCYYYFYYYYYYYYYYYYY
   170   61 H P    >>  -     0   0   20  688   65  PP PP PPPPPPPPPPPPP PPPPPPPPPSPPPPPP PP PPPPPPPPPPPPPPPPPPPPPPSPPAAPPP
   171   62 H D  T 34 S+     0   0  148  688   64  DD DD DDDDDDDDDDDDD DGDDDDDDDDDDDDDD DD DDDDDDDDDDDDDDDDDDDDDDDDDDDDDD
   172   63 H T  T 34 S+     0   0   90  688   57  TT ST SSSSSSSSSSSSS TSSTSSSSTSSSSSSS SS SSSSSSSSSSSSTSSSSSSSTSSTSTTSSS
   173   64 H V  T X> S+     0   0    1  688   42  VV VV VVVVVVVVVVVVV LVVMVVVVMVVVVVVV VV VVVVVVVVVVVVVVVVVVVMVVVVVVVVVV
   174   65 H K  B 3< S+c  177   0A 142  687   31  KK KK KKKKKKKKKKKKK KKKTKKKKTKKKKKKK KK RKKKKKKKKKKKKKKKKKKKTKKKKKKKKK
   175   66 H G  T 34 S+     0   0   74  687   36  GG GG GGGGGGGGGGGGG GGGGGGGGGGGGGGGG GG GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
   176   67 H R  T <4 S+     0   0   36  688   17  RR RR RRRRRRRRRRRRR RRRRRRRRRRRRRRRR RR RRRRRRRRRRRRRRRRRRRRRRRRRRRRRR
   177   68 H F  E  <  -cD 174 192A   2  688   60  FF FF FFFFFFFFFFFFF FFFFFFFFFFFFFFFF FF FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
   178   69 H T  E     - D   0 191A  79  688   38  TT TT TTTTTTTTTTTTT TTTTTTTTTTTTTTTT TT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
   179   70 H I  E     + D   0 190A   5  688   20  II II IIIIIIIIIIIII VIIVIIIIVIIIIIII II IIIIIIIIIIIIIIIIIIIIIIIIIIIIII
   180   71 H S  E     - D   0 189A  51  684   41  SS SS SSSSSSSSSSSSS SSSSSSSSSSSSSSSS SS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSS
   181   72 H R  E     - D   0 188A  30  687   60  RR RR RRRRRRRRRRRRR RRRRRRRRRRRRRRRR RR RRRRRRRRRRRRRRRRRRRRRRRRRRRRRR
   182   73 H D  E > > - D   0 187A  60  686    7  DD DV DDDDDDDDDDDDD DDDDDDDDDDDDDDDD DD DDDDDDDDDDDDDDDDDDDDDDDDDDDDDD
   183   74 H N  G > 5S+     0   0   48  688   57  NN NN NNNNNNNNNNNNN NNNNNNNNNNNNNNNN NN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
   184   75 H A  G 3 5S+     0   0   99  688   45  AA AA AAAAAAAAAAAAA AAAAAAAAAAAAAAAA AA AAAAAAAAAAAAAAAAAAAAAAAAAPPAAA
   185   76 H K  G < 5S-     0   0  111  688   51  KK KK KKKKKKKKKKKKK KKKKKKKKKKKKKKKK KK KRKKKKKKKKKKKKKKKKKRKKKKNKKNKN
   186   77 H N  T < 5 +     0   0   62  688   46  NN NN NNNNNNNNNNNNN NNNNNNNNNNNNNNNN NN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
   187   78 H T  E   < -BD 132 182A  16  688   69  NT TT TTTTTTTNTTTTT TTTITTTTITTNNTNT TT TTNTTTTTTNNTTTTTTNNTTITTTTTTNT
   188   79 H L  E     -BD 131 181A   0  687   56  LL LL LLLLLLLLLLLLL LLLLLLLLLLLLLLLL LL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLL
   189   80 H Y  E     -BD 130 180A  41  687   46  YY YY YYYYYYYYYYYYY YYYYYYYYYYYYYYYY YY YYYYYYYYYYYYYYYYYYYYYYYYYFFYYY
   190   81 H L  E     -BD 129 179A   0  687    7  LL LL LLLLLLLLLLLLL LLLLLLLLLLLLLLLL LL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLL
   191   82 H Q  E     -BD 128 178A  76  687   41  QQ QQ QQQQQQQQQQQQQ QQQEQQQQEQQQQQQQ QQ QQQQQQQQQQQQQQQQQLQQEQQQQQQQQQ
   192   83 H M  E     +BD 127 177A   0  688   11  MM MM MMMMMMMMMMMMM MMMMMMMMMMMMMMMM MM MMMMMMMMMMMMMMMMMMMMMMMMMMMMMM
   193   84 H S        +     0   0   42  688   54  SS SS SSSSSSSSSSSSS SSSSSSSSSSSSSSSS SS SSSSSSSSSSSSSSSSSSSSSSSNSTTSSS
   194   85 H S  S    S-     0   0   68  687   24  SS SS SSSSSSSSSSSSS SSSSSSSSSSSSSSSS SS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSS
   195   86 H L        -     0   0    3  686   18  LL LL LLLLLLLLLLLLL LLLLLLLLLLLLLLLL LL LLLLLLLLLLLLLLLLLLLLLLLLLLLLLL
   196   87 H K    >   -     0   0  102  686   68  KK KK KKKKKKKKKKKKK KKKRKKKKRKKKKKKK KR KKRKRKKRKKRKRKKKRKKKRRKKRRRRKR
   197   88 H S  G >  S+     0   0   70  686   60  SS SS SSSSSSSSSSSSS SSSSSSSSSSSSSSSS SS SSSSSSSSSSSSSSSSSSSSSSSSSSSSSS
   198   89 H E  G 3  S+     0   0  126  687   22  EE EE EEEEEEEEEEEEE EEEEEEEEEEEEEEEE EE EEEEEEEEEEEEDEEEEEEEEEEEEEEEEE
   199   90 H D  G <   +     0   0    2  687    3  DD DD DDDDDDDDDDDDD DDDDDDDDDDDDDDDD DD DDDDDDDDDDDDDDDDDDDDDDDDDDDDDD
   200   91 H T    <   +     0   0   32  688   28  TT TT TTTTTTTTTTTTT TTTTTTTTTTTTTTTT TT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
   201   92 H A  E    S- I   0 223C   8  686    5  AA AA AAAAAAAAAAAAA AAAAAAAAAAAAAAAA AA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
   202   93 H M  E     -FI 148 222C  58  687   48  MM MM MMMMMMMMMMMMM MMMMMMMMMMMMMMMM MM MMMMMMMMMMLMMMVMMMMMMMMMTMMTMT
   203   94 H Y  E     -FI 147 221C   0  688    1  YY YY YYYYYYYYYYYYY YYYYYYYYYYYYYYYY YY YYYYYYYYYYYYYYYYYYYYYYYYYYYYYY
   204   95 H Y  E     -F  146   0C   7  688    4  YY YY YYYYYYYYYYYYY YYYYYYYYYYYYYYYY YY YYYYYYYYYYYYYYYYYYYYYYYYYYYYYY
   205   96 H b  E     -F  145   0C   0  688    1  CC CC CCCCCCCCCCCCC CCCCCCCCCCCCCCCC CC CCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
   206   97 H V  E     -FJ 144 217C   0  688   23  AA AA ATAAAAAAAAAAA AVAVAAAAVTAAAAAA AA TAAAAAAANAAAAAAAVAAAAAVAAAATAA
   207   98 H R  E     -FJ 143 216C  21  687   40  Rr Rr RRRRrRRRsrrrR IRRrLrrrrRrRrrrr Rr rRrRRrrrYrRRRrRrrRrrrrrrrrrrrr
   208   99 H H  E     + J   0 214C   6  583   92   y Hr HDQHg.H.ygey. .VVy.ddgyGg.vywy Hg r.w..gpv.gY..d.ngDskytygyggyay
   209  100 H E  E  >  + J   0 213C  63  625   78   R DR GPRES.SVDSTDD NAGDLGGSDGSDRDGG GS EDGQPNAR.NYQQGQYSRSPGSGSSEGSYS
   210  101 H Y  T >4 S-     0   0   80  658   93   Y YY YRFAS.YWYSVYY FFDFRHYSFNGGGWYN DS SRYGYWYQRHRGKNGRSGGYNGNSDNNDDD
   211  102 H Y  T 34 S-     0   0  140  672   23   Y YY yLyMYHYYYYYYY YdYYYFYYYYYLYYYY yY fFYfrYyYYYyfeFfyYYyFYYyYyYYyyy
   212  103 H Y  T 34 S+     0   0   39  265   92   Y YY y.y..E.YY.... .yD.W..........G vY t..vg.s.DYavd.vg.Ga.AWp.yYFydy
   213  104 H A  E <<  -J  209   0C   0  403   87   A AA YAD.AA.AAA.AP GYWSY..YS.WRA..G GA WG.VA.WYGAWVA.VAYDWGWYYWYAAYWF
   214  105 H M  E     +J  208   0C   0  497   62   M MM FLV.MM.MMMFMF MDFMF.GFMGFMMFFF FM FLFVMFFFFMFVMFVFFFFLFFFFFMMFFF
   215  106 H D  E     +     0   0C  19  615   50   D DD DDADDD.DDDDDA DDADDDGDDIADDDDA AD AADDDDADADADDADDDDADADDPDDDDAD
   216  107 H Y  E     -J  207   0C  99  624   65   Y YY YYYYYYYYYYYYY SFYYVYYYYYYYYVYY YY YYYYYVYYYYSYYYYYYYYYYVYYYYYYYY
   217  108 H W  E     -J  206   0C  23  675    2   W WW WWWWWWWWWWWWW WWWWWWWWWWWWWWWW W  WWWWWWWWWWWWWWWWWWWWWWWWWWWWWW
   218  109 H G        -     0   0    0  664   17   G GG GGGGGGGGGGGGG GGGGGGGGGGGGGGGG G  GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
   219  110 H Q        -     0   0   91  659   46   Q QQ QQQQQQQQQQQQQ QQQQAQQQQQQQQAQQ Q  QQQQQAQQQQQQQQQQRQQQQAQQQQQQQQ
   220  111 H G        -     0   0   16  650   16   G GG GGGGGGGGGGGGG GGGGGGGGGGGGGGGG G  GGGDGGGGGGGDGGDGGGGGGGGGGGGGGG
   221  112 H T  E     -I  203   0C  21  594   27   T TT TTTTTTTTTTTTT TTTTTTTTTTTTTTTT T  TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
   222  113 H T  E     -I  202   0C  72  593   76   S SS TTLSSSTSSSTSL STLSTTTTSTLSSTTL L  LLTTSTLTLSLTSLTTTTLSLTFLTSSTLT
   223  114 H V  E     -I  201   0C   0  596   20   V VV LLVVVVLVVVLVV VVVVVLLLVLVVVVLV V  VVLLVVVLVVVLVVLLLLVVVVLVLIVLVL
   224  115 H T  E     -e  120   0B  36  593   20   T TT TTTTTTTTTTTTT TTTTTTTTTTTTTTTT T  TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
   225  116 H V  E     +e  121   0B   6  572    6   V VV VVVVVVVVVVVVV VVVVVVVVVVVVVVVV V  VVVVVVVVVVVVVVVVVVVVVVVVVVVVVV
   226  117 H S        -     0   0   36  566   11   S SS SSSSSSSSSSSSS SSSSSSSSSSSSSSSS S  SSSSSSSSSSSSSSSSSSSSSSSSSSSSSS
   227  118 H S  S    S+     0   0   84  551   22   S SS SSASSSSSSSSSA SSASSSSSSSASSSSA A  AASSSSASASASSASSSSASASS SSSSAS
   228  119 H A  S    S+     0   0   70  123   53                      A                                  G              
   229  120 H W        -     0   0  123   73   63                      K                                                 
   230  121 H R        +     0   0  207   60   75                      T                                                 
   231  122 H H              0   0  156   54   67                      T                                                 
   232  123 H P              0   0  155   35   53                      P                                                 
## ALIGNMENTS   71 -  140
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....8....:....9....:....0....:....1....:....2....:....3....:....4
     1    1 L D              0   0  183  420   16   D               D          DD       DDDD          DD       DD  DD DD 
     2    2 L I        -     0   0   32  462   11   I               I          II       IIII          III      II  II II 
     3    3 L E        -     0   0  117  463   68   Q               Q          QQ       QQQQ          QQQ      QQ  QQ QQ 
     4    4 L L  E     -K   25   0D  10  474    7   M               M          LM       MMMM          MMM      MM MMM MM 
     5    5 L T  E     -K   24   0D  64  475    8   T               T          TT       TTTT          TTT      TT TTT TT 
     6    6 L Q  E     -K   23   0D  13  475    0   Q               Q          QQ       QQQQ          QQQ      QQ QQQ QQ 
     7    7 L T  E    S+K   22   0D  64  475   34   S               S          SS       SSSS          SSS      SS SSS SS 
     8    8 L P        -     0   0   46  480    9   P               P          PP       PPPP          PPP      PP PPP PP 
     9    9 L V  S    S+     0   0   96  484   67   A               A          SS       SSSS          SSS      SS SAS SS 
    10   10 L S  E     -n  104   0E  60  485   43   S               S          SS       SSSS          PSS      SS SSS SS 
    11   11 L L  E     -n  105   0E  58  489   21   L               L          LL       LLLL          LLL      LL LLL LL 
    12   12 L S  E     +n  106   0E  60  490   42   S               S          SS       SSSS          SSS      SS SSS SS 
    13   13 L A  E     -n  107   0E   0  490   58   A               A          AA       AAAA          AAA      AA AAA AA 
    14   14 L S    >   -     0   0   47  491   29   S               S          SS       SSSS          SSS      SS SSS SS 
    15   15 L V  T 3  S+     0   0   76  491   66   L               L          VV       VVVV          MVV      VV VLV VV 
    16   16 L G  T 3  S+     0   0   42  491    4   G               G          GG       GGGG          GGG      GG GGG GG 
    17   17 L E    <   -     0   0   71  491   35   E               E          DD       DDDD          EDD      DD DED DD 
    18   18 L T        -     0   0   69  491   62   T               T          RR       RRRR          TRR      RR RTR RR 
    19   19 L V  E     - L   0  75D  11  491   37   V               V          VV       VVVV          VVV      VV VVV VV 
    20   20 L T  E     - L   0  74D  67  490   30   T               T          TT       TTTT          TTT      TT TTT TT 
    21   21 L I  E     - L   0  73D   1  489   17   I               I          II       IIII          III      II III II 
    22   22 L T  E     -KL   7  72D  29  489   58   E               E          TT       TTTT          TTT      TT TET TT 
    23   23 L a  E     -KL   6  71D   0  490    1   C               C          CC       CCCC          CCC      CC CCC CC 
    24   24 L R  E     -KL   5  70D 110  490   45   L               R          RR       RRRR          LRR      RR RLQ RR 
    25   25 L A  E     -K    4   0D  10  490   29   A               A          AA       AAAA          AAA      AA AAA AA 
    26   26 L S  S    S+     0   0   66  490    4   S               S          SS       SSSS          SSS      SS SSS SS 
    27   27 L E  S    S-     0   0  101  490   38   E               E          QE       QQQQ          QQQ      QQ QEQ QQ 
    28   28 L N        +     0   0   83  490   45   D               D          GN       GTGG          KSG      SG SDG SS 
    29   29 L I    >   -     0   0    5  491   32   I               I          IV       IIII          III      II III VI 
    30   30 L Y  T 3   -     0   0  155  491   81   Y               Y          SN       SSSS          YSS      SS SYS SS 
    31   31 L S  T 3  S+     0   0   53  467   65   D               N          SN       SSSS          GNS      SN SDN NS 
    32   32 L Y    <   +     0   0   63  490   52   I               G          YY       YYYY          NYY      YY YIN YW 
    33   33 L L  E     -O   90   0E   0  490    7   L               L          LL       LLLL          LLL      LL LLL LL 
    34   34 L A  E     -O   89   0E   0  490   71   A               A          AH       AAAA          ASA      NA NAA SA 
    35   35 L W  E     -OP  88  48E   1  491    0   W               W          WW       WWWW          WWW      WW WWW WW 
    36   36 L Y  E     -OP  87  46E   0  491    9   Y               Y          YY       YYYY          YYY      YY YYY YY 
    37   37 L Q  E     -OP  86  45E   7  491   28   Q               Q          QQ       QQQQ          QQQ      QQ QQQ QQ 
    38   38 L Q  E     -O   85   0E  21  491    4   Q               Q          QQ       QQQQ          QQQ      QQ QQQ QQ 
    39   39 L K    >   -     0   0   51  490    9   K               K          KK       KKKK          KKK      KK KKK KK 
    40   40 L Q  T 3  S+     0   0  190  491   19   P               P          PP       PPPP          QPP      PP PPP PP 
    41   41 L G  T 3  S+     0   0   86  491   10   G               G          GG       GGGG          EGA      GG GGG GG 
    42   42 L K  S <  S-     0   0  126  490   54   K               K          KK       KKKK          GKK      KK KKK KK 
    43   43 L S        -     0   0   21  490   55   S               S          AA       AVAA          SAA      AV ASA AA 
    44   44 L P        -     0   0    4  490   11   P               P          PP       PPPP          PPP      PP PPP PP 
    45   45 L Q  E     -P   37   0E  74  490   32   Q               Q          KK       KKKK          NKK      KK KQK KK 
    46   46 L F  E     +P   36   0E  25  490   42   L               L          LL       LLPP          LLL      LS LLL LL 
    47   47 L L  E     +     0   0E   4  490    9   L               L          LL       LLLL          LLL      LL LLL LL 
    48   48 L V  E     -PQ  35  54E   0  491    5   I               I          II       IIII          III      II III II 
    49   49 L Y  E >> S+ Q   0  53E  39  491   17   Y               Y          YY       YYYY          YYY      YY YYY YY 
    50   50 L N  T 34 S-     0   0   52  491   91   D               N          KA       AAYY          DDY      AA ADK AA 
    51   51 L A  T 34 S+     0   0    3  491   45   A               A          AA       AAAA          AAA      AA AAA AA 
    52   52 L K  T <4 S+     0   0  148  491   25   S               N          SS       SSSS          ASS      SS SSS SS 
    53   53 L T  E  <  -Q   49   0E  47  491   67   S               S          ST       SSNN          STS      ST SST SS 
    54   54 L L  E     -Q   48   0E  60  491   60   L               L          LL       LLLL          LLL      LL LLL LL 
    55   55 L G    >   -     0   0    9  490   71   H               H          QQ       QEEE          AQQ      QQ QHQ QQ 
    56   56 L E  T 3  S+     0   0  192  490   35   T               T          SS       SSSS          DSS      SS STS SS 
    57   57 L G  T 3  S+     0   0   70  491    5   G               G          GG       GGGG          GGG      GG GGG GG 
    58   58 L V    <   -     0   0   25  489   11   V               V          VV       VVVV          VVV      VV VVV VV 
    59   59 L P    >   -     0   0   47  490    7   P               P          PP       PPPP          PPP      PP PPP PP 
    60   60 L S  T 3  S+     0   0  115  491   57   S               S          SS       SSSS          SSS      SS SSS SS 
    61   61 L R  T 3  S+     0   0   44  491    4   R               R          RR       RRRR          RRR      RR RRR RR 
    62   62 L F  E <   +M   75   0D   5  491    1   F               F          FF       FFFF          FFF      FF FFF FF 
    63   63 L S  E     -M   74   0D  55  490   22   S               S          SS       SSSS          SSS      SS SSS SS 
    64   64 L G  E     +M   73   0D  13  491    2   G               G          GG       GGGG          GGG      GG GGG GG 
    65   65 L S  E     +M   72   0D  63  491    5   S               S          SS       SSSS          SSS      SS SSS SS 
    66   66 L G  E     -M   71   0D  36  491   14   G               G          GG       GGGG          GGG      GG GGG GG 
    67   67 L S  E >   +M   70   0D  79  491    9   S               S          SS       SSSS          SSS      SS SSS SS 
    68   68 L G  T 3  S-     0   0   16  491   13   G               G          GG       GGGG          CGG      GG GGG GG 
    69   69 L T  T 3  S+     0   0   67  488   13   T               T          TT       TTTT          TTT      TT TTT TT 
    70   70 L Q  E <   +LM  24  67D 110  489   27   Q               Q          ED       DEEE          KDE      DD DQD DD 
    71   71 L F  E     -LM  23  66D   2  491    6   Y               Y          FF       FFFF          FFF      FF FYF FF 
    72   72 L S  E     -LM  22  65D  26  491   30   S               S          TT       TTTT          STT      TT TST TT 
    73   73 L L  E     -LM  21  64D   0  491    2   L               L          LL       LLLL          LLL      LL LLL LL 
    74   74 L K  E     -LM  20  63D  97  491   39   K               K          TT       TTTT          KTT      TT TKT TT 
    75   75 L I  E     -LM  19  62D   0  491    1   I               I          II       IIII          III      II III II 
    76   76 L N  S    S-     0   0   86  491   30   N               N          SS       SSSS          SSS      SS SNS SS 
    77   77 L S  S    S-     0   0   58  491   62   S               S          SS       SSSS          SSS      SS SSS SS 
    78   78 L L        -     0   0    0  491   27   L               L          LL       LLLL          LLL      LL LLL LL 
    79   79 L L    >   -     0   0   67  491   31   Q               Q          QQ       QQQQ          QQQ      QQ QQQ QQ 
    80   80 L P  G >  S+     0   0   92  491   58   P               S          PP       PPPP          PPP      PP PPP PP 
    81   81 L E  G 3  S+     0   0  102  491   13   E               E          EE       EEEE          EEE      EE EEE EE 
    82   82 L D  G <  S+     0   0    1  491    5   D               D          DD       DDDD          DDD      DD DDD DD 
    83   83 L F    <   +     0   0   29  490   72   F               V          FV       FFFF          AFF      FV FFF FF 
    84   84 L G  E    S- R   0 105E  17  491   23   A               A          AA       AAAA          AAA      AA AAA AA 
    85   85 L S  E     -OR  38 104E  24  491   63   S               S          VT       TTTT          ITT      TT TST TT 
    86   86 L Y  E     -OR  37 103E   0  491    0   Y               Y          YY       YYYY          YYY      YY YYY YY 
    87   87 L Y  E     -O   36   0E   5  490    4   Y               F          YY       YYYY          YYY      YY YYY YY 
    88   88 L a  E     -O   35   0E   0  491    0   C               C          CC       CCCC          CCC      CC CCC CC 
    89   89 L Q  E     -OS  34  99E   0  489   48   Q               Q          QQ       QQQQ          QQQ      QQ QQQ QQ 
    90   90 L H  E     -O   33   0E  22  483   26   N               Q          QH       QQQQ           RQ      QK QNH HQ 
    91   91 L H        +     0   0    0  421   89                   Y           S                      G       S. SGG GH 
    92   92 L Y  S    S+     0   0  104  454   88                   Y           Y                      Y       YY YLY YN 
    93   93 L G  S    S-     0   0   34  422   71                   D           G                      G       .N .S  GS 
    94   94 L T  S    S-     0   0  104  446   88                               T                      T       .S SA  TY 
    95   95 L P  S    S+     0   0    7  443   51                               P                              SA TP   P 
    96   96 L P  S    S-     0   0   55  421   75                               P                              TP PR   P 
    97   97 L L        -     0   0   21  160   88                                                              LR VT     
    98   98 L T        -     0   0   40  288   41                                                              TT TC     
    99   99 L F  B     -S   89   0E  18  290   29                                                              FF FF     
   100  100 L G        -     0   0    3  294   39                                                              GG GG     
   101  101 L G        -     0   0   52  307   63                                                              GP QW     
   102  102 L G        -     0   0   11  306   43                                                              GG GP     
   103  103 L T  E     - R   0  86E   0  366   18                                                              TT TL     
   104  104 L K  E     -nR  10  85E  98  363   58                                                              KK RA     
   105  105 L L  E     -nR  11  84E   4  343   37                                                              VL LI     
   106  106 L E  E     -n   12   0E 108  326   51                                                              EE EE     
   107  107 L I  E      n   13   0E 113  301   50                                                              II II     
   108  108 L K              0   0  145  268   18                                                              KK K      
   109      ! !              0   0    0   0     0  
   110    1 H E              0   0  194  408   30      E D       EE  E    E  EE  E   EEE         E EEE   EE E    E   E  E
   111    2 H V        +     0   0   19  465   12      V V      VVV  V   VVVVVV  V VVVVV       VVVVVVE   VV VVV  V   E  V
   112    3 H K  E     -A  134   0A 111  467   31      M Q      QQQ  Q   QQQQQQ  Q QQQQQ       QQQQQQQ   QK QQQ  Q   Q  Q
   113    4 H L  E     -A  133   0A   3  489    1      L L      LLV  L   LLLLLL  L LLLLL       LLLLLLL   LL LLL  L   L  L
   114    5 H Q  E     -A  132   0A  83  493   70      V V      VLV  L   VVVVLL  V VVVVV       VVVVVVV   VL VVV  V   V  V
   115    6 H E  E     +A  131   0A   5  498   21  E   E E      EEE  E   EEEEEE  E EEEEE       EEEEEEE   EE EEE  E   E  E
   116    7 H S  E     +A  130   0A  69  501   13  S   S S      SSS  S   SSSSSS  S SSSSS       SSSSSSS   SS SSS  S   S  S
   117    8 H G        +     0   0   36  505    4  G   G G      GGD  G   GGGGGG  G GGGGG       GGGGGGG   GG GGG  G   G  G
   118    9 H G        +     0   0   29  672   48  G  GGGGGGGGGGGGGG GGGGGGGGGG  GGGGGGG    GGGGGGGGGG   GGGGGG  G   G  G
   119   10 H D        -     0   0   96  677   40  D  DGGGGDGGSGGGGG GGGDGGGGGG  GGGGGGG    GGGGGGGGGG   GGGGGG  G   G  G
   120   11 H L  E     +e  224   0B  79  675   16  L  LLLLLLLLLLLLLL LLLLLLLLLL  LLLVVLL    LLLVVVVVLL   LLLLLL  L   L  L
   121   12 H V  E     -e  225   0B  16  677   33  V  VVVVVVVVVVVVVV VVVVIVVVVV  VVVVVVV    VVVVVVVVVV   VVVVVV  V   V  V
   122   13 H Q    >   -     0   0  114  679   51  R  KKQQQKQQQQQQQQ QQQKQQQQQQ  QQQQRQQ    QQQQQQQQQL   QQQKQQ  Q   Q  Q
   123   14 H P  T 3  S+     0   0   66  678    9  P  PPPPPPPPPPPPPR PPPPPPPPPP  PPPPPPP    PPPPPPPPPP   PPPPPP  P   P  P
   124   15 H G  T 3  S+     0   0   58  682   32  G  GGGGGGGGGGGGGG GGGGGGGGGG  EGGGGGG    GGGGGGGGGG   GGGGGG  G   G  G
   125   16 H G    <   -     0   0   25  684   63  G  GGGGGGGGGGGGRG GGGGGGGGGG  GGGGGRR    EGGRRGRRGG   GGGGGG  G   G  G
   126   17 H S        +     0   0   78  683   31  S  SSSSSSSSSSSSSS SSSSSSSSSS  SSSSSSS    SSSSSSSSSS   SSSSSS  S   S  S
   127   18 H L  E     - B   0 192A  25  685   25  L  LLRRRLRRRRLLLR LRRLLLLLLL  LRLLLLL    LRLLLLLLLL   LLRLLL  L   L  L
   128   19 H K  E     - B   0 191A  93  683   56  R KKKKKKKKKKKRRKK RKKKRRRRRR  RKRRRKK    KKKRRRRRRR   RKKRRR  R   R  R
   129   20 H L  E     - B   0 190A   0  688   14  L LLLLLLLLLLLLLLL LLLLLLLLLL  LLLLILL    LLLLLLLLLL   LLLLLL  L   L  L
   130   21 H S  E     -AB 116 189A  28  688   37  S SSSSSSSSSSSSSPS SSSSSSSSSS  SSSSSSS    SSSSSSSSSS   SSSSSS  S   S  S
   131   22 H b  E     -AB 115 188A   0  688    0  C CCCCCCCCCCCCCCC CCCCCCCCCC  CCCCCCC    CCCCCCCCCC   CCCCCC  C   C  C
   132   23 H A  E     -AB 114 187A  52  688   66  A AATAAAAAAAAVAAA AAASAAAAAA  AAAAAAA    EAAAVAAAAA   AAATAA  A   A  A
   133   24 H A  E     +A  113   0A   8  688   49  A AAAAAAAAAAAAAAA AAAAAAAAAA  AAAAAAA    SAAAAAAAAA   AAAAAA  A   A  A
   134   25 H S  E     +A  112   0A  58  688   12  S SSSSSSSSSSSSSSS SSSSSSSSSS  SSSSSSS    NSSSFSSSSS   SSSSSS  S   S  S
   135   26 H G  S    S+     0   0   56  688    4  G GGGGGGGGGGGGGGG GGGGGGGGGG  GGGGGGG    EGGGGGGGGG   GGGGGG  G   G  G
   136   27 H F  S    S-     0   0   33  686   34  F FFFFFFFFFFFFFFF FFFFFFFFFF  FFFFFFF    YFFFFFFFFF   FFFFFF  F   F  F
   137   28 H T    >   -     0   0   93  687   50  A ATITTTITTTTTTTT TTTTTTTTTT  TTTTTTT    ETDTTTTTTT   TDTTTT  T   T  T
   138   29 H F  G >  S+     0   0    2  688   41  F FFFFFFFFFFFFFFF FFFFVFFFFF  FFFFFFF    FFFFFFFFFF   FFFFFF  F   F  F
   139   30 H S  G 3  S+     0   0   57  688   55  S SSNSSSNSSSSSSSS SSSNSSSSSS  SSSSDSS    PSSSSSSSSS   SSSSSS  S   S  S
   140   31 H S  G <  S+     0   0   71  688   60  S SRRSSSRSSSSSSDT SSSSSSSSST  SGSSDND    SSRSSSSNSS   SRTTDS  S   S  S
   141   32 H Y  S <  S-     0   0   44  688   41  F YSCFFFYFFFFYYYF FFFYNYYYYY  YFYYYYY    HSYYYYYYYY   YYFYHY  Y   Y  Y
   142   33 H T        -     0   0   30  688   91  G DGAGGGGGGGGWAYG SGGGYWWWAA  HGEWGGY    DGWGWGAGGD   AWGGYW  S   S  D
   143   34 H M  E     -FG 207 160C   0  672   46  M MMMMMMMMMMMMMMM MMMMMMMMMM  MMMMMMM    MIMMMMMMMM   MMMMMM  M   M  M
   144   35 H S  E     -FG 206 159C   0  685   73  S SSSHHHSHHHHSSAH SHHSSSSSSS  THSSSHA    SHSHSHHHHN   GSHHDS  N   D  N
   145   36 H W  E     +FG 205 158C   0  688    0  W WWWWWWWWWWWWWWW WWWWWWWWWW  WWWWWWW    WWWWWWWWWW   WWWWWW  W   W  W
   146   37 H V  E     -FG 204 156C   0  688   19  V VVVVVVVVVVVVVVV VVVIVVVVVV  VVVVVIV    VVVVVVVVVV   VVVVVV  V   V  I
   147   38 H R  E     -FG 203 155C  10  688   17  R RRRRRRRRRRRRRRR RRRRRRRRRR  RRRRRRR    RRRRRRRRRR   RRRRRR  R   R  R
   148   39 H Q  E     -FG 202 154C   9  688    3  Q QQQQQQQQQQQQQQQ QQQQQQQQQQ  QQQQQQQ    KQQQQQQQQQ   QQQQQQ  Q   Q  Q
   149   40 H T    >   -     0   0    9  688   68  T TTTAAATAAAAAAAG AAATAAAAAA  AAAAAAA    TAAAAAAAAA   AAGAAA  A   A  A
   150   41 H P  T 3  S+     0   0   80  687   10  P PPPPPPPPPPPPPPP PPPPPPPPPP  PPPPPPP    PPPPPPPPPP   PPPPPP  P   P  P
   151   42 H E  T 3  S-     0   0  151  688   26  A EDEEEEDEEEEGGTE GEEDGGGGGG  GEGGGTT    EEGGGGGGGG   GGEEGG  G   G  G
   152   43 H K    <   +     0   0  121  688   32  K KKKKKKKKKKKKKKK KKKMKKKKKK  KKKKKKK    KKKKKKKKKK   KKKKKK  K   K  K
   153   44 H R        -     0   0  113  687   43  R RKRGGGKGGGGGGGG GGGRGGGGGG  GGGGGGG    RGGGGGGGGG   GGGGGG  G   G  G
   154   45 H L  E     -G  148   0C   9  688   14  L LLLLLLLLLLLLLLL LLLLLLLLLL  LLLLLLL    LLLLLLLLLL   LLLLLL  L   L  L
   155   46 H E  E     -G  147   0C  44  687    5  E EEEEEEEEEEEEEEE EEEEEEEEEE  EEEEEEE    EEEEEEEEEE   EEKEEE  E   E  E
   156   47 H W  E     +G  146   0C  15  687   11  W WWWWWWWWWWWWWWW WWWWWWWWWW  WWWWWWW    LWWWWWWWWW   WWWWWW  W   W  W
   157   48 H V  E     -     0   0C   0  687   28  V VVVVVVVVVVVVVVV VVVVVVVVVV  VVVVVVV    VVIVVVVVVV   VIVVVV  V   V  V
   158   49 H A  E     -G  145   0C   0  688   38  A AAAAAAAAAAAASAA SAAASAAASS  AAAASAA    AAGAAAAASA   SGASAA  S   A  S
   159   50 H S  E     -GH 144 168C   0  688   94  T TTTYYYTYYYYNASY SYYTVNNNAA  IYNNGSS    AYEVNFVIVS   TEYTVN  Y   Y  A
   160   51 H I  E     -GH 143 167C   4  675   18  I IIIIIIIIIIIIIII IIIIIIIIII  IIIIIII    IIIIIIIIII   IIIIII  I   I  I
   161   52 H N    >   -     0   0   47  682   84  T SSSSSSSSSSSKSSS SSSSYKKKSS  WSKKNSS    NSNSKRSWSS   GNSSSK  S   S  S
   162   53 H N  T 3  S+     0   0   65  684   88  S SSSSSSSSSSSQGYS GSSSSQQQGG  NSQQWPY    SSPYQYYYTS   TPSIYQ  S   S  T
   163   54 H G  T 3  S-     0   0   65  686   68  G GGGGGGGGGGGDSDG SGGGGDDDSS  DGDDNSD    DGDDDDDDDG   ADGGDD  T   A  G
   164   55 H G  S <  S+     0   0   30  687   43  G GGGSSSGSSSSGGGS SSSGGGGGGG  GSGGGGG    GSSGGGGGGS   GSGGGG  I   S  G
   165   56 H G  S    S+     0   0   74  688   63  T SSTGSSSSSSSSGSS GSSGSSSSGG  SNSSGGG    GSSSSSSNRS   SSGGSS  I   S  S
   166   57 H R        +     0   0  163  505   86  Y YYYTTTYTTTTESST TTTF.EEGSS  QIEESSS    SMTNENNDTY   .TISNE  T   T  .
   167   58 H T  E     -H  160   0C  62  677   52  T TTTILITIIIIKTTI TIITTRKKTT  KIKKTTT    TIIKKKKETI   TIITKK  I   I  T
   168   59 H Y  E     +H  159   0C  53  686   85  Y YYYYHYYYYYYYYYY YYYHYYYYYY  YYYYGYY    YLNYYYYYYY   YNKYYY  Y   Y  Y
   169   60 H Y        -     0   0   44  688    9  Y YYYYYYYYYYYYYYY YYYYYYYYYY  YYYYYYY    YYYYYYYYYY   YYYYYY  Y   Y  Y
   170   61 H P    >>  -     0   0   20  688   65  P PPPAAAQAAAAVARA AAAPAVVVAA  AAVVARR    PATAVAAAAG   ATVAAV  A   A  A
   171   62 H D  T 34 S+     0   0  148  688   64  D DDDDDDDDDDDDDDE DDDDDDDDDD  DDDDDDD    DDPDDDDDDD   DPDNDD  D   N  D
   172   63 H T  T 34 S+     0   0   90  688   57  S STSTTTTTTTTSSST STTSSSSSSS  SASSSSS    TTSSSSSSSA   SSTSSS  S   S  S
   173   64 H V  T X> S+     0   0    1  688   42  V VVVVVVVVVVVVVVV VVVVVVVVVV  VVVVVVV    MVLVVVVVVV   VLVVVV  V   V  M
   174   65 H K  B 3< S+c  177   0A 142  687   31  K KKKKKKKKKKKKKKK KKKKKRKKKK  KKKKKKK    EKKKKKKKKK   KKKKKK  K   K  K
   175   66 H G  T 34 S+     0   0   74  687   36  G GGGGGGGGGGGGGGG GGGGGGGGGG  GGGGGGG    RGDGGGGGGG   GDGGGG  G   G  G
   176   67 H R  T <4 S+     0   0   36  688   17  R RRRRRRRRRRRRRRR RRRRRRRRRR  RRRRRRR    RRKRRRRRRR   RKRRRR  R   R  R
   177   68 H F  E  <  -cD 174 192A   2  688   60  F FFFFFFFFFFFFFFF FFFFFFFFFF  FFFFFFF    FFFFFFFFFF   FFFFFF  F   F  F
   178   69 H T  E     - D   0 191A  79  688   38  T TTTTTTITTTTTTTT TTTTTTTTTT  TTTTTTT    ITITTTTTTT   TIATTT  T   T  T
   179   70 H I  E     + D   0 190A   5  688   20  I IIIIIIIIIIIIIII IIIVIIIIII  IMIIIII    IVIIIIIIII   IIIIII  I   I  I
   180   71 H S  E     - D   0 189A  51  684   41  S SSSSSSSSSSSSSSS SSSSSSSSSS  SSSSSSS    SSSSSSSSSS   SSSSSS  S   S  S
   181   72 H R  E     - D   0 188A  30  687   60  R RRRRRRRRRRRRRRR RRRRRRRRRR  RRRRRRR    RRRRRRRRRR   RRRRRR  R   R  R
   182   73 H D  E > > - D   0 187A  60  686    7  D DDDDDDDDDDDDDDD DDDDDDDDDD  DDDDDDD    DDDDDDDDDD   DDDDDD  D   D  D
   183   74 H N  G > 5S+     0   0   48  688   57  N NNNNNNNNNNNNNNN NNNNNNNNNN  NNNNNNN    NNNNNNNNNN   NNDNNN  N   N  N
   184   75 H A  G 3 5S+     0   0   99  688   45  A AAAPPPAPPPPASAP SPPASAAASS  APAAAAA    TPASASSSAT   AAPASA  A   A  A
   185   76 H K  G < 5S-     0   0  111  688   51  K RKKKKKKKKKKKKKK KKKGKKKKKK  KKKKKKK    KKKKKKKKKK   KKKKKK  K   K  K
   186   77 H N  T < 5 +     0   0   62  688   46  N NNNNNNNNNNNNNSN NNNSNNNNNN  NNNNNSS    KNNNNNNNNN   NNNNNN  N   N  N
   187   78 H T  E   < -BD 132 182A  16  688   69  T TTTTTTTTTTTSTTT TTTTTSSSTT  TTSSSTS    TTTTSTTTST   LTTETS  S   M  S
   188   79 H L  E     -BD 131 181A   0  687   56  L LLLLLLLLLLLLLLL LLLLLLLLLL  LLLLLLL    LLLLLLLLLL   LLLLLL  L   L  L
   189   80 H Y  E     -BD 130 180A  41  687   46  Y YYYFFFYFFFFYYYF YFFFYYYYYY  YFYYYYY    YFYYYYYYYY   YYFYYY  Y   Y  Y
   190   81 H L  E     -BD 129 179A   0  687    7  L LLLLLLLLLLLLLLL LLLLLLLLLL  LLLLLLL    LPLLLLLLLL   LLLLLL  L   L  L
   191   82 H Q  E     -BD 128 178A  76  687   41  Q QQQQQQQQQQQQQQQ QQQQQQQQQQ  QQQQQQQ    QQQQQQQQQQ   QQQQQQ  Q   Q  Q
   192   83 H M  E     +BD 127 177A   0  688   11  M MMMMMMMMMMMMMMM MMMMMMMMMM  MMMMMMM    MMMMMMMMMM   MMMMMM  M   M  M
   193   84 H S        +     0   0   42  688   54  S SNSTTTSTTTTNNDT NTTSNNNNNN  STNNNDD    STSNNNNNNS   NSTNNN  N   S  N
   194   85 H S  S    S-     0   0   68  687   24  S SSSSSSSSSSSSSSS SSSSSSSSSS  SSSSSSS    SSKSSSSSSS   SKSSSS  S   S  S
   195   86 H L        -     0   0    3  686   18  L LLLLLLLLLLLLLLI LLLLLLLLLL  LLLLLLL    LLVLLLLLLL   LVLLLL  L   L  L
   196   87 H K    >   -     0   0  102  686   68  K RKRRRRKRRRRRRRR RRRKRRRRRR  RRRRRRR    RRRRRRRRRR   RRRKRR  R   R  R
   197   88 H S  G >  S+     0   0   70  686   60  S STSSSSSSSSSAASS ASSSAAAAAA  ASAAASS    SSSAAAAAAT   ASSSAA  A   A  A
   198   89 H E  G 3  S+     0   0  126  687   22  E EEAEEEEEEEEEEEE EEEEEEEEEE  QEEEEEE    EEEEEEEEEE   EEEEEE  E   E  E
   199   90 H D  G <   +     0   0    2  687    3  D DDDDDDDDDDDDDDD DDDDDDDDDD  DDDDDDD    DDDDDDDDDD   DDDDDD  D   D  D
   200   91 H T    <   +     0   0   32  688   28  A TTTTTTTTTTTTTTT TTTTTTTTTT  TTTTTTT    TTTTTTTTTT   TTTTTT  T   T  T
   201   92 H A  E    S- I   0 223C   8  686    5  A AAAAAAAAAAAAAAA AAAAAAAAAA  AAAAAAA    AAAAAAAAAA   AAAAAA  A   A  A
   202   93 H M  E     -FI 148 222C  58  687   48  M LMMMMMMMMMMVVTM VMMMVVVVVV  VIVVVTT    LILVVVMVVV   MLIVVV  V   V  V
   203   94 H Y  E     -FI 147 221C   0  688    1  Y YYYYYYYYYYYYYYY YYHYYYYYYY  YYYYYYY    YYYYYYYYYY   YYYYYY  Y   Y  Y
   204   95 H Y  E     -F  146   0C   7  688    4  Y YYYYYYYYYYYYYYF YYYYYYYYYY  YYYYYYY    YYYYYYYYYY   YYYYYY  Y   Y  Y
   205   96 H b  E     -F  145   0C   0  688    1  C CCCCCCCCCCCCCCC CCCCCCCCCC  CCCCCCC    CCCCCCCCCC   CCCCCC  C   C  C
   206   97 H V  E     -FJ 144 217C   0  688   23  A ATVAAAAAAAAAAGA AAAGAAAAAA  AAAAAAT    AAAAAAAAAA   AAAAAA  A   A  A
   207   98 H R  E     -FJ 143 216C  21  687   40  r rrrRrRrRrRRRKRr KrrrRrrrkk  RrtrRTT    rrRrrKGrGR   rRrskr  r   r  G
   208   99 H H  E     + J   0 214C   6  583   92  y alg.y.t.n....Hg .eyrGrssli  .mts.DD    rd.sy.Gw..   rLslyv  s   t  .
   209  100 H E  E  >  + J   0 213C  63  625   78  S RIGSPSTSQS.E.SE .DDGSAGGPS  .IGGRTT    GNLGN.GV.D   VGHDGR  E   A  .
   210  101 H Y  T >4 S-     0   0   80  658   93  N DTDYYYDYAYITPSN PGAFVAYYSY  .TGYRNS    YHYWW.GY.T   YYWDDH  A   S  .
   211  102 H Y  T 34 S-     0   0  140  672   23  Y AtEyYyWyYyWYFYY FyYYWyYYYy  YYFYYFF    YYyYn.LyYv   YYYFYF  F   Y  Y
   212  103 H Y  T 34 S+     0   0   39  265   92  . .w.y.y.y.y.LP.Y PaW.SsPP.y  ...P...    Y.y.e..y.g   YG....  .   .  .
   213  104 H A  E <<  -J  209   0C   0  403   87  L .YGGAGYGAGDSY.G YWY.GPTTYG  .A.TA.I    AAALADGG.S   HY..V.  .   .  .
   214  105 H M  E     +J  208   0C   0  497   62  F MFFVMVFFMFVFFFM FFFFLWFFMM  .M.FL.Y    MLMWPLLM.L   LFF.F.  .   .  .
   215  106 H D  E     +     0   0C  19  615   50  A DDAADADADAGDDDD DADDDDDDDD  TDDDD.M    DDDDDNGDTR   FDDYDD  D   .  T
   216  107 H Y  E     -J  207   0C  99  624   65  Y YVYYYYVYYYYYYYY YYVYYYYYVV  VYYYYFL    YYYYYYYVVT   MVLYYY  I   .  M
   217  108 H W  E     -J  206   0C  23  675    2  W WWWWWWWWWWWWWWW WWWWWWWWWW  RWWWW W    WWWWWWWWRW   WWWWWW  W   W  R
   218  109 H G        -     0   0    0  664   17  G GGGGGGGGGGGGGGG GGGGGGGGGG  GGGGG S    GGGGGGGGGC   GGGGGG  G   G  G
   219  110 H Q        -     0   0   91  659   46  Q QAQQQQAQQQQQQQQ QQAQQQQQQQ   QQQQ      QQQQQQQQ Q   SAAQQQ  Q   Q   
   220  111 H G        -     0   0   16  650   16  G GGGGGGGGGGGGGGG GGGGGGGGGG   GGGG      GGGGGGGG G   GGGGGG  G       
   221  112 H T  E     -I  203   0C  21  594   27  T TTTTTTTTTTTTTVT TTTTTTTTTT   TTTT      TTTTTTTT T    TTTTT  T       
   222  113 H T  E     -I  202   0C  72  593   76  L STVLSLTLSLTLLMS LLTNLLLLLT   SLLL      SSSLLLLT      TTLLL  M       
   223  114 H V  E     -I  201   0C   0  596   20  V VVVVVVVVVVLVVVV VVVLVVVVVV   VVVV      VVVVVVVV      VVVVV  V       
   224  115 H T  E     -e  120   0B  36  593   20  T TTTTTTTTTTTTTTT TTTTTTTTST   ITT       TATTTTTT      TTTTT  T       
   225  116 H V  E     +e  121   0B   6  572    6  V VVVVVVVVVVVVVVV VVVVVVVVVV   VVV       VVVVVVVV      VVVV   V       
   226  117 H S        -     0   0   36  566   11  S SSSSSSSSSSSSSSS SSSSSSSSSS   SSS       SSSSSSSS      SSSS   S       
   227  118 H S  S    S+     0   0   84  551   22  A SSAASASASASSSSS SASSSSSSSS   SSS       SSSSSSS       SSSS           
   228  119 H A  S    S+     0   0   70  123   53  A   A         G   G        G                                          
   229  120 H W        -     0   0  123   73   63                                                                        
   230  121 H R        +     0   0  207   60   75                                                                        
   231  122 H H              0   0  156   54   67                                                                        
   232  123 H P              0   0  155   35   53                                                                        
## ALIGNMENTS  141 -  210
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....5....:....6....:....7....:....8....:....9....:....0....:....1
     1    1 L D              0   0  183  420   16         D         DED  D DN          D  DDDD DDDDDD          DED D   DD
     2    2 L I        -     0   0   32  462   11         I         ILI  IIIII         I  IIII IIIIII          ILI I   II
     3    3 L E        -     0   0  117  463   68         Q         QQQ  QQQQQ         Q  QQQQ QQQQQQ          QQQ Q   QQ
     4    4 L L  E     -K   25   0D  10  474    7         M         MMM  MMMMM         M  MMMM LMMMMM          MMM M   MM
     5    5 L T  E     -K   24   0D  64  475    8         T         TTT  TTTTT         T  TTTT TTTTTT          TTT T   TT
     6    6 L Q  E     -K   23   0D  13  475    0         Q         QQQ  QQQQQ         Q  QQQQ QQQQQQ          QQQ Q   QQ
     7    7 L T  E    S+K   22   0D  64  475   34         S         SSS  SSSSS         S  SSSS SSSSSS          SSS S   SS
     8    8 L P        -     0   0   46  480    9         P         PPP  PPPPP         P  PPPP PPPPPP          PPP P   PP
     9    9 L V  S    S+     0   0   96  484   67         S         SSS  SSSSS         S  SSSS TSSSSS          SSS S   SS
    10   10 L S  E     -n  104   0E  60  485   43         S         SSS  SSSSS         S  SSSS SSSSSS          TSF S   SS
    11   11 L L  E     -n  105   0E  58  489   21         L         LLL  LLLLL         L  LLLL LLLLHL          LLL L   LL
    12   12 L S  E     +n  106   0E  60  490   42         S         SSP  SSSSS         S  SSSS SSSSSS          SPS S   SS
    13   13 L A  E     -n  107   0E   0  490   58         A         AAA  AAAAA         A  AAAA AAAAAA          AAA A   AA
    14   14 L S    >   -     0   0   47  491   29         S         SSS  SSSSS         S  SSSS SSSSSS          SSS S   SS
    15   15 L V  T 3  S+     0   0   76  491   66         V         VVV  VVVVV         V  VVVV VVVVVV          VVV V   VV
    16   16 L G  T 3  S+     0   0   42  491    4         G         GGG  GGGGG         G  GGGG GGGGGG          GGG G   GG
    17   17 L E    <   -     0   0   71  491   35         D         DDD  DDDDD         D  DDDD DDDDDD          DDD D   DD
    18   18 L T        -     0   0   69  491   62         R         RRR  RTRTT         R  RRKR RRRRVR          RRR R   TR
    19   19 L V  E     - L   0  75D  11  491   37         V         VVV  VVVVV         V  VVVV VVVVVV          VVV V   VV
    20   20 L T  E     - L   0  74D  67  490   30         T         TTT  TTTTT         T  TTTT TTTTTT          TTT T   TT
    21   21 L I  E     - L   0  73D   1  489   17         I         III  IIIII         I  IIII IIIIII          III I   II
    22   22 L T  E     -KL   7  72D  29  489   58         T         TTT  TTTTT         T  TTTT TTTTNT          TTT T   TT
    23   23 L a  E     -KL   6  71D   0  490    1         C         CCC  CCCCC         C  CCCC CCCCCC          CCC C   CC
    24   24 L R  E     -KL   5  70D 110  490   45         R         RRR  RRRKR         R  RRRQ QQRRKW          RRR R   RR
    25   25 L A  E     -K    4   0D  10  490   29         A         AAA  AAAAA         A  AAAA AAAAAA          AAA A   AA
    26   26 L S  S    S+     0   0   66  490    4         S         RSS  SSSSS         S  SSSS SSSSSS          SSS S   SS
    27   27 L E  S    S-     0   0  101  490   38         Q         QQQ  EQQQQ         Q  QQQQ QQQQHQ          QQQ Q   QQ
    28   28 L N        +     0   0   83  490   45         S         GST  NSGGG         S  GGGG GGGGNG          STG G   GG
    29   29 L I    >   -     0   0    5  491   32         I         III  VIIII         I  IIII IIIIII          III I   II
    30   30 L Y  T 3   -     0   0  155  491   81         S         SSN  NGSSR         S  SSSS STSSGS          SNS R   SS
    31   31 L S  T 3  S+     0   0   53  467   65         S         SSN  NSNNN         S  NDNS NNNNSN          SSS N   ST
    32   32 L Y    <   +     0   0   63  490   52         Y         WYY  YNDYY         Y  DYAW NDWDYY          WYN D   YY
    33   33 L L  E     -O   90   0E   0  490    7         L         LLL  LLLLL         L  LLLL LLLLLL          LLF L   LL
    34   34 L A  E     -O   89   0E   0  490   71         S         ANN  NANAA         N  NSAA AAANAA          ANA G   NN
    35   35 L W  E     -OP  88  48E   1  491    0         W         WWW  WWWWW         W  WWWW WWWWWW          WWW W   WW
    36   36 L Y  E     -OP  87  46E   0  491    9         Y         YYY  YYYYY         Y  YYYY YYYYYY          YYY Y   FY
    37   37 L Q  E     -OP  86  45E   7  491   28         Q         QQQ  QQQQQ         Q  QQQQ QQQQQQ          QQQ Q   QQ
    38   38 L Q  E     -O   85   0E  21  491    4         Q         QQQ  QQQQQ         Q  QQQQ QQQQQQ          QQQ Q   QQ
    39   39 L K    >   -     0   0   51  490    9         K         KKK  KKKKK         K  KKKK KKKKKK          KKK K   KK
    40   40 L Q  T 3  S+     0   0  190  491   19         P         PPP  PPPPP         P  PPPP PPPPPP          PPP P   PP
    41   41 L G  T 3  S+     0   0   86  491   10         G         EGG  GGGGG         G  GGGG GGGGGG          GGG G   GG
    42   42 L K  S <  S-     0   0  126  490   54         K         KKK  KKKTK         K  KKKK KEKKKK          KKK K   KK
    43   43 L S        -     0   0   21  490   55         A         AAV  AVASS         A  AAAA VTAAEV          AAA A   AA
    44   44 L P        -     0   0    4  490   11         P         PPP  PPPPP         P  PPPP PPPPPP          PPP P   PP
    45   45 L Q  E     -P   37   0E  74  490   32         Q         KKK  KKKKQ         N  KKKK KKKKKK          KKK K   KK
    46   46 L F  E     +P   36   0E  25  490   42         V         SLL  LLLLL         L  LRLL LLLLFL          LLL R   LR
    47   47 L L  E     +     0   0E   4  490    9         L         LLL  LLLLL         L  LLLL LLLLLL          LLL L   LL
    48   48 L V  E     -PQ  35  54E   0  491    5         I         III  IIIII         I  IIIL IIIIII          III I   II
    49   49 L Y  E >> S+ Q   0  53E  39  491   17         Y         YYY  YYYYY         Y  YYYY YYYYYY          YYY Y   YY
    50   50 L N  T 34 S-     0   0   52  491   91         A         AAA  KAAYD         A  AAAK SARAYA          KGA A   AA
    51   51 L A  T 34 S+     0   0    3  491   45         A         AAA  AAAAA         A  AAAA AAAAAA          AAA A   AA
    52   52 L K  T <4 S+     0   0  148  491   25         S         SSS  SSSSS         S  SSSP SSSSSS          STS S   SS
    53   53 L T  E  <  -Q   49   0E  47  491   67         S         SSS  TTSTK         S  SSNG SGNSRT          SST S   SS
    54   54 L L  E     -Q   48   0E  60  491   60         L         LLL  LLLLL         L  LLLL LLLLLL          LLL L   LL
    55   55 L G    >   -     0   0    9  490   71         P         QQQ  QQQQA         Q  EEQQ QQEQAQ          EQQ Q   EE
    56   56 L E  T 3  S+     0   0  192  490   35         S         SSS  SSSST         S  SSSS SSASS.          SSS S   SS
    57   57 L G  T 3  S+     0   0   70  491    5         G         GGG  GEGGG         G  EGGG GGGGGS          GGG G   GG
    58   58 L V    <   -     0   0   25  489   11         V         VVV  VVVVV         V  VVVV VIVVIG          VVV V   VV
    59   59 L P    >   -     0   0   47  490    7         P         PPP  PPPPP         P  PPPP PPPPPP          PPP P   PP
    60   60 L S  T 3  S+     0   0  115  491   57         S         SSS  SSSSS         S  SSSS SSSSSS          SSS S   SS
    61   61 L R  T 3  S+     0   0   44  491    4         R         RRR  RRRRR         R  RRRM RRRRRR          RRR R   RR
    62   62 L F  E <   +M   75   0D   5  491    1         F         FFF  FFFFF         F  FFFF FFFFFF          FFF F   FF
    63   63 L S  E     -M   74   0D  55  490   22         S         SSS  SSSSR         S  SSSS SSSSSS          SSS S   SS
    64   64 L G  E     +M   73   0D  13  491    2         G         GGG  GGGGG         G  GGGG GGGGGG          GGG G   GG
    65   65 L S  E     +M   72   0D  63  491    5         S         SSS  RSSSS         S  SSSS SSSSSS          SSS S   SS
    66   66 L G  E     -M   71   0D  36  491   14         G         GGG  GGGGG         G  GGGG GGGGGG          GRG G   GG
    67   67 L S  E >   +M   70   0D  79  491    9         S         SSS  SSSSS         S  SSSS SSSSSS          SSF S   SS
    68   68 L G  T 3  S-     0   0   16  491   13         G         GGG  GGGGG         G  GGGG GGGGGG          GGG G   GG
    69   69 L T  T 3  S+     0   0   67  488   13         T         TTT  TTTTT         T  TTTT TTTTTT          TTT T   TT
    70   70 L Q  E <   +LM  24  67D 110  489   27         D         DDD  GDDDD         D  DEDD DDDDDD          EDE E   ED
    71   71 L F  E     -LM  23  66D   2  491    6         F         FFF  YFFFY         F  FFFF FFFFFF          FFF F   FF
    72   72 L S  E     -LM  22  65D  26  491   30         T         TTT  TTTTS         T  TTTT TTTTTT          TTT T   TT
    73   73 L L  E     -LM  21  64D   0  491    2         L         LLL  FLLLL         L  LLLL LLLLLL          LLL L   LL
    74   74 L K  E     -LM  20  63D  97  491   39         T         TTT  TTTTT         T  TTTT TTTTTT          TTT T   TT
    75   75 L I  E     -LM  19  62D   0  491    1         I         III  IIIII         I  IIII IIIIII          III I   II
    76   76 L N  S    S-     0   0   86  491   30         S         SSS  SSSSS         S  SSSS SSSSSS          SSS S   SS
    77   77 L S  S    S-     0   0   58  491   62         S         SST  SSSGG         S  SSSS SSSSSS          SSS S   SS
    78   78 L L        -     0   0    0  491   27         L         LLL  LLLLL         L  LLLL LLLLLL          LLL L   LL
    79   79 L L    >   -     0   0   67  491   31         Q         QQQ  QQQQQ         Q  QQQQ QQQQQQ          QQQ Q   QQ
    80   80 L P  G >  S+     0   0   92  491   58         P         PPP  SPPAA         P  PPPP PPPPPP          PPP P   PP
    81   81 L E  G 3  S+     0   0  102  491   13         E         EEE  EEEEE         E  EEEE EEEEEE          DEE E   EE
    82   82 L D  G <  S+     0   0    1  491    5         D         DDD  DEDDD         D  DDDY DDDDDD          DDD D   DD
    83   83 L F    <   +     0   0   29  490   72         F         FFF  VVFFF         F  FFFF VFIFVV          FFF F   FF
    84   84 L G  E    S- R   0 105E  17  491   23         A         AAA  AAAAA         A  AAAA AAAALA          AAA A   AA
    85   85 L S  E     -OR  38 104E  24  491   63         T         TTT  TTTSD         T  TAVT TTTTTT          TTT T   TT
    86   86 L Y  E     -OR  37 103E   0  491    0         Y         YYY  YYYYY         Y  YYYY YYYYYY          YYY Y   YY
    87   87 L Y  E     -O   36   0E   5  490    4         Y         YYY  YYYYF         Y  YYYY YYYYFY          YYY Y   YY
    88   88 L a  E     -O   35   0E   0  491    0         C         CCC  CCCCC         C  CCCC CCCCCC          CCC C   CC
    89   89 L Q  E     -OS  34  99E   0  489   48         Q         QQQ  QQQMQ         Q  QLQQ QQQLQQ          QQQ L   LL
    90   90 L H  E     -O   33   0E  22  483   26         Q         QQQ  HK QQ         Q   QQQ RHQQQK          QQQ Q   QQ
    91   91 L H        +     0   0    0  421   89         N          AT  N             S   GR  TYH H           .S. H   YY
    92   92 L Y  S    S+     0   0  104  454   88         Y          NY  Y             Y   YN  YYD             YYL N   KN
    93   93 L G  S    S-     0   0   34  422   71         I          ..  G             .    S  NSN             N.N S   SS
    94   94 L T  S    S-     0   0  104  446   88         T          RI  T             S    Y  ATS             SSS Y   YD
    95   95 L P  S    S+     0   0    7  443   51         P          FT  P             T    P  PPP             ITF P   PP
    96   96 L P  S    S-     0   0   55  421   75         T          PP  P             S    P  PPP             EPP P    P
    97   97 L L        -     0   0   21  160   88         S          LL                W                       GRR       
    98   98 L T        -     0   0   40  288   41         .          TT                T                       TTT       
    99   99 L F  B     -S   89   0E  18  290   29         F          FF                F                       FFF       
   100  100 L G        -     0   0    3  294   39         G          GG                G                       GGG       
   101  101 L G        -     0   0   52  307   63         Q          GG                E                       QQQ       
   102  102 L G        -     0   0   11  306   43         G          GG                G                       GGG       
   103  103 L T  E     - R   0  86E   0  366   18         T          TT                T                       TTT       
   104  104 L K  E     -nR  10  85E  98  363   58         R          KK                K                       KKK       
   105  105 L L  E     -nR  11  84E   4  343   37         V          VV                V                       VLV       
   106  106 L E  E     -n   12   0E 108  326   51         E          EE                E                       EEE       
   107  107 L I  E      n   13   0E 113  301   50         I          II                I                       III       
   108  108 L K              0   0  145  268   18         K          KK                K                       KKK       
   109      ! !              0   0    0   0     0  
   110    1 H E              0   0  194  408   30  EEE          QEEE   QE     EE    QEE EQ    D      EE  E    E   Q EQQ  
   111    2 H V        +     0   0   19  465   12  VVV     VVVVVVVVV   VV     VVVVVVVVV VV    V      VV  VVVVVV   V VVV  
   112    3 H K  E     -A  134   0A 111  467   31  QKK     QQQQQKKQQ   QQ     KKQQQQQMQ QQ    Q      QK  LQQQQM   Q NQQ  
   113    4 H L  E     -A  133   0A   3  489    1  LLL     LLLLLLLLL   LL     LLLLLLLLL LL    L      LL  LLLLLL   L LLL  
   114    5 H Q  E     -A  132   0A  83  493   70  VLL     VVVVVLHVL   VV     LLVVVVVVV QV    V      VV  VVVVVV   Q EVQ  
   115    6 H E  E     +A  131   0A   5  498   21  EEE     EEEEEEEEE   EE     EEEEEEEEE EQ    E      EE  EEEEEE   E EEE  
   116    7 H S  E     +A  130   0A  69  501   13  SSS     SSSSSSSSS   SS     SSSSSSSSS SS    S      SS  SSSSSS   S SSS  
   117    8 H G        +     0   0   36  505    4  GGG     GGGGGGGGG   GG     GGGGGGGGG GG    G      GG  GGGGGG   G GGG  
   118    9 H G        +     0   0   29  672   48  GGGGGGG GGGGGGGGG   GG     GGGGGGGEG GG    G      GG GGGGGGG   G GGG  
   119   10 H D        -     0   0   96  677   40  DGGGGGG GGGGGGGGG   GG     GPGGGGGGG GG    G      GDGGAGGGGG   G GGG  
   120   11 H L  E     +e  224   0B  79  675   16  LLLLLLL VVVVLLFLL   VL     LLVLVVVLV LV    L      LLLLLLLVVL   L LLL  
   121   12 H V  E     -e  225   0B  16  677   33  VVVVVVV VVVVVVVVV   VV     VVVVVVVVV VV    A      VVVVVVVVVV   V VVV  
   122   13 H Q    >   -     0   0  114  679   51  QQQQQQQ QQQQQQQQQ   QQ     QQQKQQQQQ QQ    Q      QKQQQQQQQQ   Q QQQ  
   123   14 H P  T 3  S+     0   0   66  678    9  PPPPPPP PPPPPPPPP   PP     PLPPPPPPP PP    P      PPPPPPPPPP   A PPP  
   124   15 H G  T 3  S+     0   0   58  682   32  GGGKGKG GGGGGKKGG   GG     GGGGGGGKG KG    G      GGGGGGGGGK   G GGG  
   125   16 H G    <   -     0   0   25  684   63  RGGGGGG RGRRRGGGG   RG     GGRGRRRGG GR    G      GGEGGGGRRG   E GRG  
   126   17 H S        +     0   0   78  683   31  SSSSSSS SSSSSSSSS   SS     SSSPSSSSS SS    S      SSSSSSSSSS   S SSS  
   127   18 H L  E     - B   0 192A  25  685   25  LLLLRLL LLLLLLLLL   LL     LLLLLLLLL LL    L      LLLLLLLLLL   L MLL  
   128   19 H K  E     - B   0 191A  93  683   56  RK.KKKK RRRRRKKRR   RR     KKRRRRRKR KR    R      RRKKRRRRRK   K KRR  
   129   20 H L  E     - B   0 190A   0  688   14  LLLLILL LLLLLLLLL   LL     LLLLLLLLL LL    L      LLLLLLLLLL   L LLL  
   130   21 H S  E     -AB 116 189A  28  688   37  SSSSSSS SSSSSSSSS   SS     SSSSSSSSF SS    S      SSSSSSSSSS   S SSS  
   131   22 H b  E     -AB 115 188A   0  688    0  CCCCCCC CCCCCCCCC   CC     CCCCCCCCC CC    C      CCCCCCCRCC   C CCC  
   132   23 H A  E     -AB 114 187A  52  688   66  AAAAAAA AAAAAAAAA   AA     AAAAAAAAA AA    A      AVEAGAAAAA   A ATA  
   133   24 H A  E     +A  113   0A   8  688   49  AAAAAAA AAAAAAAAA   AA     AAAAAAAAA AA    A      AASAAVAAAA   A ATA  
   134   25 H S  E     +A  112   0A  58  688   12  SSSSSSS SSSSSSSSS   SS     SSSSSSSSS SS    S      SSNSSSSSSS   S SSS  
   135   26 H G  S    S+     0   0   56  688    4  GGGGGGG GGGGGGGGG   GG     GGGGGGGGG GG    G      GGEGGGGGGG   G GGG  
   136   27 H F  S    S-     0   0   33  686   34  FFFFIFF FFFFFFFFF   FF     FFFFFFFFF FF    F      FFYFFFFFFF   N FFF  
   137   28 H T    >   -     0   0   93  687   50  BDDTTTD TSTTTTTTS   TT     DDTTTTTTT TT    T      TTEDTTTTTT   T TTM  
   138   29 H F  G >  S+     0   0    2  688   41  FFFFFFF FLFFFFFVF   FF     FFFFFFFFF FF    F      FFFFFFFFFF   F FFF  
   139   30 H S  G 3  S+     0   0   57  688   55  BSSNSNS SSSSSNNSS   SS     SSSSSRSND SS    D      SSPSSTSSSN   S SGS  
   140   31 H S  G <  S+     0   0   71  688   60  BRRTGTR SDSSSNASN   SS     KRSSSSSTG TN    D      SSSRSTNISN   G DDR  
   141   32 H Y  S <  S-     0   0   44  688   41  LYYYFYY YYYYYYYNS   YY     YYYYYYYYY YY    Y      YNHYYYYYYY   G AYY  
   142   33 H T        -     0   0   30  688   91  GWWAGAW GGGGGAAYA   GN     WWGSGGGAA AG    G      SGDWVEWGGA   F WAA  
   143   34 H M  E     -FG 207 160C   0  672   46  MMMMMMM MMMMMMMMM   MM     MMMMMMMMM MM    M      MMMMMMMMMM   M MMM  
   144   35 H S  E     -FG 206 159C   0  685   73  TSSNHNS HHHHHNNNS   HN     SSHNHHHNH NH    S      NSSSNNNHHN   G DIS  
   145   36 H W  E     +FG 205 158C   0  688    0  WWWWWWW WWWWWWWWW   WW     WWWWWWWWW WW    W      WWWWWWWWWW   W WWW  
   146   37 H V  E     -FG 204 156C   0  688   19  VVAVVVV VVVVVVVVV   VV     VVVVVVVVV VV    V      VVVVVVAVVV   Y VAV  
   147   38 H R  E     -FG 203 155C  10  688   17  RRRRRRR RRRRRRRRR   RR     RRRRRRRRR RR    R      RRRRRRRRRR   R RRR  
   148   39 H Q  E     -FG 202 154C   9  688    3  QQQQQQQ QQQQQQQQQ   QQ     QQQQQQQQQ QQ    Q      QQKQQQQQQQ   Q QQQ  
   149   40 H T    >   -     0   0    9  688   68  AAAAAAA AAAAAAAAA   AA     AAAAAAAAA AA    A      ADTASAVAAA   A SAA  
   150   41 H P  T 3  S+     0   0   80  687   10  PPPPPPP PPPPPPPPQ   PP     PPPPPPPPP PP    P      PPPPPPPPPP   P PPP  
   151   42 H E  T 3  S-     0   0  151  688   26  GGGGEGG GGGGGGGGG   GG     GGGGGGGGG GG    G      GGEGEGGGGG   G EGG  
   152   43 H K    <   +     0   0  121  688   32  KKKKKKK KEKKKKKKK   KK     KKKKKKKKK KK    K      KEKKKKKKKK   K KKK  
   153   44 H R        -     0   0  113  687   43  GGGGGGG GGGGGGGGG   GG     GGGGGGGGG GG    G      GGRGGGGGGG   Q GGG  
   154   45 H L  E     -G  148   0C   9  688   14  LLQLLLL PLLLLLLLL   LL     LLLLLLLLL LL    L      LLLLLLLLLL   R LLP  
   155   46 H E  E     -G  147   0C  44  687    5  EEEEEEE EEEEEEEEE   EE     EEEEEEEEE EE    E      EQEEEEEEEE   E EEE  
   156   47 H W  E     +G  146   0C  15  687   11  WWWWWWW WWWWWWWSW   WW     WWWWWWWWW WW    W      WWLWWWWWWW   L WWW  
   157   48 H V  E     -     0   0C   0  687   28  VIIVVVI VVVVVVVVV   VV     IIVVVVVVV VV    V      VVVIVVVVVV   V VVV  
   158   49 H A  E     -G  145   0C   0  688   38  AGGAAAG AAAAAAASS   AA     GGASAAAAS AA    A      SAAGSSAAAA   A ASS  
   159   50 H S  E     -GH 144 168C   0  688   94  NEERYRE VVVVVRRVA   VY     EEVSVFVRL RI    Y      YDAESYNVVR   T ESG  
   160   51 H I  E     -GH 143 167C   4  675   18  IIIIIII IIIIIIITF   II     IIIIIIIII VI    I      IIIIIIIMII   I III  
   161   52 H N    >   -     0   0   47  682   84  KNNRNRN SSSSWRRYS   WS     HDSSWWWRS RW    N      RSNNNSKSSR   N RSS  
   162   53 H N  T 3  S+     0   0   65  684   88  ZPPSSSP YYYYYSSSG   YT     PPYSYYYSG SY    W      YSSPWSQYYS   S TSG  
   163   54 H G  T 3  S-     0   0   65  686   68  BDGKDKD DDDDDKKGS   DG     DNDSDDDKD KD    N      DSDDNSDDDK   R KSS  
   164   55 H G  S <  S+     0   0   30  687   43  GSSSSSS GGGGGTSGG   GG     SSGSGGGSG SG    G      GGGSGGGGGS   G VSG  
   165   56 H G  S    S+     0   0   74  688   63  SSSnTnS SSSSSnnSG   SS     GSSSSSSnG fN    G      GQGSEfTGSn   I nSG  
   166   57 H R        +     0   0  163  505   86  ZTTaTaT NNNNNae.S   N.     TTNYNNNaS aD    S      S.STNtENNa   . aYS  
   167   58 H T  E     -H  160   0C  62  677   52  ZIITITI KKKKKTTST   KT     IIKIKKKTT TE    I      TTTILKKEKT   T TIT  
   168   59 H Y  E     +H  159   0C  53  686   85  BNNYYYN YYYYYYYYY   YY     NNYYYYYYY YY    Y      YYYNYYYYYF   N YYY  
   169   60 H Y        -     0   0   44  688    9  YYYYYYY YYYYYYYYY   YY     YYYYYYYYY YY    Y      YYYYYYYYYY   Y YYY  
   170   61 H P    >>  -     0   0   20  688   65  VTTAAAT AAAAAAAAA   AA     TTAAAAAAA AA    A      AAPTAAVAAA   A AAA  
   171   62 H D  T 34 S+     0   0  148  688   64  DPPDDDP DDDDDDDDD   DN     PPDDDDDDD DD    D      DDDPDDDDDD   D EDD  
   172   63 H T  T 34 S+     0   0   90  688   57  SSSSTSS SSSPSSSSS   SA     SSSSSSSSS SS    S      SATSSSSSSS   F SSS  
   173   64 H V  T X> S+     0   0    1  688   42  VLLVVVL VVVVVVVVV   VV     LLVVVVVVV VV    V      VVMLVVVVVV   V VVV  
   174   65 H K  B 3< S+c  177   0A 142  687   31  KKKKKKK KKKKKKKKK   KK     KKKKKKKKK KK    K      KKEKKKKKKK   K KKK  
   175   66 H G  T 34 S+     0   0   74  687   36  GDDDGDD GGGGGDDGG   GG     DDGGGGGDG GG    G      GGRDGGGGGD   G GGG  
   176   67 H R  T <4 S+     0   0   36  688   17  RKKRRRK RRRRRRRRR   RR     KKRRLRRRR RR    R      RRRKRRRRRR   R RRR  
   177   68 H F  E  <  -cD 174 192A   2  688   60  FFFFFFF FFFFFFFFF   FF     FFFFFFFFF FF    F      FFFFFFFFFF   F FFF  
   178   69 H T  E     - D   0 191A  79  688   38  TIITTTI TTTTTTTTT   TT     IITTTTTTT TT    T      TSIITTTITT   T TTT  
   179   70 H I  E     + D   0 190A   5  688   20  IIIIIII IIIIIIIII   II     IIIITVIII II    I      IIIIIIIIII   I IIV  
   180   71 H S  E     - D   0 189A  51  684   41  SSSSSSS SSSSSSSSS   SS     SSSSSSSSS SS    S      SSSSSSSSSS   S SSS  
   181   72 H R  E     - D   0 188A  30  687   60  RRRRRRR RRRRRRRRR   RR     RRRRRRRRR RR    R      RRRRRRRRRR   R RRR  
   182   73 H D  E > > - D   0 187A  60  686    7  DDDDDDD DDDDDDDDD   DD     DNDDDDDDD DD    D      DDDDDDDDDD   D DDD  
   183   74 H N  G > 5S+     0   0   48  688   57  NNNDNDN NNNNNDDNN   NN     NDNNNSNDN DN    N      NNNNNNNNND   N DNN  
   184   75 H A  G 3 5S+     0   0   99  688   45  AAASPSA SSSSSSSSS   SA     AASASASSS SS    A      AATAGAASSS   A SAS  
   185   76 H K  G < 5S-     0   0  111  688   51  KKKQEQK KKKKKQQKK   KK     KKKKKKKQK QK    K      KKKKDKKKKQ   K KKK  
   186   77 H N  T < 5 +     0   0   62  688   46  NNNSNSN NNNNNSYNN   NN     NNNNNNNSN SN    N      NNKNNDNNNS   K SNN  
   187   78 H T  E   < -BD 132 182A  16  688   69  STTMTMT TTTTSMMTT   TT     STTSTTTMS MI    T      STTTTSSTTM   T NST  
   188   79 H L  E     -BD 131 181A   0  687   56  LLLLLLL LLLLLLVLL   LL     LLLLLLLLL LL    L      LLLLLLLLLL   V VLL  
   189   80 H Y  E     -BD 130 180A  41  687   46  YYYYFYY YYYYYYYYY   YY     YYYYYYYYY YF    Y      YYYYYFYYYY   Y YYY  
   190   81 H L  E     -BD 129 179A   0  687    7  LLLLLLL LLLLLLLLL   LL     LLLLLLLLL LL    L      LLLLLLLLLL   L LLL  
   191   82 H Q  E     -BD 128 178A  76  687   41  QQQQQQQ QQQQQQQQQ   QQ     QQQQQQQQQ QQ    Q      QQQQQQQQQQ   E QQQ  
   192   83 H M  E     +BD 127 177A   0  688   11  MMMMMMM MMMMMMMMM   MM     MMMMMMMMM MM    M      MMMMMMMMMM   M MMM  
   193   84 H S        +     0   0   42  688   54  NSSNTNS NNNNNNNNN   NS     SSNNNGNNN NN    S      NESSNHNNNN   N NNN  
   194   85 H S  S    S-     0   0   68  687   24  SKKNSNK SSSSSNNSS   SS     KKSSSSSNS NS    S      SDSKNSSSSN   S SSS  
   195   86 H L        -     0   0    3  686   18  LVVLLLV LLLLLLLLL   LL     VVLLLLLLL LL    L      LLLVLLLLLL   L LLL  
   196   87 H K    >   -     0   0  102  686   68  RRRKRKR RRRRRKKRR   RR     RRRRRRRKR KR    R      RRRRRRRRRK   E RRR  
   197   88 H S  G >  S+     0   0   70  686   60  VSSTSTS AAAAATSAA   AA     SSAAAAATA TI    A      AVSSVAAPAT   P VAA  
   198   89 H E  G 3  S+     0   0  126  687   22  EEEEEEE EEEEEEEEE   EE     EEEEEEEEE EA    E      EEEEEEEEEE   E EEE  
   199   90 H D  G <   +     0   0    2  687    3  DDDDDDD DDDDDDDDD   DD     DDDDDDDDD DD    D      DDDDDDDDDD   D DDD  
   200   91 H T    <   +     0   0   32  688   28  TTTTTTT TTTTTTTTT   TT     TTTTTTTTT TT    T      TTTTTTTTTT   T TTT  
   201   92 H A  E    S- I   0 223C   8  686    5  AAAAAAA AAAAAAAAA   AA     AATAAAAAA AA    A      AAAAAAAAAA   A GAA  
   202   93 H M  E     -FI 148 222C  58  687   48  LLLMMML VVVVVMMFV   VV     LLVVVVVML MV    L      VVLLMVIMVM   V IVV  
   203   94 H Y  E     -FI 147 221C   0  688    1  YYYYYYY YYYYYYYYY   YY     YYYYYYYYY YY    Y      YYYYYYYYYY   Y YYY  
   204   95 H Y  E     -F  146   0C   7  688    4  YYYYYYY YYYYYCYYY   YY     YYYYYYYYY YY    Y      YYYYFYYYYY   Y YYY  
   205   96 H b  E     -F  145   0C   0  688    1  CCCCCCC CCCCCCCCC   CC     CCCCCCCCC CC    C      CCCCCCCCCC   C CCC  
   206   97 H V  E     -FJ 144 217C   0  688   23  AAAVAVA AAAAAVVAA   AA     AAAAAAAVA VA    A      AAAAAAAASV   Y TAA  
   207   98 H R  E     -FJ 143 216C  21  687   40  RRRRrrR krKKtrrRr   rr     RRkRrrrrk rR    R      RtrrkRtfpr   T Mrk  
   208   99 H H  E     + J   0 214C   6  583   92  .LL.t.. ys..tgs.t   rw     LSn.wpwet y.    .      .ieliQsptg   . .ys  
   209  100 H E  E  >  + J   0 213C  63  625   78  .HG.T.. GGDDGNADG   EA     HPPGGDSTT FE    .      .PGELTSADI   . ADQ  
   210  101 H Y  T >4 S-     0   0   80  658   93  GYYHH.Y DWRRGYYRG   PL     YYGVSEGDI DI    .      .RGNPLDVDD   H YFP  
   211  102 H Y  T 34 S-     0   0  140  672   23  WYYyF.y YYllFYYfW   Yf     YYFvyYyYY YY    .      .YFYFfYYYY   Y YWF  
   212  103 H Y  T 34 S+     0   0   39  265   92  GGGw.gy ..vv...f.   Nv     G..gp.y.D GG    .      .....v....   . .S.  
   213  104 H A  E <<  -J  209   0C   0  403   87  GYYA.AY VLPP.AAL.   WG     YA.VG.YAR GD    .      ..W..H...A   F .G.  
   214  105 H M  E     +J  208   0C   0  497   62  GAFM.MF FWAA.MMFS   FF     NM.LPFFMF FS    .      D.FF.F...M   R EM.  
   215  106 H D  E     +     0   0C  19  615   50  DADDDDD DDAADDDDD   DR     ANDVDDDDD AT    .      T.ADED.D.D   S ADE  
   216  107 H Y  E     -J  207   0C  99  624   65  YYYYYYY YYNNYYYYY   PT     YYYFYYYYI YN    .      V.YYKY.C.Y   Y YVY  
   217  108 H W  E     -J  206   0C  23  675    2  WWWWWWW WWWWWWWWW   WW     WWWGWWWWW WW    .      RFWWWWWWWW   W WWW  
   218  109 H G        -     0   0    0  664   17  GGGGGGG GGGGGGGGG   GS     GGGGGGGGG GG    .      GGGGGGGGGG   G GGG  
   219  110 H Q        -     0   0   91  659   46  QQQQQQQ QQQQQQQQQ   QL     QQQQQQQQQ QQ    .      TQQQQQQQQQ   Q QKQ  
   220  111 H G        -     0   0   16  650   16  GGGGGGG GGGGGGGGG   GG     GGGGGGGGG GG    G      gGGGGGGGGG   G GGG  
   221  112 H T  E     -I  203   0C  21  594   27  TTTTTTT TTTTTTTTT   TT     TTTTTTTTT TT    .      hTTTTTTTTT   T TTT  
   222  113 H T  E     -I  202   0C  72  593   76  LLTSTST LLLLLSSLL   L      LSLLLLLSM LL    .      IILTLLLLLS   Q LTL  
   223  114 H V  E     -I  201   0C   0  596   20  VVLVLVL VVVVVVVVV   V      VVVVVVVVV VV    .      LVVLVVVVVL   V VVV  
   224  115 H T  E     -e  120   0B  36  593   20  TTTTTTT TTTTTTTTT   T      TTTTTTTTT TT    T      TTTTTTTTTT   T TTT  
   225  116 H V  E     +e  121   0B   6  572    6  VVVVVVV VVVV VVVV   V      VVVVVVVVV VV    V      SVVVVVVVVV   V VVV  
   226  117 H S        -     0   0   36  566   11  SSSSSSS SSSS SSSS   S      SSSSSSSSS SS    R      TSSSSSSSSS   S SSS  
   227  118 H S  S    S+     0   0   84  551   22  TASSSSS SSSS SSSS   S      ASSSSSSSS AS    G      ESASSSSSSS   S ASS  
   228  119 H A  S    S+     0   0   70  123   53                  A   G                                              G  
   229  120 H W        -     0   0  123   73   63                  S                                                     
   230  121 H R        +     0   0  207   60   75                  T                                                     
   231  122 H H              0   0  156   54   67                  K                                                     
   232  123 H P              0   0  155   35   53                  G                                                     
## ALIGNMENTS  211 -  280
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....2....:....3....:....4....:....5....:....6....:....7....:....8
     1    1 L D              0   0  183  420   16  D  D         DDDD D    D   E   DD  DD    D    DDD     DDDDD  DD       
     2    2 L I        -     0   0   32  462   11  I  I I       IIII I    I   L   II  III   I    III     IIIII  II       
     3    3 L E        -     0   0  117  463   68  Q  Q Q       QQQQ Q    V   V   QQ  VQQ   Q    MTT     QQQQQ  QQ       
     4    4 L L  E     -K   25   0D  10  474    7  M  M M       MMLM M    M   M   MM  LMM   M    MMM     MMMMM  LL       
     5    5 L T  E     -K   24   0D  64  475    8  T  T T       TTTT T    T   T   TT  TST   T    TTT     TTTTT  TT       
     6    6 L Q  E     -K   23   0D  13  475    0  Q  Q Q       QQQQ Q    Q   Q   QQ  QQQ   Q    QQQ     QQQQQ  QQ       
     7    7 L T  E    S+K   22   0D  64  475   34  S  S S       SSSS S    S   S   SS  SSS   S    SSS     SSSSS  SS       
     8    8 L P        -     0   0   46  480    9  P  P P       PPPP P    P   P   PP  PPP   P    PPP     PPPPP  PP       
     9    9 L V  S    S+     0   0   96  484   67  S  S S       SSSS A    S   S   SS  ASS   S    SSS     SSSSS  SS       
    10   10 L S  E     -n  104   0E  60  485   43  S  S S       PTSS S    L   S   SS  SSS   S    SSS     TSTSS  SS       
    11   11 L L  E     -n  105   0E  58  489   21  L  L L       LLLL L    L   L   LL  MLL   L    LLL     LLQLV  MM       
    12   12 L S  E     +n  106   0E  60  490   42  S  S S       SSSS S    S   A   SS  YSS   S    SPP     SSPSS  YY       
    13   13 L A  E     -n  107   0E   0  490   58  A  A A       AAAA A    A   A   AA  AAA   A    AVV     AAAAA  AA       
    14   14 L S    >   -     0   0   47  491   29  S  S S       SSSS S    S   S   SS  SSS   S    SSS     SSSSS  SS       
    15   15 L V  T 3  S+     0   0   76  491   66  V  V V       VVVV L    T   V   VV  LVV   V    PSR     VVVVV  LL       
    16   16 L G  T 3  S+     0   0   42  491    4  G  G G       GGGG E    G   G   GG  GGG   G    GGG     GGGGG  GG       
    17   17 L E    <   -     0   0   71  491   35  D  D D       DDDD E    D   D   DD  EDD   D    DDD     DDDDD  EE       
    18   18 L T        -     0   0   69  491   62  R  R R       SRRR I    R   R   RR  RRT   R    RRR     RRRRR  RR       
    19   19 L V  E     - L   0  75D  11  491   37  V  V V       VVVV V    V   V   VV  VVV   V    VVV     VVVVV  VV       
    20   20 L T  E     - L   0  74D  67  490   30  T  T T       TTTT T    T   T   TT  TTT   T    TTT     ATTTT  TT       
    21   21 L I  E     - L   0  73D   1  489   17  I  I I       IIII I    I   F   II  III   I    III     IIIII  II       
    22   22 L T  E     -KL   7  72D  29  489   58  T  T T       TTTT T    S   T   TT  TTT   T    TTT     TTTTT  TT       
    23   23 L a  E     -KL   6  71D   0  490    1  C  C C       CCCC C    C   C   CC  CCC   C    CCC     CCCCC  CC       
    24   24 L R  E     -KL   5  70D 110  490   45  Q  R R       QRRR Q    R   R   RQ  KRR   R    RIR     RRRRR  KK       
    25   25 L A  E     -K    4   0D  10  490   29  A  A A       AAAA A    M   A   AA  AAA   A    AAA     AAAAA  AA       
    26   26 L S  S    S+     0   0   66  490    4  S  S S       SSSS S    S   S   SS  SSS   S    SSS     SRSSS  SS       
    27   27 L E  S    S-     0   0  101  490   38  Q  Q Q       QQQQ Q    Q   Q   QQ  QQQ   Q    QEQ     QQQQQ  QQ       
    28   28 L N        +     0   0   83  490   45  G  G G       DSSS D    G   S   GD  DGS   G    NDN     NGSGD  DD       
    29   29 L I    >   -     0   0    5  491   32  I  I I       IIVI I    I   I   II  III   I    IVI     IIIII  II       
    30   30 L Y  T 3   -     0   0  155  491   81  T  S S       RSYS G    S   S   RS  NSG   N    NSN     SSNRS  NN       
    31   31 L S  T 3  S+     0   0   53  467   65  N  S S       NSNN N    S   S   ND  SSS   N    SSS     SSINH  NN       
    32   32 L Y    <   +     0   0   63  490   52  D  W Y       SWYY W    Y   Y   DY  YYN   Y    WYW     WWWDW  YY       
    33   33 L L  E     -O   90   0E   0  490    7  L  L L       LLVL L    L   L   LL  LLL   L    LLL     LLLLL  LL       
    34   34 L A  E     -O   89   0E   0  490   71  A  A A       IAAN A    A   N   GI  SNA   S    AHA     AAATA  SS       
    35   35 L W  E     -OP  88  48E   1  491    0  W  W W       WWWW W    W   W   WW  WWW   W    WWW     WWWWW  WW       
    36   36 L Y  E     -OP  87  46E   0  491    9  Y  Y Y       YYFY Y    Y   Y   YY  FYY   Y    YYY     YYYYY  LL       
    37   37 L Q  E     -OP  86  45E   7  491   28  Q  Q Q       QQQQ Q    Q   Q   QQ  QQQ   Q    QQQ     QQQQQ  QQ       
    38   38 L Q  E     -O   85   0E  21  491    4  Q  Q Q       QQQQ Q    Q   Q   QQ  QQQ   Q    QQQ     QQQQQ  QQ       
    39   39 L K    >   -     0   0   51  490    9  K  K K       KKKK K    K   K   KK  KKK   K    KKK     KKKKK  KK       
    40   40 L Q  T 3  S+     0   0  190  491   19  P  P P       PPPP P    P   P   PL  PPP   P    PQP     PPPPS  PP       
    41   41 L G  T 3  S+     0   0   86  491   10  G  G G       GGGG G    G   G   GG  GGG   G    GGG     GEEGG  GG       
    42   42 L K  S <  S-     0   0  126  490   54  E  K K       KKKK K    K   K   KK  KKK   K    QQK     KKKTK  KK       
    43   43 L S        -     0   0   21  490   55  T  A A       AAAA S    A   A   AA  SAV   A    AAA     AAAAA  SS       
    44   44 L P        -     0   0    4  490   11  P  P P       PPPP P    P   P   PP  PPP   P    PPP     PPPPP  PP       
    45   45 L Q  E     -P   37   0E  74  490   32  K  K K       KKKK Q    E   K   KN  KKK   K    KKK     KKKKK  KK       
    46   46 L F  E     +P   36   0E  25  490   42  L  L L       FLSL L    L   L   RL  TLL   P    LLP     VSLRL  TT       
    47   47 L L  E     +     0   0E   4  490    9  L  L L       LLLL L    L   L   LL  LLL   L    LLL     LLLLL  LL       
    48   48 L V  E     -PQ  35  54E   0  491    5  I  I I       IIII I    I   I   II  III   I    III     IIIII  II       
    49   49 L Y  E >> S+ Q   0  53E  39  491   17  Y  Y Y       YYYY Y    Y   Y   YY  YYY   Y    YRY     YYYYY  YY       
    50   50 L N  T 34 S-     0   0   52  491   91  E  A Y       DDDA G    A   A   AD  RYA   Y    KYR     KAKGS  RR       
    51   51 L A  T 34 S+     0   0    3  491   45  A  A A       AAAA A    A   A   AA  AAA   A    AAA     SAAAA  AA       
    52   52 L K  T <4 S+     0   0  148  491   25  S  S S       ESSS T    S   S   SS  NNS   S    SNS     SSSTS  NN       
    53   53 L T  E  <  -Q   49   0E  47  491   67  S  S S       NSTS S    T   S   ST  RST   S    STI     SSTSS  RR       
    54   54 L L  E     -Q   48   0E  60  491   60  L  L L       LLLL L    L   L   LL  LLL   L    LLL     LLLLL  LL       
    55   55 L G    >   -     0   0    9  490   71  Q  E Q       EEQQ A    Q   Q   QE  VAQ   E    EEQ     EQEQE  VV       
    56   56 L E  T 3  S+     0   0  192  490   35  S  S S       ISSS D    S   S   ST  DSS   T    SSS     SSTSN  DD       
    57   57 L G  T 3  S+     0   0   70  491    5  G  G G       GGGG G    G   G   GG  GRE   G    GGG     GGGGG  GG       
    58   58 L V    <   -     0   0   25  489   11  I  V V       VVVV V    V   V   VV  VVV   V    VVV     VVVVV  VV       
    59   59 L P    >   -     0   0   47  490    7  P  P P       PPPT P    P   P   PP  PPP   P    PPP     PPPPP  PP       
    60   60 L S  T 3  S+     0   0  115  491   57  S  S S       SSSS S    S   S   SS  SSS   S    SSS     SSSSS  SS       
    61   61 L R  T 3  S+     0   0   44  491    4  R  R R       RRNR R    R   R   RR  RRR   R    RRR     RRRRR  RR       
    62   62 L F  E <   +M   75   0D   5  491    1  F  F F       FFFF F    F   F   FF  FFF   F    FFF     FFFFF  FF       
    63   63 L S  E     -M   74   0D  55  490   22  S  S S       RSTS S    S   S   SS  SSS   S    SSS     SSSSS  SS       
    64   64 L G  E     +M   73   0D  13  491    2  G  G G       GGGG G    G   G   GG  GGG   G    GGG     GGGGG  GG       
    65   65 L S  E     +M   72   0D  63  491    5  S  S S       SSSS S    S   S   SS  SSS   S    SSS     SSSSS  SS       
    66   66 L G  E     -M   71   0D  36  491   14  G  G G       GGGG R    G   G   GG  GGG   G    GGG     GGGGG  GG       
    67   67 L S  E >   +M   70   0D  79  491    9  S  S S       SSSS S    S   S   SS  SSS   S    SSS     SSSSS  SS       
    68   68 L G  T 3  S-     0   0   16  491   13  G  G G       GGGG G    G   G   GG  GGG   G    GGG     GGGGG  GG       
    69   69 L T  T 3  S+     0   0   67  488   13  T  T T       TTTT T    T   T   TT  QTT   T    TTT     TTTTT  QQ       
    70   70 L Q  E <   +LM  24  67D 110  489   27  D  D D       DEDD Q    D   D   EE  DED   D    DED     DDEEE  DD       
    71   71 L F  E     -LM  23  66D   2  491    6  F  F Y       FFFF Y    F   F   FY  YFF   Y    YFF     FFFFF  YY       
    72   72 L S  E     -LM  22  65D  26  491   30  T  T T       ATIT S    T   T   TT  STT   T    TTT     TTTTT  SS       
    73   73 L L  E     -LM  21  64D   0  491    2  L  L L       LLLL L    L   L   LF  LLL   L    FLL     LLLLL  LL       
    74   74 L K  E     -LM  20  63D  97  491   39  T  T T       STTT K    T   T   TT  TTT   T    TTT     TTTTT  TT       
    75   75 L I  E     -LM  19  62D   0  491    1  I  I I       IIII I    I   I   II  III   I    III     IIIII  II       
    76   76 L N  S    S-     0   0   86  491   30  S  S S       SSSS S    S   S   SS  SSS   S    SNS     SSNNS  SS       
    77   77 L S  S    S-     0   0   58  491   62  S  S S       SSSS R    C   S   NS  SSS   S    SSS     SSSSS  SS       
    78   78 L L        -     0   0    0  491   27  L  L L       LLLL L    L   L   LL  LLL   L    MLL     LLLLL  LL       
    79   79 L L    >   -     0   0   67  491   31  Q  Q Q       QQQQ Q    Q   Q   QQ  EQQ   Q    EEE     ZQQQQ  EE       
    80   80 L P  G >  S+     0   0   92  491   58  S  P P       PPPP V    S   P   PP  YPP   P    PPP     PPPPP  YY       
    81   81 L E  G 3  S+     0   0  102  491   13  E  E E       EDEE E    E   E   EE  EEE   E    EEE     BEDEE  EE       
    82   82 L D  G <  S+     0   0    1  491    5  D  D D       DDDD D    D   D   DD  DDE   D    DDD     BDDDD  DD       
    83   83 L F    <   +     0   0   29  490   72  F  F F       FFFS I    F   F   FI  MFV   I    AVV     FFFFF  MM       
    84   84 L G  E    S- R   0 105E  17  491   23  A  A A       AAAA G    A   A   AA  GAA   A    AAA     AAAAA  GG       
    85   85 L S  E     -OR  38 104E  24  491   63  T  T T       TTTT I    T   T   TT  ITT   T    TTT     TTTTT  II       
    86   86 L Y  E     -OR  37 103E   0  491    0  Y  Y Y       YYYY Y    Y   Y   YY  YYY   Y    YYY     YYYYY  YY       
    87   87 L Y  E     -O   36   0E   5  490    4  Y  Y Y       YYYY Y    Y   Y   YY  YYY   Y    YYF     YYYYF  YY       
    88   88 L a  E     -O   35   0E   0  491    0  C  C C       CCCC C    C   C   CC  CCC   C    CCC     CCCCC  CC       
    89   89 L Q  E     -OS  34  99E   0  489   48  Q  Q Q       QQQQ Q    Q   Q   LQ  LQQ   Q    QQQ     QQQLQ  LL       
    90   90 L H  E     -O   33   0E  22  483   26  H  Q Q       QQQQ Q    Q   Q   QQ  QQK   Q     QQ     QQQQQ  KK       
    91   91 L H        +     0   0    0  421   89  Y  A H       YY.S A    Y   S   H.  .GS   Y      G      Y..A  ..       
    92   92 L Y  S    S+     0   0  104  454   88  Y  N S       YNYY S    Y   Y   NY  YNN   N      Y      NYYH  YY       
    93   93 L G  S    S-     0   0   34  422   71  S  S S       .SNS S    S   .   SD  DSK   N             SSS.  DD       
    94   94 L T  S    S-     0   0  104  446   88  T  F T       N ST A    F   S   YD  GNI   S             YRSS  EE       
    95   95 L P  S    S+     0   0    7  443   51  P  P P       L YL P    P   T   PL  FPT   P             PYFV  FF       
    96   96 L P  S    S-     0   0   55  421   75  P  P P       P PI P    P   P   PP  P P   P              PPP  PP       
    97   97 L L        -     0   0   21  160   88     T T       Y Y.      .   I    Y  L                    YWL  LL       
    98   98 L T        -     0   0   40  288   41     V V       T TT      T   T    T  T                    TTT  TT       
    99   99 L F  B     -S   89   0E  18  290   29     L L       F FF      F   F    F  F                    FFF  FF       
   100  100 L G        -     0   0    3  294   39       H       G GG      G   G    G  G                    GGG  GG       
   101  101 L G        -     0   0   52  307   63       T       Q QQ      Q   Q    Q  A                    QQG  AA       
   102  102 L G        -     0   0   11  306   43       Q       G GG      G   G    G  G                    GGG  GG       
   103  103 L T  E     - R   0  86E   0  366   18       T       T TT      T   T    T  T                    TTT  TT       
   104  104 L K  E     -nR  10  85E  98  363   58       K       K KR      K   R    K  K                    KKT  KK       
   105  105 L L  E     -nR  11  84E   4  343   37               L VL      V   L    V  L                    LVV  LL       
   106  106 L E  E     -n   12   0E 108  326   51               E QE      E   E    E  E                    DED  EE       
   107  107 L I  E      n   13   0E 113  301   50               I II      I   I    I  L                    IVI  LL       
   108  108 L K              0   0  145  268   18               K KK      K   K    K  K                    KKK  KK       
   109      ! !              0   0    0   0     0  
   110    1 H E              0   0  194  408   30   EE E EE E       Q      QQQ EQQ   Q   QEE EQQE       E     QQ  QQEEEEE
   111    2 H V        +     0   0   19  465   12   VV V LV V       V VVVV VVV VVV   V   VVV VVVV       V     VV  VVEEVEV
   112    3 H K  E     -A  134   0A 111  467   31   QQ Q QQ K       H QQQQ HQQ QQQ   Q   QQQ QEKK       Q     QQ  QQQQQQQ
   113    4 H L  E     -A  133   0A   3  489    1   LL L LL L       L LLLL LLL LLL  LL   LLL LLLL       L     LL  LLLLLLL
   114    5 H Q  E     -A  132   0A  83  493   70   VV V VV L       K VVVV VQQ VQQ  EV   VVV VVVE       V     QQ  VVVVVVV
   115    6 H E  E     +A  131   0A   5  498   21   EE E EEEE       E EEEE EEE EEE  QE   EEE EEQE       E     EE  EEEEEEE
   116    7 H S  E     +A  130   0A  69  501   13   SS S SSSS       T SSSS SSS SSS  SS   SSS SSAS       S     SS  SSSSSSS
   117    8 H G        +     0   0   36  505    4   GG G GGGG       G GGGG GGG GGG  GG   GEG GGGG    G  G     GG  GGGGGGG
   118    9 H G        +     0   0   29  672   48   GG G GGGGGGG    G GGGG GGG GGG  GG   GGG GGGG   GGGGG     GG  GGGGGGG
   119   10 H D        -     0   0   96  677   40   DG G GGGGGGG    G GGGG GGG GGE  GG   GGG DGGG   GGGGG     GG  GGGGGGG
   120   11 H L  E     +e  224   0B  79  675   16   LL L LLLLLLL    L LLVL VLL VLL  VV   VLL LVVL   LLLLL     LL  VVLLLLL
   121   12 H V  E     -e  225   0B  16  677   33   VV V VVVVVVV    V VVVV VVV VVV  VV   VVV VVVV   VVVVV     VV  VVVVVVV
   122   13 H Q    >   -     0   0  114  679   51   QL Q QQQQQQQ    Q QQQK QQQ QQQ  QQ   QQQ KZQQ   QQQQK     QQ  QQQQQQQ
   123   14 H P  T 3  S+     0   0   66  678    9   PP P PPPPPPP    P PPPP PAA PAP  PP   PPP PPPP   PPPPP     AP  PPPPPPP
   124   15 H G  T 3  S+     0   0   58  682   32   GG G GGGGGGG    G GGGG GGG GGG  GG   GGG GGGG   GKGGG     GG  GGGGGGG
   125   16 H G    <   -     0   0   25  684   63   GG G GGGGGGE    R GGRG KGG RGG  KR   RGG GRRG   GGGGG     GG  RRGGGGG
   126   17 H S        +     0   0   78  683   31   SS S CSSSSSS    S SSSS SSS SSS  SS   SSS SSSS   SSSSS     SS  SSSSSSS
   127   18 H L  E     - B   0 192A  25  685   25   LL L LLMLLLL    L LLLL LLL LLL  LL   LLL LLLM   LLLLL     LL  LLLLLLL
   128   19 H K  E     - B   0 191A  93  683   56   RR R KRKKKRK    K RRRR RRR RTK  RR   RRR RRRK   RKRRR     RR  RRRRRRR
   129   20 H L  E     - B   0 190A   0  688   14   LL L LLLLLLL    L LLLL LLL LLL  LL   LLL LLLL   LLLLL     LL  LLLLLLL
   130   21 H S  E     -AB 116 189A  28  688   37   SS S SSSSSSS    S SSSS SSS SSS  SS   SSS SSSS   SSSSS     SS  SSSSSSS
   131   22 H b  E     -AB 115 188A   0  688    0   CC C CCCCCCC    C CCCC CCC CCC  CC   CCC CCCC   CCCCC     CC  CCCCCCC
   132   23 H A  E     -AB 114 187A  52  688   66   AA A AAVAAAE    V AAAA EAA AAA  AA   AAA VAIV   AAAAV     AA  AAAAAAA
   133   24 H A  E     +A  113   0A   8  688   49   AA A AAAAATS    A VAAA AAA AAA  AA   AAA AAAA   TATTG     AA  AAAAAAA
   134   25 H S  E     +A  112   0A  58  688   12   SS S SSSSSSN    S SSSS SSS SSS  SS   SSS SSSS   SSSSS     SS  SSSSSSS
   135   26 H G  S    S+     0   0   56  688    4   GG G GGGGGGE    G GGGG GGG GGG  GG   GGG GGGG   GGGGG     GG  GGGGGGG
   136   27 H F  S    S-     0   0   33  686   34   FF F FFFFFFY    F FFFF FLL FPL  FF   FFF IFFF   FFFFF     RN  FFFFFFF
   137   28 H T    >   -     0   0   93  687   50   TT T TTTDDTE    T TTTT TTT TMT  TT   TTT TTTT   TTTTT     TI  TTTTTTT
   138   29 H F  G >  S+     0   0    2  688   41   FF F FFFFFFF    F FFFF FFF FSF  FF   FFF FFFF   FFFFF     GD  FFFFFFF
   139   30 H S  G 3  S+     0   0   57  688   55   NS S SSSSSTP    S TSSS SDD SST  RS   SSS SSSS   TNTTS     SR  SSSSSSR
   140   31 H S  G <  S+     0   0   71  688   60   DS D NSNGRDS    S TNSN TTT HSN  NN   SSS GNNN   DTDDN     TL  TTDNSSS
   141   32 H Y  S <  S-     0   0   44  688   41   YY Y YYYYYYH    Y YYYA YYY YAY  YY   YYY YYYY   YYYYY     YY  YYYYNYY
   142   33 H T        -     0   0   30  688   91   ED Y RAWWWYD    W EWGW GAA PVS  GG   GYG DAGW   YAYYY     DA  AARRSNG
   143   34 H M  E     -FG 207 160C   0  672   46   MM M MMMMMMM    M MMMM MMM MMM  MM   MMM MMMM   MMMMM     MM  MMMMMMM
   144   35 H S  E     -FG 206 159C   0  685   73   NN S SHNSSSS    Y NNHS SGG HSG  HH   HNH QHHN   SNSSN     GA  HHNNNNS
   145   36 H W  E     +FG 205 158C   0  688    0   WW W WWWWWWW    W WWWW WWW WWW  WW   WWW WWWW   WWWWW     WW  WWWWWWW
   146   37 H V  E     -FG 204 156C   0  688   19   VV V VVVVVVV    I VAVV VFF VFF  VV   VVV VVVV   VVVVV     FY  VVVVVVI
   147   38 H R  E     -FG 203 155C  10  688   17   RR R RRRRRRR    R RRRR RRR RRR  RR   RRR RRRR   RRRRR     RR  RRRRRRR
   148   39 H Q  E     -FG 202 154C   9  688    3   QQ Q QQQQQQK    Q QQQQ QQQ QQP  QQ   QQQ QQQQ   QQQQQ     QQ  QQQQQQQ
   149   40 H T    >   -     0   0    9  688   68   AA A AASAAPT    A AVAA AAA AAG  AA   AAA APAS   PAPPA     AA  AAAAAAA
   150   41 H P  T 3  S+     0   0   80  687   10   PP P PPPPPPP    P PPPP PPP PPP  PP   PPP PPPP   PPPPP     PA  PPPPPPP
   151   42 H E  T 3  S-     0   0  151  688   26   GG G GGEGGGE    G GGGG GGG GGG  GG   GGG GGGE   GGGGG     GG  GGGGGGG
   152   43 H K    <   +     0   0  121  688   32   KK K KKKKKKK    K KKKK KKK KKV  KK   KKK KKKK   KKKKK     KK  KKKKKKK
   153   44 H R        -     0   0  113  687   43   AG G GGGGGAR    G GGGG GKK GED  GG   GGG GGGG   AGAAG     EQ  GGGGGGG
   154   45 H L  E     -G  148   0C   9  688   14   FL L LLLLLLL    L LLLL LRR LQR  LL   LLL LLLL   LLLLL     RR  LLLLLLL
   155   46 H E  E     -G  147   0C  44  687    5   EE E EEEEEEE    E EEEE DEE QEE  EE   EEE QEEE   EEEEE     EE  EEEEEEE
   156   47 H W  E     +G  146   0C  15  687   11   WW W WWWWWWL    W WWWW WYY WFA  WW   WWW KWWW   WWWWW     SL  WWWWWWW
   157   48 H V  E     -     0   0C   0  687   28   VV V VVVIILV    V VVVV VVV VVV  VV   VVV VVVV   LVLLV     VV  VVVVVVV
   158   49 H A  E     -G  145   0C   0  688   38   SA S SSAGGGA    S SAAG AAA AAA  AA   AAS AAAA   GAGGS     AA  AAAAAAA
   159   50 H S  E     -GH 144 168C   0  688   94   YY G YVEEEFA    S YNVR LAA FRA  GV   VRA YVVE   FRFFY     AI  VVYYVLV
   160   51 H I  E     -GH 143 167C   4  675   18   II I IIIIIII    I IIII III III  II   III FIII   IIIII     IA  IITTIII
   161   52 H N    >   -     0   0   47  682   84   NS N NSRNNRN    N SKSK SSS SRS  SS   STS NSWR   RRRRN     NH  SSSSWSW
   162   53 H N  T 3  S+     0   0   65  684   88   GI W STLPPNS    T SQYS YWW YWW  SP   YNG DYYL   NSNNS     WL  YYYYNNN
   163   54 H G  T 3  S-     0   0   65  686   68   GP N DDKDDKD    D SDDK DTT DSS  DD   DSN ABNK   KKKKD     DS  DDGGDGD
   164   55 H G  S <  S+     0   0   30  687   43   GS G GGSSSAG    G GGGT GGG GGG  GE   GGG LGGS   ASAAG     SG  AGDDGGG
   165   56 H G  S    S+     0   0   74  688   63   Gg G TRgSSnG    G fTSd SII TGD  RN   SGG SBSh   nnnnS     AL  NNggSSS
   166   57 H R        +     0   0  163  505   86   Ts S .TaTTtS    S tENt TSS NTN  KS   NSS ABRa   tattS     R.  YYppQ.Q
   167   58 H T  E     -H  160   0C  62  677   52   AT T ATTIITT    T KKKT QTT IST  KQ   KST QKTT   TTTTT     TL  KKIIKTK
   168   59 H Y  E     +H  159   0C  53  686   85   YY G YYHNNEY    Y YYYD YYY EYY  KY   YYY GYYH   EYEEY     YT  YYHSYYY
   169   60 H Y        -     0   0   44  688    9   YY Y YYYYYYY    Y YYYY YYY HYY  YY   YYY YYYY   YYYYY     YY  YYYYYYY
   170   61 H P    >>  -     0   0   20  688   65   AA A AAATTSP    P AVAA AAA AAV  VG   AAA AAGA   SASSA     AA  AAAAAAA
   171   62 H D  T 34 S+     0   0  148  688   64   SD D DDEPPAD    D DDDA GDD ENS  DD   DEA DBDE   ADAAD     SD  DDAADND
   172   63 H T  T 34 S+     0   0   90  688   57   SA S SSSFSST    S SSSP SII SSS  SS   SYS ASSS   SSSSS     SS  SSSSSSS
   173   64 H V  T X> S+     0   0    1  688   42   VV V VVVLLVM    V VVVV VAA VVV  VV   VVV VVVV   VVVVV     VV  VVVVVVV
   174   65 H K  B 3< S+c  177   0A 142  687   31   KK K KKKKKKE    K KKKK KKK REK  KK   KKK KKKK   KKKKK     RK  KKKKKKK
   175   66 H G  T 34 S+     0   0   74  687   36   GG G GGGDDGR    G GGGG GGG GGG  GG   GGG GGGG   GDGGG     GG  GGGGGGG
   176   67 H R  T <4 S+     0   0   36  688   17   RR R RLRKKRR    R RRRR RRR RRR  RR   RRR RRRR   RRRRR     RR  RRRRRRR
   177   68 H F  E  <  -cD 174 192A   2  688   60   FF F FFFFFFF    F FFFF FFF FFF  FF   FFF FFFF   FFFFF     FF  FFFFFFF
   178   69 H T  E     - D   0 191A  79  688   38   IT T TTTIITI    T TTTT TTT TTT  TT   TTT TTTT   TTTTT     TT  TTTTTTT
   179   70 H I  E     + D   0 190A   5  688   20   TI I IIIIIII    I IIII III III  II   III IIII   IIIII     IV  IIIIIII
   180   71 H S  E     - D   0 189A  51  684   41   SS S SSSSSSS    S SSSS SSS SSS  SS   SSS SSSS   SSSSS     SS  SSSSSSS
   181   72 H R  E     - D   0 188A  30  687   60   RR R RRRRRRR    R RRRR RRR RRR  RR   RRR KRRR   RRRRR     RR  RRRRRKR
   182   73 H D  E > > - D   0 187A  60  686    7   DE N DDDDDDD    D GDDD DDD DDD  DD   DDD DDDD   DDDDD     DD  DDDDDDD
   183   74 H N  G > 5S+     0   0   48  688   57   NN N NNDNNNN    N NNND NNN NNN  KN   NNN NBND   NDNNN     NN  NNNNNNN
   184   75 H A  G 3 5S+     0   0   99  688   45   AA A AASAAST    A AASS SAA SAA  SS   SAT ASSS   SSSSS     AA  SSAAAGD
   185   76 H K  G < 5S-     0   0  111  688   51   KK K KKKKKQK    E KRKK KKK KKK  KK   KKK KKKK   QQQQK     KK  KKKKKKK
   186   77 H N  T < 5 +     0   0   62  688   46   NN N NNSNNSK    N DNNN NNN NNN  NN   NNN DBRS   SSSSS     KN  NNNNNNN
   187   78 H T  E   < -BD 132 182A  16  688   69   MS S SSSTTIT    T SSTT TTT ITT  TT   TTS STTS   IMIIE     TT  TTTTMST
   188   79 H L  E     -BD 131 181A   0  687   56   LL L LLVLLLL    V LLLL LLL LMV  LV   LLL LLLV   LLLLL     VV  LLLLLLL
   189   80 H Y  E     -BD 130 180A  41  687   46   YY Y YYYFYYY    Y FYYY YYY FYY  YY   YYY YYYY   YYYYY     YY  YYYYYYY
   190   81 H L  E     -BD 129 179A   0  687    7   LL L LLLLLLL    L LLLL LLL LLL  LL   LLL LLML   LLLLL     LL  LLLLLLL
   191   82 H Q  E     -BD 128 178A  76  687   41   QQ Q QQQQQQQ    Q QQQQ QQQ QQQ  QQ   QQQ QQZQ   QQQQQ     QQ  QQQQQQQ
   192   83 H M  E     +BD 127 177A   0  688   11   MM M MMMMMMM    M MMMM MMM MMM  MM   MMM MMMM   MMMTM     MM  MMMMMMM
   193   84 H S        +     0   0   42  688   54   NS N NNNSSNS    N HNNN TDD NNN  NN   NNS NNNN   NNNNN     NH  NNSSNSN
   194   85 H S  S    S-     0   0   68  687   24   SS S SSNKKTS    S SSSS SSS SKS  SS   SSS SSSN   TNTTN     SS  SSSSSSS
   195   86 H L        -     0   0    3  686   18   LL L LLLVVLL    L LLLL LLL LLL  LL   LLL LLLL   LLLLL     LL  LLLLLLL
   196   87 H K    >   -     0   0  102  686   68   RR R RKRRRRR    R RRRK RKK RKK  RR   RKR RRRR   RKRRR     KK  RRRRRRG
   197   88 H S  G >  S+     0   0   70  686   60   AA A ATASSAS    S AAAT VPP IPP  AA   AVA AATA   ATAAA     PP  AAAAAAS
   198   89 H E  G 3  S+     0   0  126  687   22   EE E EEEEEEE    E EEEE EEE AEQ  EE   EEE EEEE   EEEEE     EE  EEEEEEQ
   199   90 H D  G <   +     0   0    2  687    3   DD D DDDDDDD    D DDDD DDD DDD  DD   DDD DBDD   DDDDD     DD  DDDDDDD
   200   91 H T    <   +     0   0   32  688   28   TT T TTTTTST    T TTTT TTT TTT  TT   TTT TTTT   STSSS     TT  TTTTTTM
   201   92 H A  E    S- I   0 223C   8  686    5   AA A AAGAAAA    A AAAA AAA AAA  AA   AAA AAAA   AAAAA     AA  AAAAAAA
   202   93 H M  E     -FI 148 222C  58  687   48   VV L VVILLTL    T VIVV VVV VVV  VL   VMV VVVI   TMTTV     VV  VVVVMVI
   203   94 H Y  E     -FI 147 221C   0  688    1   YF Y YYYYYYY    Y YYYY YYY YYY  YY   YYY YYYY   YYYYY     YY  YYYYYYY
   204   95 H Y  E     -F  146   0C   7  688    4   YY Y YYYFYYY    Y YYYY YYY YTY  YY   YYY YYYY   YYYYY     TY  YYYYYYY
   205   96 H b  E     -F  145   0C   0  688    1   CC C CCCCCCC    C CCCC CCC CCC  CC   CCC CCCC   CCCCC     CC  CCCCCCC
   206   97 H V  E     -FJ 144 217C   0  688   23   TV A AATAAAA    A AAAT AAA AAA  AA   AAA AAAS   AVAAA     GN  AAAAAAV
   207   98 H R  E     -FJ 143 216C  21  687   40   tR r rrrRrrr    K Rtkt kaa Rlv  kk   ktr PrrT   Rnrrs     aR  kkRrRrr
   208   99 H H  E     + J   0 214C   6  583   92   g. r sm..lym    . Qsai vpp .gd  as   fvr .yl.   .dggf     g.  ffDt.vl
   209  100 H E  E  >  + J   0 213C  63  625   78   N. S RD..LPA    . TSAP GAA ESG  GS   DGG .GT.   .GTTD     G.  EETQ.AG
   210  101 H Y  T >4 S-     0   0   80  658   93   G. Y VA.NRYW    . LDTT YPP IFW  GH   WNS .BAG   VTYYF     TA  WWQQ.LW
   211  102 H Y  T 34 S-     0   0  140  672   23   Yh f FF.wYYF    . fYFY yWW YYW  FF   lFF WYFF   lFYYY     WY  llVVYLF
   212  103 H Y  T 34 S+     0   0   39  265   92   .e f H.gv...    . v..V a.. G..  ..   g.. .R..   r....     .G  gg...L.
   213  104 H A  E <<  -J  209   0C   0  403   87   WR I YGVG.A.    D H..T G.. DQ.  ..   Y.. QAS.   A.GG.     .N  YYQQ.A.
   214  105 H M  E     +J  208   0C   0  497   62   AK S PKPFFM.    C F..V I.. SV.  .L   F.. FFF.   M.MM.     .P  FFLL.E.
   215  106 H D  E     +     0   0C  19  615   50   SL R CCDDDDA    S D.DD DDD TDD  DD   DR. ENDA   DAGD.     DT  DDEE.DP
   216  107 H Y  E     -J  207   0C  99  624   65   YI I VKYYVYY    L Y.YY YYY NYY  IS   YF. YYYY   YYYYY     SY  YPVV.MV
   217  108 H W  E     -J  206   0C  23  675    2   WW W WWWWWWW    W WWWW WWW WWW  WW   WW. WWWW   WWWWW     WW  WWWW.WW
   218  109 H G        -     0   0    0  664   17   GA   GTGGGGG    I GGGG GGG GGG  GG   GGL GGGG   GGGGG     GG  GGSS.AF
   219  110 H Q        -     0   0   91  659   46   QQ   R QQAQQ    H QQQQ QQQ QQQ  QQ   QLL QQQQ   QQQQQ     QK  QQGG.VP
   220  111 H G        -     0   0   16  650   16    G   G GVGGG    I GGGG GGG GGG  GG   GnG GGGG   GGGGG     GG  GGSS.mL
   221  112 H T  E     -I  203   0C  21  594   27    F     TTTTT    Q TTTT TTT TTT  TT   TpS TTVT   TTTTT     TT  TT...t.
   222  113 H T  E     -I  202   0C  72  593   76    P     TTTSL    L LLLL LQQ LQQ  ML   LMM LLLL   SLSSL     QL  LL...LL
   223  114 H V  E     -I  201   0C   0  596   20    L     LLVVV    L VVVV VVV VVV  VV   VVL VVVV   VVVVV     VV  VVCC.LV
   224  115 H T  E     -e  120   0B  36  593   20    K     TTTTT    D TTTT TTT TTT  TT   TSS TTTT   TTTTT     TT  TTVV.TT
   225  116 H V  E     +e  121   0B   6  572    6    L     VVVVV    V VVVV VVV VVV  VV   V   VVVV   VVVVV     VV  VVVV. I
   226  117 H S        -     0   0   36  566   11    S     SSSSS      SSSS SSS SSS  SS   S   SSS    SSSSS     SS  SSSS. S
   227  118 H S  S    S+     0   0   84  551   22    A     SSSSA      SSSS SSS SSS  SS   S   SSS    SASSS     SS  SSSST  
   228  119 H A  S    S+     0   0   70  123   53                          A        A                               SSV  
   229  120 H W        -     0   0  123   73   63                                                                     R  
   230  121 H R        +     0   0  207   60   75                                                                     R  
   231  122 H H              0   0  156   54   67                                                                     S  
   232  123 H P              0   0  155   35   53                                                                        
## ALIGNMENTS  281 -  350
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....9....:....0....:....1....:....2....:....3....:....4....:....5
     1    1 L D              0   0  183  420   16  DD DDDDDD D     D   D      D        DD  D       DDDDD   D      D  DDDD
     2    2 L I        -     0   0   32  462   11  IPIIIIIIIII     I  II      I        III I       IIIII  II      IIIIITI
     3    3 L E        -     0   0  117  463   68  QVRQQQQQQQQ     M  ZQ      Q        QQQ Q       QQQQQ  QQ      QQVQQQQ
     4    4 L L  E     -K   25   0D  10  474    7  MLMMMMMMMMM     M  MM      M        MMM M       MMMMM  LM     LMMLMMMM
     5    5 L T  E     -K   24   0D  64  475    8  TTTTTTTTTTT     T  TT      T        TIT T       TTTTT  TT     TTTSTTTT
     6    6 L Q  E     -K   23   0D  13  475    0  QQQHQQQQQQQ     Q  QQ      Q        QQQ Q       QQQQQ  QQ     QQQQQQQQ
     7    7 L T  E    S+K   22   0D  64  475   34  STSSSSSSSSS     S  SS      S        PTS S       SSSSS  SS     TSSSSSSS
     8    8 L P        -     0   0   46  480    9  PPPPPPPPPPP     P  PP      P        PPP P       PPPPP  PP     PPPPPPPP
     9    9 L V  S    S+     0   0   96  484   67  SSSPSSSSSSS     S  SS      S        SSS S       SSSSS  AS     SVSASSSS
    10   10 L S  E     -n  104   0E  60  485   43  SSSSSSSSSSS     S  SS      S        SSS S       SSSSS  SS     PISSSSSS
    11   11 L L  E     -n  105   0E  58  489   21  LVLLLLLLLLL     L  LL      L        LLL L       LLLLL  LL     VLLLLLQL
    12   12 L S  E     +n  106   0E  60  490   42  SSSSSSSSSSS     S  SS      S        SPS S       SSSSS  AS     SSPSSSSS
    13   13 L A  E     -n  107   0E   0  490   58  AEAAAAAAAAA     A  AA      A        AAA A       AAAAA  AA     AAAGAAAA
    14   14 L S    >   -     0   0   47  491   29  SPSSSSSSSSS     S  SS      S        SSS S       SSSSS  SS     ASSSSSSS
    15   15 L V  T 3  S+     0   0   76  491   66  VVTLVVVLLVV     P  VV      V        VVV V       VVVVV  LV     VLTSVVVV
    16   16 L G  T 3  S+     0   0   42  491    4  GGGGGGGGGGG     G  GG      G        GGG G       GGGGG  GG     GGGGGGGG
    17   17 L E    <   -     0   0   71  491   35  DGDEDDDDDDD     D  DD      D        DDD D       DDDDD  DD     GEDEDDDD
    18   18 L T        -     0   0   69  491   62  RTRTTTRTTRR     R  RR      R        RTT R       RRRRR  TR     TSRRRRRT
    19   19 L V  E     - L   0  75D  11  491   37  VVVVVVVVVVV     V  VV      V        VVV V       VVVVV  VV     VVVVVVVV
    20   20 L T  E     - L   0  74D  67  490   30  TTTTTTTTTTT     T  TT      T        TTT T       TTTTT  ST     TTTTTTTT
    21   21 L I  E     - L   0  73D   1  489   17  IIIIIIIIIII     I  II      I        III V       IIIII  II     IIIIIIII
    22   22 L T  E     -KL   7  72D  29  489   58  TKTTTTTTTTT     T  TT      T        SKT T       TTTTT  TT     KTTSTTTT
    23   23 L a  E     -KL   6  71D   0  490    1  CCCCCCCCCCC     C  CC      C        CCC C       CCCCC  CC     CCCCCCCC
    24   24 L R  E     -KL   5  70D 110  490   45  RQRKRRRRRRQ     R  RR      R        QKR R       QQQQR  RR     QQQKRRQR
    25   25 L A  E     -K    4   0D  10  490   29  AAAAAAAAAAA     A  AA      A        AAA A       AAAAA  AA     TSAAAAAA
    26   26 L S  S    S+     0   0   66  490    4  SSSSSSSSSSS     S  GS      S        SSG S       SSSSG  SS     SSSSSSSS
    27   27 L E  S    S-     0   0  101  490   38  QEQQQQQQQQQ     Q  QQ      Q        QQQ Q       QQQQH  QQ     QQQEQQQQ
    28   28 L N        +     0   0   83  490   45  GDGSGGGGGGD     N  SD      G        SGS G       DDDDN  SG     SSGNGGSG
    29   29 L I    >   -     0   0    5  491   32  IIIIIIIIIII     I  VI      I        III I       IIIII  II     IIIVIILI
    30   30 L Y  T 3   -     0   0  155  491   81  NYSSSSNSSSS     N  NT      S        YSY N       NSIRT  NS     YYGYSSSS
    31   31 L S  T 3  S+     0   0   53  467   65  NSSTNSHKKNN     S  KN      N        NNN K       HDKKN  KS     STSSNDNN
    32   32 L Y    <   +     0   0   63  490   52  ELYWYYYYYEY     W  YY      W        YVV E       YYYHF  WY     YYYNWYYY
    33   33 L L  E     -O   90   0E   0  490    7  LLLLLLLLLLL     L  LV      L        LLL L       LLLLL  LL     LLLLLLLL
    34   34 L A  E     -O   89   0E   0  490   71  AAAAAASNNSN     A  NN      A        NNA S       NNNNS  AA     AANHASNN
    35   35 L W  E     -OP  88  48E   1  491    0  WWWWWWWWWWW     W  WW      W        WWW W       WWWWW  WW     WWWWWWWW
    36   36 L Y  E     -OP  87  46E   0  491    9  YYYYYYYYYYY     Y  YF      Y        YYY Y       YYYYY  YY     YYYYYYYY
    37   37 L Q  E     -OP  86  45E   7  491   28  QQQQQQQQQQQ     Q  QQ      Q        QQQ Q       QQQDQ  QQ     QQQQQQQQ
    38   38 L Q  E     -O   85   0E  21  491    4  QQQQQQQQQQQ     Q  QQ      Q        QQQ Q       QQQQQ  QQ     QQQQQQQQ
    39   39 L K    >   -     0   0   51  490    9  KKKKKKKKKKK     K  KR      K        KKK K       GKTKK  QK     KKKKKKKK
    40   40 L Q  T 3  S+     0   0  190  491   19  PPPPPPPPPPP     P  PP      P        PPP P       PPPPP  AP     PPPPPPPP
    41   41 L G  T 3  S+     0   0   86  491   10  WGGGGGGGGGG     G  GG      G        GGG G       KGGGG  GG     GGGGGGGG
    42   42 L K  S <  S-     0   0  126  490   54  KQKKKKKKKQK     Q  KQ      K        KNK K       KKKKK  KK     QEKQKKKK
    43   43 L S        -     0   0   21  490   55  DPASAAASSAA     A  AA      A        AAP A       AAAAA  AA     PHSAAAIA
    44   44 L P        -     0   0    4  490   11  PPPPPPPPPPP     P  PP      P        PPP P       PPPPP  PP     PPPPPPPP
    45   45 L Q  E     -P   37   0E  74  490   32  KKKKKKKKKTK     K  KK      K        KQK T       KKKRT  KK     KKKRKKKK
    46   46 L F  E     +P   36   0E  25  490   42  LLLLLPPLLLL     L  VV      L        FLL L       ILLLL  LL     LLLLLLLL
    47   47 L L  E     +     0   0E   4  490    9  LLLLLLLLLLL     L  LL      L        LLL L       LLLLL  LL     LLLLLLLL
    48   48 L V  E     -PQ  35  54E   0  491    5  IIITIIIIIII     I  II      I        TII I       IIIII  II     IIIIIIII
    49   49 L Y  E >> S+ Q   0  53E  39  491   17  YYYYYYYYYYY     Y  FY      Y        YYY Y       YYYYY  YY     YYYYYYYY
    50   50 L N  T 34 S-     0   0   52  491   91  SSAGAYYYDAD     K  AG      R        RDG A       DDEGA  SA     EAYDRARY
    51   51 L A  T 34 S+     0   0    3  491   45  AAAAAAATTAA     A  AA      A        AAT A       AAAAV  AA     AAAAAAAA
    52   52 L K  T <4 S+     0   0  148  491   25  SSSSSSSSSSS     S  SS      S        STS S       SSSSS  SS     SSSSSSSN
    53   53 L T  E  <  -Q   49   0E  47  491   67  NTTTSNSNNSN     S  SI      N        SNN S       NNNTN  TS     TNYNNSSR
    54   54 L L  E     -Q   48   0E  60  491   60  LLLLLLLLLLL     L  LL      L        LLL L       LLLLL  LL     LLLLLLLL
    55   55 L G    >   -     0   0    9  490   71  LAQQQEEEAQE     E  KE      E        QGA Q       EEQEQ  QQ     AAQAEQQE
    56   56 L E  T 3  S+     0   0  192  490   35  MSSSSSTTTST     S  ST      T        RFT T       TSATV  SS     SDSSTSSS
    57   57 L G  T 3  S+     0   0   70  491    5  GGGGGGGGGGG     G  GG      G        AGG G       GGGGG  GG     GGGGGGGG
    58   58 L V    <   -     0   0   25  489   11  VVVVVVVVVVV     V  VV      V        MVV V       VVVVV  VV     VIIVVVIV
    59   59 L P    >   -     0   0   47  490    7  PPPPPPPPPPP     P  PP      P        PPP S       PPPPP  PP     PPPPPPPP
    60   60 L S  T 3  S+     0   0  115  491   57  SSSSSSSSSSS     S  SS      S        SSS S       SSSSS  SS     SSSASSSS
    61   61 L R  T 3  S+     0   0   44  491    4  QRRRRRRRRRR     R  RR      R        QRR R       RRRRR  RR     RRRRRRRR
    62   62 L F  E <   +M   75   0D   5  491    1  FFFFFFFFFFF     F  FF      F        FFF F       FFFFF  FF     FFFFFFFF
    63   63 L S  E     -M   74   0D  55  490   22  SKSKSSSSRSS     S  SS      S        SSR S       SSSSS  KS     SSSSSSSS
    64   64 L G  E     +M   73   0D  13  491    2  GGGGGGGGGGG     G  GG      G        GGG G       GGGGG  GG     GGGGGGGG
    65   65 L S  E     +M   72   0D  63  491    5  SSSSSSSSSSS     S  SS      S        SSS S       SGSSS  SS     SSSSSSSS
    66   66 L G  E     -M   71   0D  36  491   14  GGGGGGGGGGG     G  GG      G        GGG G       GGGGG  GG     GGGRGGGG
    67   67 L S  E >   +M   70   0D  79  491    9  PSSSSSSSSSS     S  SS      S        YFS S       FSSSS  SS     SSSSSSSS
    68   68 L G  T 3  S-     0   0   16  491   13  GGGEGGGGGGG     G  GG      G        GGG G       GGGGG  GG     GGGGGGGG
    69   69 L T  T 3  S+     0   0   67  488   13  TTTTTTTTTTT     T  TT      T        RKT T       TATTA  TT     TTTTATTT
    70   70 L Q  E <   +LM  24  67D 110  489   27  DQEDDEDDDDD     D  DD      D        DDD D       DHDDE  DD     QQDADDDD
    71   71 L F  E     -LM  23  66D   2  491    6  YFFFFFYYFFF     Y  FF      F        FFY F       FFYFF  FF     FFFYFFFF
    72   72 L S  E     -LM  22  65D  26  491   30  TTTTTTTSSTT     T  TT      T        TTS T       TTTTT  TT     TSTTTTTT
    73   73 L L  E     -LM  21  64D   0  491    2  LLLLLLLLLLF     F  LF      L        LLL L       FFFLL  LL     LLLLLLLL
    74   74 L K  E     -LM  20  63D  97  491   39  TTTTTTTTTTT     T  TT      T        TAT T       TTTTT  TT     TKTTTTTT
    75   75 L I  E     -LM  19  62D   0  491    1  IIIIIIIIIII     I  II      I        III I       IIIII  II     IIIIIIII
    76   76 L N  S    S-     0   0   86  491   30  SSSSSSSSSSS     S  SS      S        SSS S       SSSSS  SS     SNDSSSSS
    77   77 L S  S    S-     0   0   58  491   62  SDCSSSSGGSS     S  GS      S        SSG S       GSSTS  GS     GNCSSSSS
    78   78 L L        -     0   0    0  491   27  LLLLLLLLLLL     M  LL      L        LLL L       LLLLL  LL     VLLLLLLL
    79   79 L L    >   -     0   0   67  491   31  QEQEQQQQQQQ     E  LQ      Q        QQE Q       QQQQQ  QQ     QQQEQQQQ
    80   80 L P  G >  S+     0   0   92  491   58  PCSAPPPAAPP     P  PP      P        PPA P       PPPPP  AP     CPPPPPPP
    81   81 L E  G 3  S+     0   0  102  491   13  EDEEEEEEEEE     E  EE      E        EEE E       EEEEE  EE     DEEEEEEE
    82   82 L D  G <  S+     0   0    1  491    5  DDDDDDDDDDD     D  DD      D        DDD D       DDDDD  DD     DDDDDDDD
    83   83 L F    <   +     0   0   29  490   72  AAFSFFIIVVI     A  FI      I        FVV V       IIIIF  VF     AVFAIFFF
    84   84 L G  E    S- R   0 105E  17  491   23  AAAGAAAAAAA     A  AA      A        AAG A       AAAGA  AA     AAAAAAAA
    85   85 L S  E     -OR  38 104E  24  491   63  TTTITTTDDTT     T  TT      T        TTN T       TTTNT  TT     TNTHTTTT
    86   86 L Y  E     -OR  37 103E   0  491    0  YYYYYYYYYYY     Y  YY      Y        YYY Y       YYYYY  YY     YYYYYYYY
    87   87 L Y  E     -O   36   0E   5  490    4  YYYYYYYYYYY     Y  YY      Y        YYY Y       YYYYY  YY     YYYYYYYY
    88   88 L a  E     -O   35   0E   0  491    0  CCCCCCCCCCY     C  CC      C        CCC C       CCCCC  CC     CCCCCCCC
    89   89 L Q  E     -OS  34  99E   0  489   48  QQQQQQQELLQ     Q  QQ      Q        QQQ Q       QQQQQ  QQ     AQEQQQQQ
    90   90 L H  E     -O   33   0E  22  483   26   NQQQQQQQQQ     Q  QQ      Q        QHQ Q       QQQQQ  QQ     GQQQQQQQ
    91   91 L H        +     0   0    0  421   89   NYYHYY YD         S.      H         VG D       ....N  HY     GCS HHGY
    92   92 L Y  S    S+     0   0  104  454   88    YDNNN  Y         YY      D         YS Y       YYYYY  HN     YYY DNYN
    93   93 L G  S    S-     0   0   34  422   71    SNSSN  T         TD      N         GS S       DDQDN  SS     SSG NSSS
    94   94 L T  S    S-     0   0  104  446   88    YSNAS  T         TT      S         TY Y       TYSNF  AN      NT SYYD
    95   95 L P  S    S+     0   0    7  443   51    PPPPP  P          L      P         PP P       LLLVS  PP      PP PPPP
    96   96 L P  S    S-     0   0   55  421   75    P PP              P      P         P          PPPPF   P      PP PP P
    97   97 L L        -     0   0   21  160   88    T ..              L      T         T          RWYI.   .      .T T. .
    98   98 L T        -     0   0   40  288   41    V ..              T      V         V          TTTTT   .      .V V. .
    99   99 L F  B     -S   89   0E  18  290   29    L ..              F      L         I          FFFFF   .      .L L. .
   100  100 L G        -     0   0    3  294   39    H ..              G      Q         Q          GGGGG   .      .Q Q. .
   101  101 L G        -     0   0   52  307   63    T ..              G      A         S          QQQQG   .      .G A. .
   102  102 L G        -     0   0   11  306   43    Q ..              G      R         M          GGGGG   .      .S R. .
   103  103 L T  E     - R   0  86E   0  366   18    T TT              T      T         T          TTTTT   .      T  TT T
   104  104 L K  E     -nR  10  85E  98  363   58    K VV              K      Q         K          KKKRK   T      V  QV V
   105  105 L L  E     -nR  11  84E   4  343   37      LL              V                           LVLVV   V      I   L L
   106  106 L E  E     -n   12   0E 108  326   51      HH              D                           EEQED   Q      Q   H H
   107  107 L I  E      n   13   0E 113  301   50      TT              I                           IIINN   M      V   T T
   108  108 L K              0   0  145  268   18      RR              K                           KK KK              R R
   109      ! !              0   0    0   0     0  
   110    1 H E              0   0  194  408   30             EQEEE     E  QQ  EE  EEEE   E EEEEE        Q  EEEEE        
   111    2 H V        +     0   0   19  465   12             VVVVV V   V  VVV VV  VEVE   V VVVVVV      VV  VVEEE        
   112    3 H K  E     -A  134   0A 111  467   31             QQQKK Q   Q  QKQ QQ  QQQQ   Q QKKKKQ      QQ  QQQQQ        
   113    4 H L  E     -A  133   0A   3  489    1             LLLLL L   L  LLL LLLLLLLL   L LLLLLL      LL  LLLLL        
   114    5 H Q  E     -A  132   0A  83  493   70             VVVEE V   V  QLV VVVVVVVV   V LVEEEV      VV  VVVVV        
   115    6 H E  E     +A  131   0A   5  498   21             EDEEE E   E  EEE EEEEEEEE   E EEEEEE      EQ  EEEEE        
   116    7 H S  E     +A  130   0A  69  501   13             SSSSS S   S  SSS SSSSSSSS   S SSSSSS      SS  SSSSS        
   117    8 H G        +     0   0   36  505    4             GGGGG G   GGGGGG GGGGGGGG   G GGGGGG      GG  GGGGG        
   118    9 H G        +     0   0   29  672   48             GGGGG GG  GGGGGG GGGGGGGG   G GGGGGGG     GG  GGGGG        
   119   10 H D        -     0   0   96  677   40             GGGGG GG  GGGGGT GGGGGGGG   G GGGGGGG     GG  GGGGG        
   120   11 H L  E     +e  224   0B  79  675   16             LLLLL LL  VLVLVL LLLLLLLL   L LLLLLLL     LV  LLLLL        
   121   12 H V  E     -e  225   0B  16  677   33             VVVVV QV  VVVVVV VVVVVVVV   V VVVVVQV     VV  VVVVV        
   122   13 H Q    >   -     0   0  114  679   51             QEQQQ QQ  QQQQQQ QQPQQQQQ   Q QQQQQQQ     KQ  QQQQQ        
   123   14 H P  T 3  S+     0   0   66  678    9             PPPPP PP  PPPPPP PPPPPPPP   P PPPPPPP     PP  PPPPP        
   124   15 H G  T 3  S+     0   0   58  682   32             GGGGG GG  GGGKGG GGGGGGGG   G GGGGGGG     GG  GGGGG        
   125   16 H G    <   -     0   0   25  684   63             GGGGG GG  RRRGRG GGGGGGGG   G GGGGGGG     GR  GGGGG        
   126   17 H S        +     0   0   78  683   31             SSSSS SS  SSSSSS SSSSSSSS   S SSSSSSS     SS  SSSSS        
   127   18 H L  E     - B   0 192A  25  685   25             LLLMM LL  LLLMLL LLLLLLLL   L LLMMMLL     VL  LLLLL        
   128   19 H K  E     - B   0 191A  93  683   56             RRRKK RR  RRRKRR RRRRRRRR   R RRKKKRR     RR  RMRRR        
   129   20 H L  E     - B   0 190A   0  688   14             LLLLL LL  LLLLLL LLLLLLLL   L LLLLLLL     LL  LLLLL        
   130   21 H S  E     -AB 116 189A  28  688   37             SSSSS SS  SSSSSS SSSSSSSS   S SSSSSSS     SS  SSSSS        
   131   22 H b  E     -AB 115 188A   0  688    0             CCCCC CC  CCCCCC CCCCCCCC   C CCCCCCC     CC  CCCCC        
   132   23 H A  E     -AB 114 187A  52  688   66             ASAVV EA  AAAAEA AAAAAAAA   A AAVVVKA     AA  AAAAA        
   133   24 H A  E     +A  113   0A   8  688   49             TAAAA AT  AAAAAA AAAAAAAA   T ATAAAGT     AA  AAAAA        
   134   25 H S  E     +A  112   0A  58  688   12             SSSSS TS  SSSSSS SSSSSTSS   S SSSSSSS     SS  SSSSS        
   135   26 H G  S    S+     0   0   56  688    4             GGGGG GG  RGGGGG GGGGGGGG   G GGGGGGG     GG  GGGGG        
   136   27 H F  S    S-     0   0   33  686   34             FFFFF FF  FFFFFF FFFFFFFF   F FFFFFFF     FF  FFFFF        
   137   28 H T    >   -     0   0   93  687   50             TTTTT TT  TTTNTT TTTTTTTT   T TTTTTDT     TS  TTTTS        
   138   29 H F  G >  S+     0   0    2  688   41             FFFFF FF  FFFFSL FFFFFFFF   F FFFFFFF     FF  FFFFF        
   139   30 H S  G 3  S+     0   0   57  688   55             SSSSS ST  SDSNRS SSSSSSSS   S SSSSSST     TG  GSSSR        
   140   31 H S  G <  S+     0   0   71  688   60             NAYNN SD  NDHIDR SSSSSSSS   N TANNNSD     NN  SSSSS        
   141   32 H Y  S <  S-     0   0   44  688   41             YNYYY FY  YYYNYY YYYYYYYY   Y YFYYYFY     AF  YYYYY        
   142   33 H T        -     0   0   30  688   91             WDNWW AY  GAAAGD YNYEWWDW   W VYWWWRY     WG  THWWP        
   143   34 H M  E     -FG 207 160C   0  672   46             MMMMM MM  MMMMMM MMMMMMMM   M MMMMMLM     MM  MMMMM        
   144   35 H S  E     -FG 206 159C   0  685   73             FNNNN FS  HHHNNN HHSNDHNH   Y SENNNGS     NH  HNHHN        
   145   36 H W  E     +FG 205 158C   0  688    0             WWWWW WW  WWWWWW WWWWWWWW   W WWWWWWW     WW  WWWWW        
   146   37 H V  E     -FG 204 156C   0  688   19             VVVVV VV  VVVVVV VVVVVVVV   F VVVVVVV     VV  VVVLV        
   147   38 H R  E     -FG 203 155C  10  688   17             RRRRR RR  RRRRRR RRRRRCRR   R RRRRRRR     RR  RRRRR        
   148   39 H Q  E     -FG 202 154C   9  688    3             QQQQQ QQ  QQQQQQ QQQQQQQQ   Q QQQQQQQ     QQ  QQQQQ        
   149   40 H T    >   -     0   0    9  688   68             AAVSS AP  AAAAAA AAAAAAAA   A APSSSAP     AA  AAAAA        
   150   41 H P  T 3  S+     0   0   80  687   10             PPTPP PP  PPPPPP PPPPPPPP   P PPPPPPP     PP  PPPPP        
   151   42 H E  T 3  S-     0   0  151  688   26             GGGEE GG  GGGGGG GEGGGGGG   G GGEEEEG     GG  GGGGG        
   152   43 H K    <   +     0   0  121  688   32             KKKKK KK  KKKRKK KKKKKKKK   K KKKKKKK     KK  KKKKK        
   153   44 H R        -     0   0  113  687   43             GGGGG GA  GGGGGG GGGGGGGG   G GRGGGGA     GG  GGGGG        
   154   45 H L  E     -G  148   0C   9  688   14             LLLLL LL  LLLLLL LLLLLLLL   L LLLLLLF     LL  LLLLL        
   155   46 H E  E     -G  147   0C  44  687    5             EEEEE EE  EEEEEE EEEEEEEE   E ZEEEEEE     EE  EEEEE        
   156   47 H W  E     +G  146   0C  15  687   11             WWWWW YW  WWWWWW WWWWWWWW   W WWWWWPW     WW  WWWWW        
   157   48 H V  E     -     0   0C   0  687   28             VLVVV VL  VVVIVI VVVVLVVV   V VIVVVVL     VV  IVVVV        
   158   49 H A  E     -G  145   0C   0  688   38             SSSAA AG  ASAAES AASACSSS   S GAAAAAG     GA  SAASA        
   159   50 H S  E     -GH 144 168C   0  688   94             SFAEE EF  AGVRVY yLVYRLLL   S AAEEEIF     RT  RIYLL        
   160   51 H I  E     -GH 143 167C   4  675   18             IIIII II  IIIIII iIIIMIII   I ISIIIII     II  IIIII        
   161   52 H N    >   -     0   0   47  682   84             SGGRR TR  SSARLG SSSSNSSS   S ZRRRRSR     KS  SWSSS        
   162   53 H N  T 3  S+     0   0   65  684   88             GGTLL DN  NWSSSG SGGSPSPS   G GNLLLLN     TH  SNGSS        
   163   54 H G  T 3  S-     0   0   65  686   68             SSAKK GK  DNDYDS DGDDDDSD   S LKKKKDK     KD  SDGDG        
   164   55 H G  S <  S+     0   0   30  687   43             SGGSS GA  GSGSGG GSSGGGGG   S SASSSGA     SG  GGSGR        
   165   56 H G  S    S+     0   0   74  688   63             SSDhh Gn  SGNnSN rTRsSsGs   S VnhnhSn     dS  GSTsd        
   166   57 H R        +     0   0  163  505   86             ST.ae St  NSNeSV y.YyTySy   N Staaa.t     tQ  TQ.yn        
   167   58 H T  E     -H  160   0C  62  677   52             TIQTT TT  KIDTKI I.TITITI   T ZTTTTTT     AK  IK.IT        
   168   59 H Y  E     +H  159   0C  53  686   85             YYYHH YE  FGYYYS NYNSHYYY   Y SEHHHYE     DY  SYYYY        
   169   60 H Y        -     0   0   44  688    9             YYYYY YY  YYYYYY YYYYYYYY   Y YYYYYYY     YH  YYYYY        
   170   61 H P    >>  -     0   0   20  688   65             PAAAA AS  AAIVAS AAAAAAAA   P ASAAAAS     AT  AAAAA        
   171   62 H D  T 34 S+     0   0  148  688   64             DDDEE DA  DDDDDD ADAANADA   D BAEEEDA     AD  EDDAT        
   172   63 H T  T 34 S+     0   0   90  688   57             SSSSS AS  SSSSSS SSSSSSSS   S SSSSSAS     PS  SSSSS        
   173   64 H V  T X> S+     0   0    1  688   42             VVVVV VV  VVLVVV VVVVVVVV   V VVVVVVV     VV  VVVVV        
   174   65 H K  B 3< S+c  177   0A 142  687   31             KKKKK QK  KKKKKK KKKKKKKK   K KKKKKKK     KK  KKKKK        
   175   66 H G  T 34 S+     0   0   74  687   36             GGGGG GG  GGGDGG GGGGGGGG   G GGGGGGG     GG  GGGGG        
   176   67 H R  T <4 S+     0   0   36  688   17             RRRRR RR  RRRRRR RRRRRRRR   R RRRRRRR     RR  RRRRH        
   177   68 H F  E  <  -cD 174 192A   2  688   60             FFFFF FF  FFFFFF FFFFFFFF   F FFFFFFF     FF  FFFFF        
   178   69 H T  E     - D   0 191A  79  688   38             TTTTT TT  TTTTTT TTTTTTTT   T TFTTTTT     TT  TTTTT        
   179   70 H I  E     + D   0 190A   5  688   20             IIIII II  IIIIII IIIIIIII   I IVIIIII     II  IIIII        
   180   71 H S  E     - D   0 189A  51  684   41             SSSSS SS  FSSSSS SSSSSSSS   S SSSSSSS     SS  SSSSS        
   181   72 H R  E     - D   0 188A  30  687   60             RRRRR RR  RRRRRK RRRRRRRR   R RRRRRRR     RR  RRRRR        
   182   73 H D  E > > - D   0 187A  60  686    7             DNNDD DD  DDDDDD DEDDDDDD   D DDDDDDD     DD  DDDDD        
   183   74 H N  G > 5S+     0   0   48  688   57             NBDDD NN  NNNDNN NNNNNNNN   N DTDDDNN     DN  NNNNN        
   184   75 H A  G 3 5S+     0   0   99  688   45             ASSSS GS  SASSSA AATAAAAA   A SSSSSGS     SS  TAAAA        
   185   76 H K  G < 5S-     0   0  111  688   51             KKKKK QQ  KKNQMR KKKKKKKK   K KQKKKQQ     KK  KKKKK        
   186   77 H N  T < 5 +     0   0   62  688   46             NNNSS SS  NNNSNN NNNNNNNN   N NSSSSSS     NN  NNNNN        
   187   78 H T  E   < -BD 132 182A  16  688   69             TSTSS TI  MSTMTS TSTTMTMT   T TISSSTI     TT  TTMTS        
   188   79 H L  E     -BD 131 181A   0  687   56             LLLVV VL  MLLLLL LLLLLLVL   L .LVVVLL     LL  LLLLL        
   189   80 H Y  E     -BD 130 180A  41  687   46             YYYYY YY  DYYYYY YYYYYYYY   Y .YYYYYY     YY  SHDYY        
   190   81 H L  E     -BD 129 179A   0  687    7             LLLLL LL  LLLLLL LLLLLLLL   L .LLLLLL     LL  LLLLL        
   191   82 H Q  E     -BD 128 178A  76  687   41             QQNQQ QQ  QQQQQQ QQQQQQQQ   Q .QQQRQQ     QQ  QQEQQ        
   192   83 H M  E     +BD 127 177A   0  688   11             MMMMM MM  MMLMMM MMMMMMMM   M MMMMMMM     MM  MMMMM        
   193   84 H S        +     0   0   42  688   54             NSNNN NN  NNSNNN SSNSNSSS   N NNNNNDN     NN  SNSNG        
   194   85 H S  S    S-     0   0   68  687   24             SSSNI ST  SSSNSS SSSSSSSS   S SANNNST     SS  SSSSS        
   195   86 H L        -     0   0    3  686   18             PLLLL LL  LLLLLL LLLLLLLL   L LLLLLLL     LL  LLLLL        
   196   87 H K    >   -     0   0  102  686   68             RRRRR KR  RRRKRR RRRRRRRK   R RRRRRKR     KR  RRRKR        
   197   88 H S  G >  S+     0   0   70  686   60             AAAAA AA  AAITAA AAAAAAAA   A AAAAPAA     TA  AATAS        
   198   89 H E  G 3  S+     0   0  126  687   22             EEEEE EE  EEEEEE EEEDEEEE   E EEEEEEE     EE  EQQED        
   199   90 H D  G <   +     0   0    2  687    3             DDDDD DD  DDDDDD DDDDEDDD   D DDDDDDD     DD  DDDDD        
   200   91 H T    <   +     0   0   32  688   28             TTTTT TS  TTTTTT TTTTTTTT   T TTTTTPS     TT  SSTTT        
   201   92 H A  E    S- I   0 223C   8  686    5             AAAGG GA  AAAAAA AAAAAAAA   A AAGGGAA     AA  AAAAA        
   202   93 H M  E     -FI 148 222C  58  687   48             VVVII TT  VLVITV VVVVMVVL   V VIIIITT     VV  VMVVL        
   203   94 H Y  E     -FI 147 221C   0  688    1             YYYYY YY  YYYYYY YYYYYYYY   Y YYYYYYY     YY  YHYYY        
   204   95 H Y  E     -F  146   0C   7  688    4             YYYYY YY  YYYYFF YFYYYYYY   Y YYYYYYY     FF  YYYFY        
   205   96 H b  E     -F  145   0C   0  688    1             CCCCC CC  CCCCCC CCCCCCCC   C CCCCCCC     CC  CCCCC        
   206   97 H V  E     -FJ 144 217C   0  688   23             AAATT AA  AAAVAA AAAAAAAA   A AATTTVA     AA  AAAAA        
   207   98 H R  E     -FJ 143 216C  21  687   40             rRrTT kr  kkrRkr rrrrrRrr   r krTTTrr     tk  rrrrr        
   208   99 H H  E     + J   0 214C   6  583   92             r.w.. ga  vlt.ey rii.rDgq   g sy...na     rw  rrlgt        
   209  100 H E  E  >  + J   0 213C  63  625   78             G.L.. GP  GLHGLG GSP.GTSP   S AY...DP     ER  GDGKQ        
   210  101 H Y  T >4 S-     0   0   80  658   93             RGYGG WY  TWTLYD SRM.RQQP   Q YGGGGIY     ER  IKWDQ        
   211  102 H Y  T 34 S-     0   0  140  672   23             FWYFF cY  YFFWyf FFY.NVYC   F YyFFFWY     Yy  YFFMV        
   212  103 H Y  T 34 S+     0   0   39  265   92             ..Y.. g.  .G..hv .L.t....   . .y...A.     Ga  .....        
   213  104 H A  E <<  -J  209   0C   0  403   87             K.Y.. C.  .E..GR .T.S.Q..   . .W...F.     HY  ....Q        
   214  105 H M  E     +J  208   0C   0  497   62             ALG.. IF  FL.FML .ALK.L.H   . FF...IC     FG  ....L        
   215  106 H D  E     +     0   0C  19  615   50             FLSAA DD  DLDADD .DRG.E.R   . BDAAAVD     DD  HHP.E        
   216  107 H Y  E     -J  207   0C  99  624   65             SNVYY AY  YNIYVS .PTLLV.C   . YVYYYAY     YY  CTI.V        
   217  108 H W  E     -J  206   0C  23  675    2             WWWWW WW  WWWWWW .RWWWWPW   . WWWWWWW     WW  WWWWW        
   218  109 H G        -     0   0    0  664   17             SGGGG GG  GGGGGG LGSGTAEN   . GGGGGGG     GG  LTFAA        
   219  110 H Q        -     0   0   91  659   46             SQQQQ RQ  QQQQQQ LREPPGED   . ZAQQQRQ     QR  LKPAG        
   220  111 H G        -     0   0   16  650   16             GGGGG GG  GGGGGG GVGSDSgK   . GGGGGGG     GG  SGLmS        
   221  112 H T  E     -I  203   0C  21  594   27             GTTTT TT  TTTTTT STT.S.aT   S TTTTTTT     IT  G..t.        
   222  113 H T  E     -I  202   0C  72  593   76             ALLLL ST  LLMTTL ML .A.LF   L LTLLLST     LL  F.HL.        
   223  114 H V  E     -I  201   0C   0  596   20             QV VV VL  VVVVVV LL .LCLT   V VVVVVVL     VV  I.VLC        
   224  115 H T  E     -e  120   0B  36  593   20             PT TT TT  TTTTTT SL .TVLT   N TTPTTTT     TT  T.TTV        
   225  116 H V  E     +e  121   0B   6  572    6             VV VV VV  VVVVVV  A . VAL   L VVVVVVV     VV  L.V V        
   226  117 H S        -     0   0   36  566   11             AS    SS  SSSSSS  E . SET   S SS SSSS     SS  T.S S        
   227  118 H S  S    S+     0   0   84  551   22             PS    SS  SSSSSS  D G SDS     SS AASS     SS   .  S        
   228  119 H A  S    S+     0   0   70  123   53                        GG     M T SMA                      .  S        
   229  120 H W        -     0   0  123   73   63                        SS     W W  W                       .           
   230  121 H R        +     0   0  207   60   75                        RR                                  R           
   231  122 H H              0   0  156   54   67                        SS                                              
   232  123 H P              0   0  155   35   53                        AA                                              
## ALIGNMENTS  351 -  420
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....6....:....7....:....8....:....9....:....0....:....1....:....2
     1    1 L D              0   0  183  420   16  DDD        DDD  DDDDD DD D      DDDDD D D        D DDDE E D    DED E D
     2    2 L I        -     0   0   32  462   11  III        III VIIIII II I      IIIII III        I IIII I I    III I I
     3    3 L E        -     0   0  117  463   68  QQQ        QQQ EQQQQK VQ Q      VQQQQ QQQ        T QKQQ V Q    QQQ V Q
     4    4 L L  E     -K   25   0D  10  474    7  MMM        MMM LMMMMM LM M      MMVLM MMM        M MMMM L M    MMM M M
     5    5 L T  E     -K   24   0D  64  475    8  TTT        TTT TTTTTT TT T      TTTTT TTT        T TTTT T T    TTT T T
     6    6 L Q  E     -K   23   0D  13  475    0  QQQ        QQQ QQQQQQ QQ Q      QQQQQ QQQ        Q ZQQQ Q Q    QQQ Q Q
     7    7 L T  E    S+K   22   0D  64  475   34  SSS        SSS TSSSSS SS T      TTSSS SST        S SSSS S S    TSS S S
     8    8 L P        -     0   0   46  480    9  PPP        PPP PPPPPP PP T      PPPPP QPP        P PPPP P S    TPP P P
     9    9 L V  S    S+     0   0   96  484   67  SSS        SSS ASSSSS AS S      SSSTS SSP        S SSAS G S    SSS A D
    10   10 L S  E     -n  104   0E  60  485   43  SSS        SSS STSSSS IS S      SSSSS SSS        Y SSSS T S    SLS T I
    11   11 L L  E     -n  105   0E  58  489   21  VLL        VLV VLLLLM MLLL      VLLLL LLL        L LMLL L L    LLL L L
    12   12 L S  E     +n  106   0E  60  490   42  SSS        SSS ESSSSY SSAS      SSSSS SSS        S SYSS S S    SSP S S
    13   13 L A  E     -n  107   0E   0  490   58  AAA        AAA AAAVAA AAAA      AAAAA AAA        K AAAA L A    AAA L A
    14   14 L S    >   -     0   0   47  491   29  SSS        SSS ASSSSS SSSS      ASSSS SSS        S SSSS S S    SSS S S
    15   15 L V  T 3  S+     0   0   76  491   66  VVV        VVV VVVVVL PVPL      VVVVV LVL        P VLLP P L    LPL P L
    16   16 L G  T 3  S+     0   0   42  491    4  GGG        GGG GGGGGG GGGG      GGGGG GGG        G GGEG G G    GGG G G
    17   17 L E    <   -     0   0   71  491   35  DDD        DDD GDDDDE EDED      GDDDG DDD        E BEED E D    DDD E E
    18   18 L T        -     0   0   69  491   62  RRK        RRR TRRRRR KRTR      TRRRR RTT        R RRIR R R    RRR T S
    19   19 L V  E     - L   0  75D  11  491   37  VVV        VVV VVVVVV VVIV      VVVVV VVV        V VVVV A V    VVV A V
    20   20 L T  E     - L   0  74D  67  490   30  TTT        TTT TTTTTT TTTT      TSTTT ATT        T TTTT T T    TTT T T
    21   21 L I  E     - L   0  73D   1  489   17  III        III IIIIII MIII      IIIII III        I IIII L I    III I I
    22   22 L T  E     -KL   7  72D  29  489   58  TTT        TTT KTITTS TTNS      KTTTT TTT        T TTTT S S    STT S T
    23   23 L a  E     -KL   6  71D   0  490    1  CCC        CCC CCCCCC CCCC      CCCCC CCC        C CCCC C C    CCC C C
    24   24 L R  E     -KL   5  70D 110  490   45  RRR        RRR QRRQQK RRRR      QKRQR KQR        R RKQR R R    RRR R Q
    25   25 L A  E     -K    4   0D  10  490   29  AAA        AAA AAAAAA AAAA      AAAAA AAA        A AAAA A A    AAA T S
    26   26 L S  S    S+     0   0   66  490    4  SSS        SSS SSSSSS SSSS      SSSSS SSS        S SSSS S S    SSS S S
    27   27 L E  S    S-     0   0  101  490   38  QQQ        QQQ QQQQQQ SQKQ      EEQQQ HQQ        Q ZQQQ Q Q    QQQ Q Q
    28   28 L N        +     0   0   83  490   45  GGG        SSS BSGNDD SGRD      NDGGG NGG        G TDDN S D    DND S S
    29   29 L I    >   -     0   0    5  491   32  III        III IIIVII VIII      IIIII III        I IIIV V I    IAI V I
    30   30 L Y  T 3   -     0   0  155  491   81  SSS        SSS YNRNSN sSSS      YFSSS NSS        S SNGN s S    SNG S Y
    31   31 L S  T 3  S+     0   0   53  467   65  SNS        SNS STNAIS sNKN      SDNNN SNN        S SSNT s N    NKN S S
    32   32 L Y    <   +     0   0   63  490   52  YYW        WYW YWDYFY YNYY      LAENN YEN        Y YYWW Y Y    YWY Y N
    33   33 L L  E     -O   90   0E   0  490    7  LLL        LLL LLLLLL LLLL      LLLLL LLL        L LLLL L L    LLL L L
    34   34 L A  E     -O   89   0E   0  490   71  ANA        AAA SATNNT HNAN      ASSAN ANH        N BSSA A N    NTR A A
    35   35 L W  E     -OP  88  48E   1  491    0  WWW        WWW WWWWWW WWWW      WWWWW WWW        W WWWW W W    WWW W W
    36   36 L Y  E     -OP  87  46E   0  491    9  YYY        YYY YYYYYF YYYY      YYYYY YYY        Y YFYY Y Y    YYF Y Y
    37   37 L Q  E     -OP  86  45E   7  491   28  QQQ        QQQ QQQQQQ QQQQ      QQQQQ QQQ        Q ZQQQ Q Q    QQQ Q Q
    38   38 L Q  E     -O   85   0E  21  491    4  QQQ        QQQ QQQQQQ QQEQ      QQQQQ QQQ        Q ZQQQ Q Q    QQQ Q Q
    39   39 L K    >   -     0   0   51  490    9  KKK        KKK KKKKKK KKRK      KKKKK KKK        K KKKK K K    KKK K K
    40   40 L Q  T 3  S+     0   0  190  491   19  PPP        PPP PPPPPP SPPP      PPPPP QPP        P PPPP P P    PPP P P
    41   41 L G  T 3  S+     0   0   86  491   10  GGG        GGG GGGGGG GGGD      GGGGG GGG        G GGGG G D    DGG G G
    42   42 L K  S <  S-     0   0  126  490   54  KKK        KKK QKKLKK AKKG      QKQKK KKS        Q KKKK Q G    GKK Q E
    43   43 L S        -     0   0   21  490   55  AAA        AVA PAAAAS STTT      PAAVT ASS        S ASSV A T    TPS A H
    44   44 L P        -     0   0    4  490   11  PPP        PPP PPPPPP PPNV      PPPPP PPP        P PPPP P V    VPP P P
    45   45 L Q  E     -P   37   0E  74  490   32  KKK        KKK KKKKKK KKKK      KKTKK KKK        K BKQK R K    KKR R K
    46   46 L F  E     +P   36   0E  25  490   42  LLP        LLL LLELLT LLLL      LLLLL LPL        R LTLL L L    LPL L L
    47   47 L L  E     +     0   0E   4  490    9  LLL        LLL LLLLLL WLFV      LLLLL LLL        L LLLL L L    LRM L L
    48   48 L V  E     -PQ  35  54E   0  491    5  III        III IMIIIL IIII      IIIII III        I IIII I I    III I I
    49   49 L Y  E >> S+ Q   0  53E  39  491   17  YYY        YYY YYYYYY YYYY      YYYYY YYY        Y YYYY Y Y    YYY Y Y
    50   50 L N  T 34 S-     0   0   52  491   91  ARK        KAK KKAGDR SASY      DYASA AYY        G ARGR G Y    YEG G A
    51   51 L A  T 34 S+     0   0    3  491   45  AAA        AAA AAAAAA TAGT      AAAAA AAA        A AAAA A T    TAA A A
    52   52 L K  T <4 S+     0   0  148  491   25  SSS        SSS SSSSSN SSSS      SNSSS SSS        S SNTS S S    SST S S
    53   53 L T  E  <  -Q   49   0E  47  491   67  SNS        NTN TSNTKR NSTR      DSSSS NRS        N BRST S R    RKN S N
    54   54 L L  E     -Q   48   0E  60  491   60  LLL        LLL LLLRLL LLLL      LLLLL LLL        L LLLL R L    LLL R L
    55   55 L G    >   -     0   0    9  490   71  QQQ        QQQ AEQEEV AQQH      AEQQQ AEH        Q HVAQ A H    HQA A A
    56   56 L E  T 3  S+     0   0  192  490   35  STS        SSS SSSAAD SSSS      SDSSS STS        S SDDT T S    STN T D
    57   57 L G  T 3  S+     0   0   70  491    5  GGG        GGG GGGGGG GGGG      GGGGG GGG        G GGGG G G    GGG G G
    58   58 L V    <   -     0   0   25  489   11  VVV        VVV VVVVVV VIIV      VVVVI VVV        V VVVV I V    VVV I I
    59   59 L P    >   -     0   0   47  490    7  PPP        PPP SPPPPP PPPP      PPPPP PPP        P PPPP P P    PPP P P
    60   60 L S  T 3  S+     0   0  115  491   57  SPS        SSS SSSSSS ASSS      SSSSS SSS        S SSSS D S    SSS D S
    61   61 L R  T 3  S+     0   0   44  491    4  RRR        RRR RRRRRR RRRR      RRRRR RRR        R RRRR R R    RRR R R
    62   62 L F  E <   +M   75   0D   5  491    1  FFF        FFF FFFFFF FFFF      FFFFF FFF        F FFFF F F    FFF F F
    63   63 L S  E     -M   74   0D  55  490   22  SSS        SSS KISSSS SSSS      SSSSS SRR        S SSSS S S    SSS S S
    64   64 L G  E     +M   73   0D  13  491    2  GGG        GGG GGGGGG GDGG      GGGGD GGG        G GGGG G G    GGG G G
    65   65 L S  E     +M   72   0D  63  491    5  SSS        SSS SSSSTS SSSS      SSSSS SSS        S SSSS S S    SSS S S
    66   66 L G  E     -M   71   0D  36  491   14  GRG        GGG GGGGGG GGGG      GGGGG GGR        V GGRG G G    GGR G G
    67   67 L S  E >   +M   70   0D  79  491    9  SSS        SSS SSASSS SSSS      YSSSS SSS        S SSSS S S    SSS S S
    68   68 L G  T 3  S-     0   0   16  491   13  GGG        GGG GGGGGG GGGG      GGGGG GGG        G GGGG G G    GGG G G
    69   69 L T  T 3  S+     0   0   67  488   13  TTT        TTT TTTTTQ TATT      TTTTT TTT        T TQTT T T    TTS T T
    70   70 L Q  E <   +LM  24  67D 110  489   27  EDD        DDD EEEDDD SDDD      EQDDD DDD        D BDQD D D    DDD D Q
    71   71 L F  E     -LM  23  66D   2  491    6  FFF        FFF FFFFFF YYFY      FFFFY YFF        F FYYF F Y    YFY F Y
    72   72 L S  E     -LM  22  65D  26  491   30  TTT        TTT TTTTTS STTS      TSTTT STT        T TSST T S    STS T S
    73   73 L L  E     -LM  21  64D   0  491    2  LLL        LLL LLLFFL LLLL      LLLRL LLL        L FLLL L L    LLL L L
    74   74 L K  E     -LM  20  63D  97  491   39  TTT        TTT TTTTTT TTTT      TKTTT TTT        T TTKT T T    TTT T K
    75   75 L I  E     -LM  19  62D   0  491    1  III        III IIIIII IIII      IIIII III        I IIII I I    III I I
    76   76 L N  S    S-     0   0   86  491   30  SSS        SSS SSSSSS SRSS      SSSSS SSN        S SSSS S S    SSN S S
    77   77 L S  S    S-     0   0   58  491   62  SSS        SSS DSSSSS SSSN      GSSSS SGG        S SSRS R N    NSS S S
    78   78 L L        -     0   0    0  491   27  LLL        LLL LLLLLL MLLL      VLLLL VLL        L LLLL L L    LLL L L
    79   79 L L    >   -     0   0   67  491   31  QQQ        QQQ ZQQQQE EQEG      QEQQQ EEQ        E ZEQE E E    EEE E Q
    80   80 L P  G >  S+     0   0   92  491   58  PPP        PPP CPPPPY APPP      CAPPP ATA        P PYVP P P    QPS P P
    81   81 L E  G 3  S+     0   0  102  491   13  EKE        EEE ADEEEE EEEE      EEEEE EDE        E ZEEE E E    EEE E E
    82   82 L D  G <  S+     0   0    1  491    5  DDD        DDD DDDDDD DDDD      DDDDD DDD        D BDDD D D    DDD D D
    83   83 L F    <   +     0   0   29  490   72  FIF        FVF AFFIIM AFFI      AAIVF IVV        F FMIA C I    IAM F V
    84   84 L G  E    S- R   0 105E  17  491   23  AAA        AAA AAAAAG AAAA      AGAAA AGG        A AGGA A A    AGA A A
    85   85 L S  E     -OR  38 104E  24  491   63  TTT        TTT TTTTTI TTMT      TITTA TNI        T TIIT V T    TTI V N
    86   86 L Y  E     -OR  37 103E   0  491    0  YYY        YYY YYYYYY YYYY      YYYYY YYY        Y YYYY Y Y    YYY Y Y
    87   87 L Y  E     -O   36   0E   5  490    4  YYY        YYY YYYYYY YYYY      YFYYY YYY        Y YYYY Y Y    FYY Y Y
    88   88 L a  E     -O   35   0E   0  491    0  CCC        CCC CCCCCC CCCC      CCCCC CCC        C CCCC C C    CCC C C
    89   89 L Q  E     -OS  34  99E   0  489   48  MQQ        IQQ QQLQQL QQQQ      QHLQQ QQQ        L ZLLQ Q Q    QHL Q Q
    90   90 L H  E     -O   33   0E  22  483   26  QQQ        QKQ  QQQQQ QQQQ      GQQRQ QQQ        Q ZQQQ Q Q    QQQ E Q
    91   91 L H        +     0   0    0  421   89  HYY        HHY  .Q..Y .S..      GGDTS LDS        Y SYAS . .    GYH   G
    92   92 L Y  S    S+     0   0  104  454   88  NDS        SNS  YNYFD YDHY      YYYYD SYS        D YDYS Y Y    NNN   Y
    93   93 L G  S    S-     0   0   34  422   71  SNS        SSS  N.NDE HSNS      YNTNS DSS        K .ESN G S    .SE   S
    94   94 L T  S    S-     0   0  104  446   88  YLY        TAT  SSNNF STEK      SPTAT FYL        L SFAL S N    TNY   Y
    95   95 L P  S    S+     0   0    7  443   51  PPP        PPP  DYWLP YPFL      SPPPP PPP        P SPPP S L    LPP   P
    96   96 L P  S    S-     0   0   55  421   75  PPN        PPP  SPPPL PPPP      SPFPP PPF        P P PP P P    PPP   P
    97   97 L L        -     0   0   21  160   88  . .        ...  KRPL. R LP      A.T.. TT.        T T .. L L    Y .   .
    98   98 L T        -     0   0   40  288   41  . .        ...  MSTTT T TT      T.V.T VVT        V T .. T T    T T   .
    99   99 L F  B     -S   89   0E  18  290   29  . .        ...  FFFFF F FF      Y.L.V ILV        T F .. F F    F     .
   100  100 L G        -     0   0    3  294   39  . .        ...  GGGGG G GG       .Q.L QQS        Q G .. G G    G     .
   101  101 L G        -     0   0   52  307   63  . .        ...  QQQGA G AG       .A.Q AGG        A Z .. G A    G     .
   102  102 L G        -     0   0   11  306   43  . .        ...  GGGGG G GG       .I.W M K        M G .. G G    G     .
   103  103 L T  E     - R   0  86E   0  366   18  T T        TTT  TTTTT T TT       TTTN T Q        T T TT T T    T     T
   104  104 L K  E     -nR  10  85E  98  363   58  V V        VVV  KKKKK K KK       VKVK K K        K R    K K    K     V
   105  105 L L  E     -nR  11  84E   4  343   37  L L        LIL  VVVVL L LL       I LL   L          L    V L    L     I
   106  106 L E  E     -n   12   0E 108  326   51  Q H        HQH  EEEDE E EE       H QE   E          Z    E E    E     Q
   107  107 L I  E      n   13   0E 113  301   50  T          TAT  VIVFL I LI          S   M          I    I L    I     V
   108  108 L K              0   0  145  268   18  Q          RRR  KKKKK K K           K   K          K    K K    K      
   109      ! !              0   0    0   0     0  
   110    1 H E              0   0  194  408   30     EEEEEEEE                 QQE      E   EEQQEEEE           QQQ   E D 
   111    2 H V        +     0   0   19  465   12     VVVVVVVV          V      VVVM     V   VVVVVVVV V    V V  VVV   V V 
   112    3 H K  E     -A  134   0A 111  467   31     QKKKKKKK          Q      QQQQ     Q   QQQQQKKK Q    Q Q  QQQ   Q Q 
   113    4 H L  E     -A  133   0A   3  489    1     LLLLLLLL          L    L LLLL     L   LLLLLLVL L    L L MLLL   L L 
   114    5 H Q  E     -A  132   0A  83  493   70     VVVVVVVE          V    VLVVVV     V   VVVVVVVE V    V E LQQQ   V V 
   115    6 H E  E     +A  131   0A   5  498   21     EEEEEEEE          E    EEEQEE     E   EEQEEEEE E    E E EEEE   E E 
   116    7 H S  E     +A  130   0A  69  501   13     TSSSSSSS          S    SSSSSS     S   SSSSSSSS S    S S SSSS   S S 
   117    8 H G        +     0   0   36  505    4     GGGGGGGG          G    GGGGGG     G   GGGGGGGG G    G G GGGG   G G 
   118    9 H G        +     0   0   29  672   48     GGGGGGGG   G      G    GGGGGG     G   GGGGGGGG G    G G GGGG   G R 
   119   10 H D        -     0   0   96  677   40     GGGGGGGG   G      G    GGGGSG     G   GGGGDGGG G    G G GGGG   G D 
   120   11 H L  E     +e  224   0B  79  675   16     LLLLLLLL   L      V    LVLVLL     L   LLVVLLLL L    V L LLLL   L V 
   121   12 H V  E     -e  225   0B  16  677   33     IVVVVVVV   V      V    VVVVVV     V   VVVVVVVV Q    V V VVVV   V R 
   122   13 H Q    >   -     0   0  114  679   51     QQQQQQQQ   Q      Q    KQNQQP     Q   QQQQQQQQ Q    Q Q KQQQ   Q Q 
   123   14 H P  T 3  S+     0   0   66  678    9     PPPPPPPP   P      P    PPPPPP     P   PPPPPPPP P    P P PAAA   P P 
   124   15 H G  T 3  S+     0   0   58  682   32     GGGGGGGG   K      G    GGGGGG     G   GGGGGGGG G    G G GGGG   G G 
   125   16 H G    <   -     0   0   25  684   63     GGGGGGGM   G      R    GKGRGG     G   GGRRRGGG G    R G GGGG   G G 
   126   17 H S        +     0   0   78  683   31     SSSSSSSS   S      S    SSSSSS     A   CSSSSSSS S    S A SSSS   F S 
   127   18 H L  E     - B   0 192A  25  685   25     LLLLLLLV   L      L    LLRLLL     L   LLLLLLLM L    L M LLLL   L L 
   128   19 H K  E     - B   0 191A  93  683   56     RRRRRRRK   K      R    RRRRTR     R   KRRRRRRK R    R K RRRR   R H 
   129   20 H L  E     - B   0 190A   0  688   14     LLLLLLLL   L      L    LLLLLL     V   LLLLLLLL L    L L LLLL   L L 
   130   21 H S  E     -AB 116 189A  28  688   37     SSSSSSSS   S      S    SSSSAS     S   SSSSSSSS S    S S SSSS   S S 
   131   22 H b  E     -AB 115 188A   0  688    0     CCCCCCCC   C      C    CCCCCC     C   CCCCCCCC C    C C CCCC   C C 
   132   23 H A  E     -AB 114 187A  52  688   66     AAAAAAAA   A      A    AAVAAA     V   AAASAAAV K    A V AAAA   V K 
   133   24 H A  E     +A  113   0A   8  688   49     ATTTTTTT   A      A    AAAAAA     A   AAASATTA G    A A GAAA   V A 
   134   25 H S  E     +A  112   0A  58  688   12     SSSSSSSS   S      S    SSSSGS     S   SSSSSSSS T    S S SSSS   S S 
   135   26 H G  S    S+     0   0   56  688    4     GGGGGGGG   G      G    GGGGFG     G   GGGGGGGG G    G G GGgg   G G 
   136   27 H F  S    S-     0   0   33  686   34     FFFFFFFF   F      F    FFFF.F     F   FFFFFFFF F    F F FFss   F F 
   137   28 H T    >   -     0   0   93  687   50     TTTTTTTT   T      T    TTTTTT     T   TTTINTTT T    P T TTGG   T T 
   138   29 H F  G >  S+     0   0    2  688   41     VFFFFFLF   F      F    FFLFFF     F   FFFFFFFF F    F F FSHH   F F 
   139   30 H S  G 3  S+     0   0   57  688   55     SSSSSSSS   N      S    SRNSSS     S   SSSSHSSS S    N R SDGG   S S 
   140   31 H S  G <  S+     0   0   71  688   60     BDDDDDDD   F      R    NNDTDS     D   NDRSEDDN S    T N SDHG   D S 
   141   32 H Y  S <  S-     0   0   44  688   41     HFFFFFFY   Y      Y    AYYYYY     Y   YYYYYFFY F    Y Y YYYY   H Y 
   142   33 H T        -     0   0   30  688   91     SYYYYYYW   A      D    WGYGWW     G   LYTANYYW N    G W GAGG   Y S 
   143   34 H M  E     -FG 207 160C   0  672   46     MMMMMMMM   M      L    MMVMMM     M   MMIMMMMM M    M M FVMM   M M 
   144   35 H S  E     -FG 206 159C   0  685   73     SEEEEEEE   N      H    SHIHSS     A   SEHYHEEN F    H N SGGG   D H 
   145   36 H W  E     +FG 205 158C   0  688    0     WWWWWWWW   W      W    WWWWWW     W   WWWWWWWW W    W W WWWW   W W 
   146   37 H V  E     -FG 204 156C   0  688   19     VVVVVVVV   V      V    VVVVAV     V   VVVVLVVV I    V V VFFF   V V 
   147   38 H R  E     -FG 203 155C  10  688   17     RRRRRRRR   R      R    RRRRRR     R   RRRRRRRR R    R R RRRR   R R 
   148   39 H Q  E     -FG 202 154C   9  688    3     QQQQQQQQ   Q      Q    QQQQQQ     Q   QQQQQQQQ Q    Q Q QQQQ   Q Q 
   149   40 H T    >   -     0   0    9  688   68     APPPSPTA   A      P    AAAAAA     A   AAAAGPTS A    A S AAVV   A T 
   150   41 H P  T 3  S+     0   0   80  687   10     PPPPPPPP   P      P    PPPPPP     T   PPPPPPPP P    P P PPPP   P P 
   151   42 H E  T 3  S-     0   0  151  688   26     GGGGGGGG   G      G    GGGGGG     G   GGGGGGGE G    G E GGGG   G G 
   152   43 H K    <   +     0   0  121  688   32     KKKKKKKK   K      K    KKKKKK     K   KKKKKKKK K    K R KKKK   K K 
   153   44 H R        -     0   0  113  687   43     ARRRRRRG   G      G    GGGGGG     G   GGGGGRRG G    G G GEEE   G G 
   154   45 H L  E     -G  148   0C   9  688   14     LLLLLLLL   L      L    LLLLLL     L   LLLLPLLL L    L L LRRR   L L 
   155   46 H E  E     -G  147   0C  44  687    5     ZEEEEEEE   E      E    EEEEEE     E   EEEEEEEE E    E E EEEE   E E 
   156   47 H W  E     +G  146   0C  15  687   11     WWWWWWWW   W      W    WWWWWW     W   WWWWWWWW H    W W WGFF   W W 
   157   48 H V  E     -     0   0C   0  687   28     VIIIIIIV   V      V    VVVVVL     V   VVVVVIII V    V V VVVV   V V 
   158   49 H A  E     -G  145   0C   0  688   38     SAAAAAAA   A      A    GAAASG     S   SGAASAAA A    A A SSAA   S A 
   159   50 H S  E     -GH 144 168C   0  688   94     AAAAAAAE   R      V    RGYVDE     S   YFVITAAE E    G Q ACAA   S L 
   160   51 H I  E     -GH 143 167C   4  675   18     ISSSSSSI   I      I    IIIIII     I   IIMIISSI I    T I IIII   I I 
   161   52 H N    >   -     0   0   47  682   84     YRRRRRRR   R      W    KSSSRN     S   NRSWTRRR S    T R SSRR   S Y 
   162   53 H N  T 3  S+     0   0   65  684   88     RNNNNNNN   S      F    SSPYSP     Q   SNYDWNSL S    Y L SSWW   T S 
   163   54 H G  T 3  S-     0   0   65  686   68     GKKKKKKK   K      D    KDSDDD     P   DKBDNKKK G    D K SGSS   G D 
   164   55 H G  S <  S+     0   0   30  687   43     GAAGAAVA   S      G    AGGGSG     S   GAGGGAAS G    G S SDGG   S G 
   165   56 H G  S    S+     0   0   74  688   63     Tnnnnfyn   n      S    dRSNSS     g   TnBSGnhh S    R d SGKK   g S 
   166   57 H R        +     0   0  163  505   86     .ttttttv   a      N    tKSYTT     n   .tBDStra .    I a YSEE   t S 
   167   58 H T  E     -H  160   0C  62  677   52     TTTTTTTA   A      K    TKTKTT     T   AAKQVTTT T    K T TTTT   T T 
   168   59 H Y  E     +H  159   0C  53  686   85     YEEEEEEY   Y      Y    DKYYYN     Y   YEHHLEEH Y    D H FYWW   L Y 
   169   60 H Y        -     0   0   44  688    9     YYYYYYYY   Y      Y    YYYYYY     Y   YYYYYYYY Y    Y Y YYYY   Y Y 
   170   61 H P    >>  -     0   0   20  688   65     ASSSSSSG   A      A    AVAAAA     L   AAAAASSA A    A A TAKV   S A 
   171   62 H D  T 34 S+     0   0  148  688   64     DAAAAAAK   D      D    ADEDAN     D   DADDDAAE D    D E DDDD   D E 
   172   63 H T  T 34 S+     0   0   90  688   57     SSSSSSSS   S      S    PSSSSA     P   SSSSSSSS A    S S SSSS   S S 
   173   64 H V  T X> S+     0   0    1  688   42     VVVVVVVL   V      V    VVVVVV     V   VVVVVVVV V    V V VVVV   V V 
   174   65 H K  B 3< S+c  177   0A 142  687   31     KKKKKKKK   R      R    KKKKKK     K   KKNKKKKK K    K K KKKK   K K 
   175   66 H G  T 34 S+     0   0   74  687   36     GGGGGGGG   D      G    GGGGGG     G   GGGGGGGG G    G G GGGG   G S 
   176   67 H R  T <4 S+     0   0   36  688   17     RRRRRRRR   R      R    RRRRRR     R   RRRRRRRR R    R R RRRR   R R 
   177   68 H F  E  <  -cD 174 192A   2  688   60     FFFFFFFF   F      F    FFFFFF     F   FFFFFFFF F    F F FFFF   F F 
   178   69 H T  E     - D   0 191A  79  688   38     TIIIIIIT   T      T    TFTTTT     T   TTTTAIIT T    T T TTTT   I T 
   179   70 H I  E     + D   0 190A   5  688   20     IVVVVVVL   I      I    IIIIII     I   IIIIIVVI I    I I VIII   I I 
   180   71 H S  E     - D   0 189A  51  684   41     SSSSSSSS   S      S    SSSSSS     S   SSSSSSSS S    S S SSSS   S S 
   181   72 H R  E     - D   0 188A  30  687   60     RRRRRRRR   R      R    RRRRRR     R   RRRRRRRR R    R R KTRR   R R 
   182   73 H D  E > > - D   0 187A  60  686    7     DDDDDDDD   D      D    DDDDDD     D   DDNDDDDD D    D D DDDD   D D 
   183   74 H N  G > 5S+     0   0   48  688   57     DTTTTTTD   D      N    DNRNNN     N   NDDNNTTD T    N D NNNN   N N 
   184   75 H A  G 3 5S+     0   0   99  688   45     SSSSSSSS   S      S    SSASSA     A   ASSSASSS G    S S AAAA   A A 
   185   76 H K  G < 5S-     0   0  111  688   51     RQQQQQQK   Q      K    KKKKRK     K   KKKKQQQK Q    K K KSKK   K N 
   186   77 H N  T < 5 +     0   0   62  688   46     BSSSSSSS   S      K    NNNNNN     N   NNNNKSSS S    N R SNTS   N S 
   187   78 H T  E   < -BD 132 182A  16  688   69     TIIIIIII   M      M    TTSTTT     T   SSTTTIVS T    T S STTT   T Q 
   188   79 H L  E     -BD 131 181A   0  687   56     VLLLLLLV   L      L    LLVLLL     L   LLLLLLLV L    L V LVVV   L L 
   189   80 H Y  E     -BD 130 180A  41  687   46     YYYYYYYY   Y      Y    YYSYYF     Y   YYYFYYYF Y    Y Y YYYY   Y H 
   190   81 H L  E     -BD 129 179A   0  687    7     LLLLLLLL   L      L    LLLLLL     L   LLLLLLLL L    L L LLLL   L L 
   191   82 H Q  E     -BD 128 178A  76  687   41     QQQQQQQQ   Q      Q    QQEEQQ     Q   HQNQQQQQ Q    Q Q QQQQ   Q Q 
   192   83 H M  E     +BD 127 177A   0  688   11     MMMMMMMM   M      M    MLMMMM     I   MMMMLMMM M    M M MMMM   M M 
   193   84 H S        +     0   0   42  688   54     BNNNNNNN   N      Y    NNSNNK     N   NSNDNNNN N    N N NNNN   N N 
   194   85 H S  S    S-     0   0   68  687   24     SAAAAAAN   N      S    SSSSSS     S   NGSSIAAN S    S N SSSS   S S 
   195   86 H L        -     0   0    3  686   18     LLLLLLLI   L      L    LLLLLL     L   LLLLLLLL L    L L LLLL   L L 
   196   87 H K    >   -     0   0  102  686   68     RRRRRRRR   K      R    KRRRRR     R   RKRRRRRR K    R R RKKK   R K 
   197   88 H S  G >  S+     0   0   70  686   60     AAAAAAAS   T      A    TARTVA     A   ATPPPAAA A    L A APPP   A T 
   198   89 H E  G 3  S+     0   0  126  687   22     EEEEEEEE   E      E    EEEEEE     E   EEEEEEEE E    E E EEEE   E E 
   199   90 H D  G <   +     0   0    2  687    3     DDDDDDDD   D      D    DDDDDD     D   DDDDDDDD D    D D DDDD   D D 
   200   91 H T    <   +     0   0   32  688   28     TTTTTTTT   T      T    TTTTKM     T   TTTTTTTT T    T T TTTT   T T 
   201   92 H A  E    S- I   0 223C   8  686    5     AAAAAAAG   A      A    AAAAAA     A   AAAGAAAG A    A G AAAA   A A 
   202   93 H M  E     -FI 148 222C  58  687   48     VIIIIIII   M      V    VVMLLV     V   VVVVFITI T    V T VVVV   V L 
   203   94 H Y  E     -FI 147 221C   0  688    1     YYYYYYYY   Y      Y    YYYYYY     Y   YYYYYYYH Y    Y Y YYYY   Y Y 
   204   95 H Y  E     -F  146   0C   7  688    4     YYYYYYYY   Y      Y    YYYYYY     Y   YYYFYYYY Y    Y Y YYYY   Y Y 
   205   96 H b  E     -F  145   0C   0  688    1     CCCCCCCC   C      C    CCCCCC     C   CCCCCCCC C    C C CCCC   C C 
   206   97 H V  E     -FJ 144 217C   0  688   23     AAAAAAAS   V      A    NAAAVA     A   TTAAAATT V    A T AAAA   A A 
   207   98 H R  E     -FJ 143 216C  21  687   40     rrrrrrrr   r      r    ykrkrr     r   rRrrkrrT k    k N kaav   r k 
   208   99 H H  E     + J   0 214C   6  583   92     aggsggyy   q      y    sfnfqw     r   s.tagpn. t    g . kpds   t g 
   209  100 H E  E  >  + J   0 213C  63  625   78     RSBTSSGG   A      N    SADDAA     G   RHASNHS. A    P . GPIS   G R 
   210  101 H Y  T >4 S-     0   0   80  658   93     LSSWSRSG   W      I    GAAWSS     R   VTMCWWYG A    D W DCSP   G F 
   211  102 H Y  T 34 S-     0   0  140  672   23     FYYYYYYy   F      h    YYFlYY     F   FYFFFYFF I    Y Y WYlV   S Y 
   212  103 H Y  T 34 S+     0   0   39  265   92     .WW.WWWn   .      p    LY.g..     .   H.....G. .    . . .Pv.   . . 
   213  104 H A  E <<  -J  209   0C   0  403   87     .YY.YYYW   .      T    SG.Y..     K   YT.G..Y. .    . Y .GGG   S . 
   214  105 H M  E     +J  208   0C   0  497   62     .FFFFFFF   .      V    RM.F..     A   PFFP.FF. .    . F LMFF   L F 
   215  106 H D  E     +     0   0C  19  615   50     .DDDDDDV   A      D    DDDD..     F   CKADDDDA D    . D GDDD   D L 
   216  107 H Y  E     -J  207   0C  99  624   65     .VVVVVVY   Y      Y    LVIH..     S   VTHYSVVY A    . Y NYYY   V Y 
   217  108 H W  E     -J  206   0C  23  675    2     .WWWWWWW   W      W    WWWWWW     W   WWWWWWWW W    W W WWWW   W W 
   218  109 H G        -     0   0    0  664   17     GGGGGGGG   G      G    GGGGGG     S   GSGGGGGG G    G G GGGG   G S 
   219  110 H Q        -     0   0   91  659   46     KAAAAAAQ   Q      Q    QQQQQQ     S   RLQQQAAQ R    L Q QKQQ   R L 
   220  111 H G        -     0   0   16  650   16     GGGGGGGG   G      G    GGGG       G   GPGGGGGG G    G G GGGG   G N 
   221  112 H T  E     -I  203   0C  21  594   27     TTTTTTTT   T      T    .TTT       G   ..TTTTTT T    T T TTTT   V V 
   222  113 H T  E     -I  202   0C  72  593   76     TTTTTTTL   L      L    .TML       A   ..LPLTTL S    L T LQQQ   L S 
   223  114 H V  E     -I  201   0C   0  596   20     VVVVVVVV   V      V    .VVV       P   ..VVVVVV V    V L VVVV   V V 
   224  115 H T  E     -e  120   0B  36  593   20     TTTTTTTT   T      T    .TTT       P   .VTTTTTT T    T T TTTT   T T 
   225  116 H V  E     +e  121   0B   6  572    6     VVVVVVVV   V      V    .VVV       V   .LVVVVVV V    V V VVVV   V V 
   226  117 H S        -     0   0   36  566   11     SSSSSSSS   S      S    .SSS       A   .GSSSSS  S    S S SSSS   S T 
   227  118 H S  S    S+     0   0   84  551   22     SSSSSSSS   A      S    .SSS       P   .SSSSSS  S    S S SSSS   S   
   228  119 H A  S    S+     0   0   70  123   53                            TA             .G              A        A   
   229  120 H W        -     0   0  123   73   63                            W              W               K            
   230  121 H R        +     0   0  207   60   75                                                           T            
   231  122 H H              0   0  156   54   67                                                           T            
   232  123 H P              0   0  155   35   53                                                           P            
## ALIGNMENTS  421 -  490
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....3....:....4....:....5....:....6....:....7....:....8....:....9
     1    1 L D              0   0  183  420   16   D   DD   DDDED  D  D D         DD   D DDDDDDDDD D DE D      DD     D 
     2    2 L I        -     0   0   32  462   11  II   II   IIIII  I  I I I       II   I IIIVIIIII I II I      II  IIII 
     3    3 L E        -     0   0  117  463   68  VQ   QT   QQVVQ  Q  Q Q V       QQ   T QQQQQQQQQ Q QV K      QQ  QQQQ 
     4    4 L L  E     -K   25   0D  10  474    7  LM   MM   MMMMM  M  M M L       MM   M MMMMMMMMM M MM M      MM  MMMM 
     5    5 L T  E     -K   24   0D  64  475    8  ST   TT   TTTTT  T  T T T       TS   T TTTTTTTTT T TT T      TT  TTTT 
     6    6 L Q  E     -K   23   0D  13  475    0  QQ   QQ   QQQQQ  Q  Q Q Q       QQ   Q QQQQQQQQQ Q QQ Q      QQ  QQQQ 
     7    7 L T  E    S+K   22   0D  64  475   34  SS   SS   SSTST  S  T T S       SS   S SSSSTTTST S SS S      SS  STSS 
     8    8 L P        -     0   0   46  480    9  PP   PP   PPPPT  P PI T P       PP   P PPPPTTTTP P PP P      PP  PPPP 
     9    9 L V  S    S+     0   0   96  484   67  AS   SS   SSAVS  S AS S A       SS   L SSSSSSSSS S SA S      SS  SPSS 
    10   10 L S  E     -n  104   0E  60  485   43  SS   SY   SSSTS  S IS S S       SS   S SSSSSSSSS S ST S      SS  SSFS 
    11   11 L L  E     -n  105   0E  58  489   21  LV   LL   VLVLL  L ML L L       IL   L LVVLLLLLL L LL L      LL  LLLL 
    12   12 L S  E     +n  106   0E  60  490   42  SS   SS   SSSSS  P SS S S       SS   S SSSSSSSSS S SS S      SS  SSSS 
    13   13 L A  E     -n  107   0E   0  490   58  GA   AK   AAAVA  A AA A R       AA   V AAAAAAAAA A AV A      AA  AAAA 
    14   14 L S    >   -     0   0   47  491   29  SS   SS   SSASS  S SS S S    S  SS   S SSSSSSSSS S SS S      SS  SSSS 
    15   15 L V  T 3  S+     0   0   76  491   66  PV   QP   VVVPL  L PL L A    L  IL   R VVVVLLLLL L VP L      VV  LLVV 
    16   16 L G  T 3  S+     0   0   42  491    4  GG   GG   GGGGG  G GG G G    K  GR   G GGGGGGGGG G GG G      GG  GGGG 
    17   17 L E    <   -     0   0   71  491   35  ED   EE   DDGED  E ED D E    D  ED   G DDDDDDDDD D DE E      DD  DDDD 
    18   18 L T        -     0   0   69  491   62  TR   RR   RRTRR  R KR R T    P  RT   R RRRRRRRRR R RR R      RT  TTTR 
    19   19 L V  E     - L   0  75D  11  491   37  VV   VV   VVVAV  V VV V V    V  VV   V VVVVVVVVV V VA V      VV  VVVV 
    20   20 L T  E     - L   0  74D  67  490   30  TT   ST   TTTTT  T TT T T    T  TT   T TTTITTTTT T TT S      TT  TTTT 
    21   21 L I  E     - L   0  73D   1  489   17  II   LI   IIILI  I MI I I    I  II   I IIIIIIIII I IL L      II  IIII 
    22   22 L T  E     -KL   7  72D  29  489   58  TT   TT   TTNSS  S TS S S    T  ST   T TSTTSSSSS S TS T      TT  RNTT 
    23   23 L a  E     -KL   6  71D   0  490    1  CC   CC   CCCCC  C CC C C    C  CC   C CCCCCCCCC C CC C      CC  CCCC 
    24   24 L R  E     -KL   5  70D 110  490   45  KQ   KR   RRQRR  R RR R R    Q  RQ   R RRRRSRRRR R RW R      RR  QQKR 
    25   25 L A  E     -K    4   0D  10  490   29  AA   AA   AAAAA  A AA A A    A  AA   A AAAAAAAAA A AA A      AA  AAAE 
    26   26 L S  S    S+     0   0   66  490    4  SS   SS   SSSSS  S SS S T    S  SS   S SSSSSSSSS S SS S      SS  SSSS 
    27   27 L E  S    S-     0   0  101  490   38  GQ   EQ   QQQQQ  Q SQ Q E    Q  QQ   E QQQQQQQQQ Q QQ Q      QQ  QQQQ 
    28   28 L N        +     0   0   83  490   45  SG   GG   GGNSD  G SD D S    S  GG   D GSGSSDDDD G SS E      SE  GSGG 
    29   29 L I    >   -     0   0    5  491   32  VV   II   IIIII  I VI I L    I  II   I IIISIIIII I II I      II  IIII 
    30   30 L Y  T 3   -     0   0  155  491   81  YS   SS   SSDsN  S sN S t    G  NS   Y SSSVGSSSN S SS S      SY  NSNS 
    31   31 L S  T 3  S+     0   0   53  467   65  DN   NS   NDSsN  N sN N q    S  KS   D SSSDNNNNN K NS G      K.  NNR. 
    32   32 L Y    <   +     0   0   63  490   52  YA   YS   YDWYY  N HY Y Y    A  WW   N WWAYYYYYY W YN Y      WS  EWWN 
    33   33 L L  E     -O   90   0E   0  490    7  LL   LL   LLLLL  L LL L L    L  LL   L LLLLLLLLL L LL L      LL  LLLN 
    34   34 L A  E     -O   89   0E   0  490   71  HA   HN   AAAAN  A HS N H    A  AA   N AAANBNNNN A NA S      AS  NAAL 
    35   35 L W  E     -OP  88  48E   1  491    0  WW   WW   WWWWW  W WW W W    W  WW   W WWWWWWWWW W WW W      WW  WWWN 
    36   36 L Y  E     -OP  87  46E   0  491    9  YY   YY   YHYYY  Y YY Y Y    Y  YY   Y YYYYYYYYY Y YY L      YY  YYYY 
    37   37 L Q  E     -OP  86  45E   7  491   28  QQ   QQ   QQQQQ  Q QQ Q Q    Q  QQ   Q QQQQQQQQR Q QQ Q      QQ  QQQQ 
    38   38 L Q  E     -O   85   0E  21  491    4  QQ   QQ   QQQQQ  Q QQ Q Q    Q  QQ   Q QKQQQQQQQ Q QQ Q      QP  QQQQ 
    39   39 L K    >   -     0   0   51  490    9  KK   KK   KKKKK  K KK K K    K  KK   K KKKKKKKKK K KK K      KK  KKKK 
    40   40 L Q  T 3  S+     0   0  190  491   19  PP   PP   PPPPP  P SP P P    P  PP   P PPPPPPPPP P PP P      PP  PPPP 
    41   41 L G  T 3  S+     0   0   86  491   10  GG   GG   GGGSD  G GD D G    G  GG   G GGGGDDDDD G GG D      GG  GGGG 
    42   42 L K  S <  S-     0   0  126  490   54  QK   QQ   KKQGG  K AG G Q    K  KK   Q KKKKGGGGG K KQ G      KN  ADAK 
    43   43 L S        -     0   0   21  490   55  AT   AS   AAPST  S ST T A    S  AS   P AAPATTTTT A AA T      VP  SSST 
    44   44 L P        -     0   0    4  490   11  PP   PP   PPPPV  P PV V P    P  PP   P PPAPVVVVV P PP V      PP  PPPP 
    45   45 L Q  E     -P   37   0E  74  490   32  RK   KK   KKKRK  Q KK K R    N  KK   K KKKKKKKKK K NR K      KK  KKKK 
    46   46 L F  E     +P   36   0E  25  490   42  LL   LR   LLVLL  L LL L L    L  LL   L PLLLLLLLL P LL R      LL  LLLL 
    47   47 L L  E     +     0   0E   4  490    9  LL   LL   LLLLL  L WL L L    L  LL   L LLLLLLLLL L LL L      LL  LLLL 
    48   48 L V  E     -PQ  35  54E   0  491    5  II   II   IIIII  I II I I    I  II   I IIIIIIIII I II I      II  IIII 
    49   49 L Y  E >> S+ Q   0  53E  39  491   17  YY   NY   YYYYY  Y YY Y Y    Y  YY   Y YYYFYYYYY Y YY Y      YY  YYYY 
    50   50 L N  T 34 S-     0   0   52  491   91  GD   NG   YARGY  G SY Y E    Y  QA   G KKADYYYYY E AG A      AG  AKGA 
    51   51 L A  T 34 S+     0   0    3  491   45  VA   AA   AATAT  A TT T A    A  AA   T VAATTTTTT A AA A      AI  AAAA 
    52   52 L K  T <4 S+     0   0  148  491   25  ST   NS   SSSSS  T SS S T    K  NS   S SSSSSSSSS S SS S      SN  SSSS 
    53   53 L T  E  <  -Q   49   0E  47  491   67  NT   TN   SSTTR  S NR R N    G  KN   N SSSNSRRRR K ST T      TI  TNTS 
    54   54 L L  E     -Q   48   0E  60  491   60  LL   LL   LLLRL  L LL L L    L  LL   L LLLLLLLLL L LR L      LL  LLLL 
    55   55 L G    >   -     0   0    9  490   71  EQ   QQ   QQAAH  A AH H A    V  EQ   Q EQQQHHHHH H QA H      QE  QEQQ 
    56   56 L E  T 3  S+     0   0  192  490   35  CS   SS   SSSTS  D SS S S    D  SS   P SSSSSSSSS S ST S      SD  STSS 
    57   57 L G  T 3  S+     0   0   70  491    5  GG   GG   GGGGG  G GG G G    G  GG   G GGGGGGGGG G GG G      GG  GGGG 
    58   58 L V    <   -     0   0   25  489   11  VV   VV   VVVIV  V VV V V    V  VV   V IVVVVVVVV V VI V      VV  VIVI 
    59   59 L P    >   -     0   0   47  490    7  PP   PP   PPPPP  P PP P P    P  PP   P PPPPPPPPP P PP P      PP  PPPP 
    60   60 L S  T 3  S+     0   0  115  491   57  AS   SS   SSSAS  S AS S S    S  SS   S SSSSSSSSS S SA K      SQ  SSSS 
    61   61 L R  T 3  S+     0   0   44  491    4  RR   RR   RRRRR  R RR R R    R  RR   R RRRRRRRRR R RR R      RR  RRRR 
    62   62 L F  E <   +M   75   0D   5  491    1  FF   FF   FFFFF  F FF F F    F  FF   F FFFFFFFFF F FF F      LF  FFFF 
    63   63 L S  E     -M   74   0D  55  490   22  SS   SS   SSKSS  S SS S S    S  SR   S SSSSSSSSS S SS S      SS  SRSS 
    64   64 L G  E     +M   73   0D  13  491    2  GG   GG   GGGGG  G GG G G    G  GG   G GGGGGGGGG G GG G      GG  GGGD 
    65   65 L S  E     +M   72   0D  63  491    5  SS   SS   SSSSS  S SS S S    S  SS   S SSSGSSSSS S SS S      SS  SSSS 
    66   66 L G  E     -M   71   0D  36  491   14  GG   GV   GERGG  G GG G G    G  GG   G EGGRGGGGG G GG R      GG  GGGG 
    67   67 L S  E >   +M   70   0D  79  491    9  SS   SS   SSSSS  S SS S S    T  AS   S SSSSSSSSS S SS S      SS  YSSS 
    68   68 L G  T 3  S-     0   0   16  491   13  GG   EG   GGGGG  G GG G G    G  GG   E GGGGGGGGG G GG G      GG  GGGG 
    69   69 L T  T 3  S+     0   0   67  488   13  TT   TT   TTTTT  T TT T T    T  TK   T TTTTTTTTT T TT S      TT  TTTT 
    70   70 L Q  E <   +LM  24  67D 110  489   27  DD   DD   DEEED  Q SD D D    D  DD   D EEDDDDDDD D DE D      DQ  DDDD 
    71   71 L F  E     -LM  23  66D   2  491    6  YY   FF   YFFFY  F YY Y F    F  FF   Y FFYFYYYYY F FF Y      FF  FYFY 
    72   72 L S  E     -LM  22  65D  26  491   30  TT   TT   TTTTS  S SS S T    T  TT   S TTTTSSSSS S TT S      TS  TSTT 
    73   73 L L  E     -LM  21  64D   0  491    2  LL   LL   LLLLL  L LL L L    L  LL   L LLLLLLLLL L LL L      LL  LLLL 
    74   74 L K  E     -LM  20  63D  97  491   39  TT   TT   TTTTT  K TT T T    T  TT   T TTTTTTTTT T TT T      TK  TTTT 
    75   75 L I  E     -LM  19  62D   0  491    1  II   II   IIIII  I II I I    I  II   I IIIIIIIII I II I      II  IIII 
    76   76 L N  S    S-     0   0   86  491   30  SS   SS   SSSSS  S ST S S    S  SS   S SSSSSSSSS S SS S      SS  SSRS 
    77   77 L S  S    S-     0   0   58  491   62  SS   SS   SSDSN  S SN N S    S  SG   S SSSSBNNNN N GS S      SS  GGGS 
    78   78 L L        -     0   0    0  491   27  LL   LL   LLLLL  P VL L L    L  LL   L LLLLLLLLL L LL L      LL  LLLL 
    79   79 L L    >   -     0   0   67  491   31  EQ   EE   QQEQE  H EE E E    E  EQ   E QQQQZEEEE E QQ E      QQ  QQQQ 
    80   80 L P  G >  S+     0   0   92  491   58  PP   PP   PPCSQ  P AQ Q P    P  PA   P PPPPPQQQQ P AS S      PA  AAAP 
    81   81 L E  G 3  S+     0   0  102  491   13  EE   EE   EEAEE  D EE E E    E  EE   E EEEDZEEEE D EE D      EE  EEEE 
    82   82 L D  G <  S+     0   0    1  491    5  DD   DD   DDDDD  D DD D D    D  DD   D DDDDBDDDD D DD D      DD  DDDD 
    83   83 L F    <   +     0   0   29  490   72  AF   GF   FFAFI  T AV I A    I  VF   A FFFFIIIII F FF F      VI  AVFF 
    84   84 L G  E    S- R   0 105E  17  491   23  GA   AA   AAAAA  A AA A G    A  AA   A AAAAAAAAS G AA A      AA  AAAA 
    85   85 L S  E     -OR  38 104E  24  491   63  HT   TT   TTTVT  M ST T E    T  TT   T TTTTTTTTT I TI D      TA  TDNT 
    86   86 L Y  E     -OR  37 103E   0  491    0  YY   YY   YYYYY  Y YY Y Y    Y  YY   Y YYYYYYYYY Y YY Y      YY  YYYY 
    87   87 L Y  E     -O   36   0E   5  490    4  YY   FF   YYYYF  Y YF F Y    Y  YY   Y YYYYYFFFF Y YH Y      YY  YYYY 
    88   88 L a  E     -O   35   0E   0  491    0  CC   CC   CCCCC  C CC C C    C  CC   C CCCCCCCCC C CC C      CC  CCCC 
    89   89 L Q  E     -OS  34  99E   0  489   48  QQ   QL   QQQQQ  Q QQ Q Q    Q  QQ   Q QTQQQQQQQ Q QQ L      QQ  QQLE 
    90   90 L H  E     -O   33   0E  22  483   26  QQ   QQ   QQSQQ  Q QQ Q Q    Q  QQ   Q QQQQQQQQQ Q QQ Q      KQ  NQQQ 
    91   91 L H        +     0   0    0  421   89  GY   GC   YYY.G  G YG G S    H  YY   G YHYS.GGGG Y SY Y      HG  DYRS 
    92   92 L Y  S    S+     0   0  104  454   88  YN   YY   NNYYK  Y SN N K    N  DN   S NNNYYNNYN N YN A      DR  YNNY 
    93   93 L G  S    S-     0   0   34  422   71  ES   SS   SSSN.  S GT . S    N  SS   S SSSTS.... S SS S      SY  ESSS 
    94   94 L T  S    S-     0   0  104  446   88  WY   YF   YY NT  D YL T S    N  SW   Y VYVNKSMMA Y AW D      AY  GYWT 
    95   95 L P  S    S+     0   0    7  443   51  LP   PP   PP WL  P PP L P    P  PP   P PPPPLLLLL P LP P      AP  PPPP 
    96   96 L P  S    S-     0   0   55  421   75  PP   PP   PP PP  P LY P      P  PP   P PPPEPPPPP P TP W      HP  WPLP 
    97   97 L L        -     0   0   21  160   88  ..   TT   .. PR  T N. L      .  .T   T ...VRRRRR . FL .      ..  ..T. 
    98   98 L T        -     0   0   40  288   41  T.   VV   .. TT  V TT T      .  .V   V ...TTTTTT . GT T      ..  GTVT 
    99   99 L F  B     -S   89   0E  18  290   29  V.   II   .. FF  I FF F      .  .L   I ...FFFFFF . PF F      ..  WVLV 
   100  100 L G        -     0   0    3  294   39  L.   QQ   .. GG  Q GG G      .  .Q   Q ...GGGGGG . GG G      ..  GLQL 
   101  101 L G        -     0   0   52  307   63  Q.   AA   .. QG  A SG A      .  .V   N ...GGGGGG . TG G      ..  GQQQ 
   102  102 L G        -     0   0   11  306   43  G.   MM   .. GG  M GG G      .  .L   K ...GGGGGG . KG G      ..  GISL 
   103  103 L T  E     - R   0  86E   0  366   18  TT   TT   TT TT  A TT T      .  TT   T TTTTTTTTT T VT T      TA  GALN 
   104  104 L K  E     -nR  10  85E  98  363   58  EV   KK   VV RK  T KK K      T   K   K VVVTKKKKK V DK K      VV  KKDK 
   105  105 L L  E     -nR  11  84E   4  343   37  LL        LL VL  T LL L      V   I     LLLVLLLLL L IV L      II  VIKL 
   106  106 L E  E     -n   12   0E 108  326   51            HH EE  Q EE E      E   E     HHHDEEEEE Q  E E      QQ  QEEE 
   107  107 L I  E      n   13   0E 113  301   50            T  II  E II L                TTTIIIIII A  I I      SV  VIIS 
   108  108 L K              0   0  145  268   18            R  KK  R KK K                QRRKKKKKK Q  K K      Q   K KK 
   109      ! !              0   0    0   0     0  
   110    1 H E              0   0  194  408   30    EEE          EE Q  Q E Q EE EE  E E           E    E QDDDDD  EE    E
   111    2 H V        +     0   0   19  465   12    VVV  VVV     VV V  V V V VV VV  VVV V         E V  V VVIIII  MV    V
   112    3 H K  E     -A  134   0A 111  467   31    QKK  QQQ     QQ Q  Q R Q QQ QQ  QQQ Q         K Q  Q QQQQQQ  KQ    Q
   113    4 H L  E     -A  133   0A   3  489    1    LLL  LLL     LL L  L L L LL LL  LLL L         L L  L LLLLLL  LL    L
   114    5 H Q  E     -A  132   0A  83  493   70    LVE  VVV     VV Q  L V VVVV VA  VLL V         V V  V QVVVVV  VV    V
   115    6 H E  E     +A  131   0A   5  498   21    EEE  EEE     EE E  E E QEEE EE  EEE E         E E  E QEEEEE  EE    E
   116    7 H S  E     +A  130   0A  69  501   13    SSS  SSS     SS S  S S SSSS SS  SSS S         S S  S SSSSSS  SS    S
   117    8 H G        +     0   0   36  505    4    GGG  GGG     GG G  G G GGGG GG  GGG G         G G  G GGGGGG  GG    G
   118    9 H G        +     0   0   29  672   48    GGG  GGG     GG G  G G GGGG GG  GGG G         G G  G GGGGGG  GG    G
   119   10 H D        -     0   0   96  677   40    GGG  GGG     DD G  G G GGGG GG  GGG G         G G  G GDDDDD  DG    G
   120   11 H L  E     +e  224   0B  79  675   16    LLL  LLL     ML L  L L VLLL LL  LLL L         L V  L LLVVVV  LL    L
   121   12 H V  E     -e  225   0B  16  677   33    VVV  QQQ     VV V  V V VVVV AV  VVV Q         V V  V VRRRRR  RA    A
   122   13 H Q    >   -     0   0  114  679   51    QQQ  QQQ     KK Q  K E PQHQ QQ  QQQ Q         Q Q  K QQQQQQ  QQ    Q
   123   14 H P  T 3  S+     0   0   66  678    9    PPP  PPP     PP P  P P PPPP PP  PPP P         P P  P APPPPP  PP    P
   124   15 H G  T 3  S+     0   0   58  682   32    GGG  GGG     GG G  G G GGGG GG  GGG G         G G  G GGGGGG  GG    G
   125   16 H G    <   -     0   0   25  684   63    GGR  GGG     GG G  G G RGGG GG  GGG G         G R  G GGGGGG  GG    G
   126   17 H S        +     0   0   78  683   31    SSS  SSS     SS S  S F SSSS SS  SSS S         S S  S SSSSSS  SS    S
   127   18 H L  E     - B   0 192A  25  685   25    LLM  LLL     LL L  L L LLLL LL  LLL L         L L  L LLLLLL  LL    L
   128   19 H K  E     - B   0 191A  93  683   56    RRK  RRR     RR R  R R RRRR RR  RRR R         R R  R RRKKKK  RR    R
   129   20 H L  E     - B   0 190A   0  688   14    LLL  LLL     LL L  L L LLLL LL  LLL L         L L  L LLLLLL  LL    L
   130   21 H S  E     -AB 116 189A  28  688   37    SSS  SSS     SS S  S S SSSS SS  SSS S         S S  S SSSSSS  SS    S
   131   22 H b  E     -AB 115 188A   0  688    0    CCC  CCC     CC C  C C CCCC CC  CCC C         C C  C CCCCCC  CC    C
   132   23 H A  E     -AB 114 187A  52  688   66    AAV  KKK     VV T  A V AAAA AA  AAA K         V A  A VKKKKK  VA    A
   133   24 H A  E     +A  113   0A   8  688   49    ATA  GAA     AA A  A V AAAA AA  AAA G         G A  A AAAAAA  AA    A
   134   25 H S  E     +A  112   0A  58  688   12    SSS  TTT     SS S  S S SSSS SS  SSS T         S S  S SSSSSS  SS    S
   135   26 H G  S    S+     0   0   56  688    4    GGG  GGG     GG G  G G GGGG GG  GGG G         G G  G ggGGGG  GG    G
   136   27 H F  S    S-     0   0   33  686   34    FFF  FFF     FF S  F F FFFF FF  FFF F         F Y  F sfFFFF  FF    F
   137   28 H T    >   -     0   0   93  687   50    TTT  DMT     TT I  T T TTTT TT  TTS T         T T  T GSTTTT  TT    T
   138   29 H F  G >  S+     0   0    2  688   41    FFF  FLL     FF S  F F FFFF FF  FFF L         F F  F HSFFFF  FF    F
   139   30 H S  G 3  S+     0   0   57  688   55    STS  SSS     SS S  S S SRSS SS  SSS S         S S  S GSSSSS  DS    S
   140   31 H S  G <  S+     0   0   71  688   60    SDN  SSS     SS I  N D TSSS DG  SAT S         Y S  K GNSSSS  DD    D
   141   32 H Y  S <  S-     0   0   44  688   41    SYY  MFF     YY N  A H YYSY HY  YSD F         Y Y  A YYYYYY  YH    H
   142   33 H T        -     0   0   30  688   91    AYW  RDL     YY A  W Y GGGY YE  DAA G         E G  W GGYSGD  GY    Y
   143   34 H M  E     -FG 207 160C   0  672   46    MMM  VMM     MM M  M M MMMM MM  MMM M         I M  M MMMMMM  MM    M
   144   35 H S  E     -FG 206 159C   0  685   73    SSN  MFQ     YE G  S D HNNH DH  HSY S         S H  S GSSNYS  SD    D
   145   36 H W  E     +FG 205 158C   0  688    0    WWW  WWW     WW W  W W WWWW WW  WWW W         W W  W WWWWWW  WW    W
   146   37 H V  E     -FG 204 156C   0  688   19    VVV  VVI     AV Y  V V VVVV VV  VVV I         V V  V FVVVIV  VV    V
   147   38 H R  E     -FG 203 155C  10  688   17    RRR  RRR     RR R  R R RRRR RR  RRR R         R R  R RRRRRR  RR    R
   148   39 H Q  E     -FG 202 154C   9  688    3    QQQ  QQQ     QQ Q  Q Q QQQQ QQ  QQQ Q         Q Q  Q QQQQQQ  QQ    Q
   149   40 H T    >   -     0   0    9  688   68    APS  AAA     AA A  A A AAAA AA  AAA A         A A  A VAAAAA  AA    A
   150   41 H P  T 3  S+     0   0   80  687   10    PPP  PPP     PP P  P P PPPP PP  PPP P         P P  P PPPPPP  PP    P
   151   42 H E  T 3  S-     0   0  151  688   26    GGE  GGG     GG G  G G GGGG GG  GGG G         G G  G GGGGGG  GG    G
   152   43 H K    <   +     0   0  121  688   32    KKK  KKK     KK S  K K KKKK KK  KKK K         K K  K KKKKKK  KK    K
   153   44 H R        -     0   0  113  687   43    GAG  GGG     GG K  G G GGGG GW  GGG G         G G  G EGGGGG  GG    G
   154   45 H L  E     -G  148   0C   9  688   14    LLL  LLL     LL R  L L LLLL LL  LLL L         L L  L RLLLLL  LL    L
   155   46 H E  E     -G  147   0C  44  687    5    EEE  EEE     QQ E  E D EEEE EE  EEE E         E E  E EEEEEE  QE    E
   156   47 H W  E     +G  146   0C  15  687   11    WWW  AVP     WW F  W W WWWW WS  WWW P         W W  W FWWWWW  WW    W
   157   48 H V  E     -     0   0C   0  687   28    VLV  VVV     VV V  V V VVVV VV  AVV V         L V  V VVIVVV  VV    V
   158   49 H A  E     -G  145   0C   0  688   38    AGA  AAA     SA A  G S ASAA GS  SAA A         A A  G AASSSS  SS    S
   159   50 H S  E     -GH 144 168C   0  688   94    WFE  GLS     HQ H  r S VPVy RV  YWW G         A V  r AIERAY  YR    R
   160   51 H I  E     -GH 143 167C   4  675   18    .II  III     II I  t I IIIi II  I.. I         S I  s IIIIII  II    I
   161   52 H N    >   -     0   0   47  682   84    KRR  YVS     NS T  K S SSWS RG  SKK S         G W  K RYSDSS  SR    R
   162   53 H N  T 3  S+     0   0   65  684   88    YNL  NTK     KS N  T T YTYS NG  YYY S         C Y  T WTNTNS  WN    N
   163   54 H G  T 3  S-     0   0   65  686   68    EKK  DTN     DD T  D G DGDD KD  NEQ S         G D  D SSDGDG  SK    K
   164   55 H G  S <  S+     0   0   30  687   43    NAS  GGG     GG G  G S GGGG AS  GNE G         G G  G GSGSGG  GA    A
   165   56 H G  S    S+     0   0   74  688   63    gbh  SAY     SS V  G g NGSr nS  Gga S         w S  G VGSGSS  Sn    n
   166   57 H R        +     0   0  163  505   86    dya  G..     SS .  T t YSQy tY  Sdn D         r N  T TNS.SS  St    t
   167   58 H T  E     -H  160   0C  62  677   52    KTI  TAT     TT T  T T KTKI TT  TKS T         T K  T TATTTT  IT    T
   168   59 H Y  E     +H  159   0C  53  686   85    HTH  YGW     SY E  D L YYYN EH  NHH Y         Y Y  D YYYYYN  YE    E
   169   60 H Y        -     0   0   44  688    9    YEY  YYY     YY F  Y Y YYYY YY  YYF Y         Y Y  Y YYYYYY  YY    Y
   170   61 H P    >>  -     0   0   20  688   65    AYA  AAA     AP A  A P AAAA AA  AAA A         V A  A VAAAAA  AA    A
   171   62 H D  T 34 S+     0   0  148  688   64    DSE  SPD     DD D  A D DDDA AD  DDD D         D D  A DDDDDD  GA    A
   172   63 H T  T 34 S+     0   0   90  688   57    SAS  SSV     AA S  P S SSSS SS  SST A         S S  P SSSSSS  SS    S
   173   64 H V  T X> S+     0   0    1  688   42    VVV  VVV     VV V  V V VVVV VV  VVV V         V V  V VVVVVV  VV    V
   174   65 H K  B 3< S+c  177   0A 142  687   31    NKK  KKQ     KK K  K K RKKK KK  KNN Q         K K  K KKKKKK  KK    K
   175   66 H G  T 34 S+     0   0   74  687   36    GGG  GGG     GG G  G G GGGG GG  GGG G         G G  G GGGGGG  GG    G
   176   67 H R  T <4 S+     0   0   36  688   17    RRR  RRR     RQ R  R R RRRR RR  RRR R         R R  R RRRRRR  RR    R
   177   68 H F  E  <  -cD 174 192A   2  688   60    FFF  FFF     FF F  L F FFFF FF  FFF F         F F  L FFFFFF  FF    F
   178   69 H T  E     - D   0 191A  79  688   38    TTT  TTT     TT T  T I TTTT TT  TTT T         T T  T TTTTTT  TT    T
   179   70 H I  E     + D   0 190A   5  688   20    III  III     II I  I I IIII II  III I         I T  I IIIIII  TI    I
   180   71 H S  E     - D   0 189A  51  684   41    SSS  SSS     SS S  S S SSSS SS  SSS S         S S  S SSSSSS  SS    S
   181   72 H R  E     - D   0 188A  30  687   60    RRR  RRR     RR R  R R RRRR RR  RRR R         K R  R RKRRRR  RR    R
   182   73 H D  E > > - D   0 187A  60  686    7    NBD  DDD     DD D  D D DDDD DD  DNN D         D D  D DDDDDD  DD    D
   183   74 H N  G > 5S+     0   0   48  688   57    DBD  NNS     NN N  D N NNNN DN  NDD N         N N  S NNNNNN  ND    D
   184   75 H A  G 3 5S+     0   0   99  688   45    SSS  GGG     AA A  S A SGAA SA  ASS G         S S  S AAGGGG  AS    S
   185   76 H K  G < 5S-     0   0  111  688   51    KZK  QQQ     KK K  K K KKKK KK  KKK Q         Q K  K KNNNNN  KK    K
   186   77 H N  T < 5 +     0   0   62  688   46    NGS  SSS     NN T  N N NNNN NN  NNN S         N N  N SSSSSS  NN    N
   187   78 H T  E   < -BD 132 182A  16  688   69    TIS  MTT     TT T  T T TMMT TS  STT T         T T  T TLLLLL  TT    T
   188   79 H L  E     -BD 131 181A   0  687   56    LLV  GLV     LL V  L L LLAL LL  LLL L         A L  L VVLLLL  LL    L
   189   80 H Y  E     -BD 130 180A  41  687   46    YYY  YYY     YY D  Y Y NYYY YS  YYY Y         Y Y  Y YNHHHH  YY    Y
   190   81 H L  E     -BD 129 179A   0  687    7    LLL  LLL     LL L  L L LLLL LL  LLL L         L L  L LLLLLL  LL    L
   191   82 H Q  E     -BD 128 178A  76  687   41    LQQ  QQQ     QQ Q  Q Q DQHQ QQ  QQQ Q         Q Q  R QQQQQQ  QQ    Q
   192   83 H M  E     +BD 127 177A   0  688   11    MMM  MMM     MM M  M M MMMM MM  MMM M         M M  M MMMMMM  MM    M
   193   84 H S        +     0   0   42  688   54    NNN  DNN     NN N  N N NSNS SN  NNN N         N N  N NNNNNN  DS    S
   194   85 H S  S    S-     0   0   68  687   24    STN  SSS     SS S  S S SSSS SS  SGR G         S S  S SSSSSS  RS    S
   195   86 H L        -     0   0    3  686   18    LLL  LLL     LL L  L L LLLL LL  LLL L         L L  L LLLLLL  LL    L
   196   87 H K    >   -     0   0  102  686   68    QRR  KEK     RG K  K R RRRR KR  RQE K         R R  K KKKKKK  TK    K
   197   88 H S  G >  S+     0   0   70  686   60    AAA  AAA     AA P  T A TAAA TA  AAA A         T A  T PTAAAA  QT    T
   198   89 H E  G 3  S+     0   0  126  687   22    ZQE  EEE     EE E  E E EEEE EE  EZZ E         E E  E EEEEEE  EE    E
   199   90 H D  G <   +     0   0    2  687    3    BDD  DDD     DD D  D D DDDD DD  DVB D         D D  D DDDDDD  DD    D
   200   91 H T    <   +     0   0   32  688   28    TST  TTT     TT T  T T TTTT TT  TST T         T A  T TTTTTT  TT    T
   201   92 H A  E    S- I   0 223C   8  686    5    AAG  AGA     AA A  A A AAAA AA  AAA A         A A  A GAAAAA  AA    A
   202   93 H M  E     -FI 148 222C  58  687   48    LTI  TTT     VV V  V V LMMV VV  VIV T         R V  V VLTTTT  LV    V
   203   94 H Y  E     -FI 147 221C   0  688    1    YYY  YYY     YY Y  Y Y YYYY YY  YYY Y         Y Y  Y YYYYYY  YY    Y
   204   95 H Y  E     -F  146   0C   7  688    4    YYY  YYY     YY Y  Y Y YYYY YY  YYY Y         Y Y  Y YYYYYY  YY    Y
   205   96 H b  E     -F  145   0C   0  688    1    CCC  CCC     CC C  C C CCCC CC  CCC C         C C  C CCCCCC  CC    C
   206   97 H V  E     -FJ 144 217C   0  688   23    AAS  AAT     AA A  T A AATA AT  AAA A         A A  T AAASAA  AA    A
   207   98 H R  E     -FJ 143 216C  21  687   40    rrT  ikk     kk a  t r krar rr  grr k         r r  t vrrrrr  tr    r
   208   99 H H  E     + J   0 214C   6  583   92    si.  pad     ra w  e t sael vl  lsr c         h w  r dtiins  sv    v
   209  100 H E  E  >  + J   0 213C  63  625   78    PT.  GIK     RD G  T G QKTP HK  TPQ G         P D  T DKRRLR  QH    H
   210  101 H Y  T >4 S-     0   0   80  658   93    TEG  GGG     PF T  G G GGGL IA  STP P         I Y  S IPEELE  CI    I
   211  102 H Y  T 34 S-     0   0  140  672   23    FFF  wWy     Ll l  y N YgfC FF  tFf W         Y Y  F sWFFFF  FF    F
   212  103 H Y  T 34 S+     0   0   39  265   92    ...  aAd     .s k  s . .es. N.  a.q .         . .  . d.....  .S    S
   213  104 H A  E <<  -J  209   0C   0  403   87    ...  SSC     .R G  G S .GD. F.  R.F N         . .  . G.....  .F    F
   214  105 H M  E     +J  208   0C   0  497   62    F..  III     .E I  W L FPK. F.  LFF L         . F  . FE..R.  .F    F
   215  106 H D  E     +     0   0C  19  615   50    AAP  ADD     .S D  Y D DSW. L.  SAD D         . E  E VD..E.  .L    L
   216  107 H Y  E     -J  207   0C  99  624   65    HYS  AAA     .L H  G V HCL. TS  PHV A         L L  Y YS..F.  QT    T
   217  108 H W  E     -J  206   0C  23  675    2    YWW  WWW     WW W  W W WWW. WW  WWF W         W L  W WWWWWW  WW    W
   218  109 H G        -     0   0    0  664   17    GGG  GGG     TA G  G G GAGE NS  VGG G         G G  G GA      TN    N
   219  110 H Q        -     0   0   91  659   46    QZP  RRR     QQ K  Q R QQRP AS  QQQ R         P P  Q QA      TA    A
   220  111 H G        -     0   0   16  650   16    GGG  GGG     DG G  G G GGGe NG  KGG G         G G  G GA      Kn    n
   221  112 H T  E     -I  203   0C  21  594   27    TTT  TTT     .S T  T V TFTt .G  .TT A         V .  T T.      Ss    s
   222  113 H T  E     -I  202   0C  72  593   76    LLL  SSS     .V Q  L L LP H .A  .LL S         E .  L Q.      VL    V
   223  114 H V  E     -I  201   0C   0  596   20    VVV  VVV     .L V  V V VL L .Q  .VV V         V .  V V.      IL    L
   224  115 H T  E     -e  120   0B  36  593   20    TTT  TTT     ST T  T T TK S .P  .TT T         V .  T T.      AQ    Q
   225  116 H V  E     +e  121   0B   6  572    6     VV  VVV     V  V  V V VL V .V  .   V         V .  V V.       I    I
   226  117 H S        -     0   0   36  566   11     S   SSS        S  S S SS W AA  .   S         S N  S S.             
   227  118 H S  S    S+     0   0   84  551   22     S   SSS        S  S S SA A SP  .   S         S P  S S.             
   228  119 H A  S    S+     0   0   70  123   53                         A  A R     .             A G     A             
   229  120 H W        -     0   0  123   73   63                              W     W             P H     W             
   230  121 H R        +     0   0  207   60   75                              R     P             K R                   
   231  122 H H              0   0  156   54   67                              Q     S             T                     
   232  123 H P              0   0  155   35   53                                    P             A                     
## ALIGNMENTS  491 -  560
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....0....:....1....:....2....:....3....:....4....:....5....:....6
     1    1 L D              0   0  183  420   16       DD DEEEEED DDQ  E DEEE   DEDE    E  N  DD  D DDDD     EEDDDDDDDD 
     2    2 L I        -     0   0   32  462   11       II IIIIIII III  I ILLL   IIII    I II III  I IIII     IIIIIIVVII 
     3    3 L E        -     0   0  117  463   68       MT QVVVVVQ QVV  V QTTV   QVVV    Q QV VQQ  Q TTTQ     VVVVQQQQQQ 
     4    4 L L  E     -K   25   0D  10  474    7       MM MLLLLLM MLL  M LLLM   LLML    M ML LMM  M MMMM     LLLLMMMMMM 
     5    5 L T  E     -K   24   0D  64  475    8       TT TTTTTTT TST  T TTTT   TTTT    T TT SST  T TTTT     TTTTTTIITT 
     6    6 L Q  E     -K   23   0D  13  475    0       QQ QQQQQQQ QQQ  Q QQQQ   QQQQ    Q QQ QQQ  Q QQQQ     QQQQQQQQQQ 
     7    7 L T  E    S+K   22   0D  64  475   34       SS SSSSSST SSS  S SSSS   SSSS    S SS SSS  S SSSP     SSSSSTSSST 
     8    8 L P        -     0   0   46  480    9       PL PPPPPPT PPP  P PPPP   PPPP    P PP PPP  P PPPT     PPPPPPPPPP 
     9    9 L V  S    S+     0   0   96  484   67       ST SGGGGGS SAA  A AGDA   SGDA    S SA ASS  F TSSS     GGAASSSSSS 
    10   10 L S  E     -n  104   0E  60  485   43       SS TTTTTTS SII  T ITTT   STTT    L SF SSS  F SSSS     TTSSSSSSSS 
    11   11 L L  E     -n  105   0E  58  489   21       LL LLLLLLL LLML L MLLL   LLLL    L LL LLL  L LLLL     LLLLLLLLLM 
    12   12 L S  E     +n  106   0E  60  490   42       PS SSSSSSS PSSS S SSSS   ASSS    S AA SSS  S SSLS     SSAASSSSSP 
    13   13 L A  E     -n  107   0E   0  490   58       VK VLLLLLA AAAA V ALLL   MLLL    A AK GAA  A KKVA     LLVVAAAAAA 
    14   14 L S    >   -     0   0   47  491   29       SS SSSSSSS SSSS S SSSS   SSSS    S SS SSS  S SSSS     SSSSSSSSSS 
    15   15 L V  T 3  S+     0   0   76  491   66       HQ VPPPPPL LPPP P PPPP   VPPP    P VQ PLL  V QQRQ     PPLLLLLLIL 
    16   16 L G  T 3  S+     0   0   42  491    4       GG GGGGGGG GGGG G GGGG   GGGG    G GG GRG  G GGGG     GGGGGGGGGG 
    17   17 L E    <   -     0   0   71  491   35       DE DEEEEEH DEEE E EEEE   QEEE    D DE EDD  D EEDD     EEQQEDDDEE 
    18   18 L T        -     0   0   69  491   62       RT RRRSRRR KKKK R KRRG   KRRR    R TT RTT  T TTRR     RRRRRRIIRR 
    19   19 L V  E     - L   0  75D  11  491   37       VV VAAAAAV VVVV A VAAA   VAAA    V VV VVV  V VVVV     AAAAVVVVVV 
    20   20 L T  E     - L   0  74D  67  490   30       NT TTTTTTT TTTT T TTTT   TTTT    T TT TTT  T TTTT     TTTTSSTTTT 
    21   21 L I  E     - L   0  73D   1  489   17       II ILLLLLI IMMM L MLLL   MLLL    I II III  I IIII     LLIILIMMII 
    22   22 L T  E     -KL   7  72D  29  489   58       TR TSSSSST STTT S TSSS   SSSS    T TN STS  T RRIT     SSSSTSTTTS 
    23   23 L a  E     -KL   6  71D   0  490    1       CC CCCCCCC CCCC C CCCC   CCCC    C CC CCC  Y CCFC     CCCCCCCCCC 
    24   24 L R  E     -KL   5  70D 110  490   45       RQ ERRRRRS RRRR R SRRR   KRRR    R KK KQQ  Q QQRR     RRRRRRQQQR 
    25   25 L A  E     -K    4   0D  10  490   29       AA AAAAAAA AAAA A AAAA   SAAA    A AA AAA  A AAAA     AAAAAAAAAA 
    26   26 L S  S    S+     0   0   66  490    4       SS SSSSSSS SSSS S SSSS   SSSS    S SS SSS  S SSSS     SASSSSSSSS 
    27   27 L E  S    S-     0   0  101  490   38       QQ QQQQQQQ QSSS Q SQQQ   QQQQ    Q EQ EQQ  K QQQQ     QLKKQQQQQQ 
    28   28 L N        +     0   0   83  490   45       NG TSSSSSD GSSS S SSSS   SSSS    N DS SGG  V GGGS     SLSSDDGGGG 
    29   29 L I    >   -     0   0    5  491   32       II VVVVVVI IVVV V VVVV   LVVV    A IV LII  I IIII     VSVVILTTII 
    30   30 L Y  T 3   -     0   0  155  491   81       NS LssSssS SSrS S SssG   lssS    N GS tSS  S SSSG     ssssGSSSSS 
    31   31 L S  T 3  S+     0   0   53  467   65       SN SssSssN S.s. S .ssS   nngN    K YS sSK  N NNNI     ggssSQIIKN 
    32   32 L Y    <   +     0   0   63  490   52       WY YYFNYYY TYYY N YYYY   YYYY    W GY YWY  Y YVYN     YYYYSYNNWY 
    33   33 L L  E     -O   90   0E   0  490    7       LL LLLLLLL LMLM L MLLL   LLLL    L LL LLL  L LLLL     LLMMLLLLLL 
    34   34 L A  E     -O   89   0E   0  490   71       AS NAAAAAN HHHH A NAAA   AAAA    T NA NAN  A NSHA     GAHHNFNNAN 
    35   35 L W  E     -OP  88  48E   1  491    0       WW WWWWWWW WWWW W WWWW   WWWW    W WW WWW  W WWWW     WWWWWWWWWW 
    36   36 L Y  E     -OP  87  46E   0  491    9       FY YYYYYYY YYYY Y YYYY   YYYY    Y YY YYY  Y YYYY     YYYYLYFFYY 
    37   37 L Q  E     -OP  86  45E   7  491   28       QQ QQQQQQQ QQQQ Q QQQQ   QQQQ    Q QQ QQQ  Q QQQQ     QQQQQQQQQQ 
    38   38 L Q  E     -O   85   0E  21  491    4       QQ QQQQQQQ QQQQ Q QQQQ   QQQQ    Q QQ QQQ  Q QQQQ     QQQQQQQQQQ 
    39   39 L K    >   -     0   0   51  490    9       KK KKKKKKK KKKK K KKKK   KRKK    K KK KKK  K KKKK     KKKKEKKKKK 
    40   40 L Q  T 3  S+     0   0  190  491   19       PP PPPRPPP PPPP P SPPP   PPPP    P LP HPP  P PPAP     PPPPPPPPPP 
    41   41 L G  T 3  S+     0   0   86  491   10       GG GGGGGGD GGGG G GGGG   GGGG    G GG GGG  G GGGG     GGGGDGGGGD 
    42   42 L K  S <  S-     0   0  126  490   54       QQ KQQQQQG KSSS Q TQQQ   QQQQ    K IQ QKK  K QQQQ     QQQQGQKKKG 
    43   43 L S        -     0   0   21  490   55       AA AAASAAT SSSS A SAAA   SAAA    P AA ASS  S AAAA     AAPPTPAAAT 
    44   44 L P        -     0   0    4  490   11       PP PPPPPPV PPPP P PPPP   PPPP    P PP PPP  P PPPP     PPPPIPPPPI 
    45   45 L Q  E     -P   37   0E  74  490   32       KK KRRRRRK KKKK R KRRR   KRRR    K KK RKK  T KKKK     RRKKKKKKKK 
    46   46 L F  E     +P   36   0E  25  490   42       LL LLLLLLL LPLP L RLLL   LLLL    P LR LLL  F LPCL     LLLLRLLLLP 
    47   47 L L  E     +     0   0E   4  490    9       LL LLLLLLL LWWW L WLLL   LLLL    R LL LLL  L LLLL     LLLLLLLLLL 
    48   48 L V  E     -PQ  35  54E   0  491    5       II IIIIIII IIII I IIII   LIII    I II III  I IIII     IMIIIIIIII 
    49   49 L Y  E >> S+ Q   0  53E  39  491   17       YY YYYRYYY YYYY Y YYYY   YYYY    Y YS YYY  Y YYYY     YYYYYYYYDY 
    50   50 L N  T 34 S-     0   0   52  491   91       SD AGVDGGY GASA C DGGG   FGGD    E GG WAY  G YYGH     GGLLARGGEY 
    51   51 L A  T 34 S+     0   0    3  491   45       AT AAAAAAT ATTT A TAAA   AAAT    A AA AAT  A TTAA     AAAATVAAAT 
    52   52 L K  T <4 S+     0   0  148  491   25       SN SSSSSSS SSSS S SSSS   SSSS    S NS NSS  T NNSN     SSSSSSSSSS 
    53   53 L T  E  <  -Q   49   0E  47  491   67       NC SSSSSSR SNNN T KSSS   TSSY    K TN KNN  N SRNS     SSNNSRINKN 
    54   54 L L  E     -Q   48   0E  60  491   60       LL LRRRRRL LLLL R LRRR   RRRR    L LR LLL  L LLLL     RRLLLLLLLL 
    55   55 L G    >   -     0   0    9  490   71       QQ EAAAAAH QAAA A AAAA   EAAA    Q EN AQE  Y QHQE     AAEEDTEEHQ 
    56   56 L E  T 3  S+     0   0  192  490   35       PS TTTNTTS TSSS T STTT   STTT    T SS SST  T SSPS     TTSSSNDDTS 
    57   57 L G  T 3  S+     0   0   70  491    5       GG GGGGGGG GGGG G GGGG   GGGG    G GG GGG  G GGGG     GGGGGGGGGG 
    58   58 L V    <   -     0   0   25  489   11       VV VIIIIIV VVVV I VIII   VIII    V VV VVV  V VVVV     IIVVVVVVVV 
    59   59 L P    >   -     0   0   47  490    7       PP PPPPPPP PPPP P PPPP   PPPP    P PP PPP  P PPPP     PPPPPPPPPP 
    60   60 L S  T 3  S+     0   0  115  491   57       SS SDDDDDS SAVA A ADDD   DDDA    S SD ASS  S SSLS     DDAAKDSSSS 
    61   61 L R  T 3  S+     0   0   44  491    4       RR RRRRRRR RRRR R RRRR   RRRR    R RR RRR  Q RRRR     RRRRRRRRRR 
    62   62 L F  E <   +M   75   0D   5  491    1       FF FFFFFFF FFFF F FFFF   FLFF    F FF FFF  F FFFF     FFFFFFFFFF 
    63   63 L S  E     -M   74   0D  55  490   22       SS SSSSSSS SSSS S TSSS   ISSS    S SS SRS  S SSSS     SSSSSSSSSS 
    64   64 L G  E     +M   73   0D  13  491    2       GG GGGGGGG GGGG G GGGG   GGGG    G GG GGG  G GGGG     GGGGGGGGGG 
    65   65 L S  E     +M   72   0D  63  491    5       SS QSSSSSS SSSS S SSSS   SSSS    S SS SSS  S SSSS     SSSSSSSSSS 
    66   66 L G  E     -M   71   0D  36  491   14       GG GGGGGGG GGGG G GGGG   GGGG    G GG GGG  G GGGG     GGGGRGRRGG 
    67   67 L S  E >   +M   70   0D  79  491    9       SS SSSSSSS SSSS S SSSS   SSSS    S SS SSS  S SSSS     SSSSSSYYSS 
    68   68 L G  T 3  S-     0   0   16  491   13       GG GGGGGGA GGGG G GGGG   GGGG    G EG GGG  G GGGG     GGGGGGGGGG 
    69   69 L T  T 3  S+     0   0   67  488   13       TT TTTTTTT TTTT T TTTT   TTTT    T TT TKT  A TTTT     TTTTSTTTTT 
    70   70 L Q  E <   +LM  24  67D 110  489   27       DD BDDDDDD DSSS E SDDD   DDDD    D DD DDD  D DDDD     DDDDDDDDED 
    71   71 L F  E     -LM  23  66D   2  491    6       YY FFFFFFY FYYY F YFFF   FFFF    F YF FFY  Y YYFF     FFFFYFFFFY 
    72   72 L S  E     -LM  22  65D  26  491   30       SS TTTTTTS TSSS T STTT   ATTT    T TT TTS  S SSTT     TTTTSTTTTS 
    73   73 L L  E     -LM  21  64D   0  491    2       LL FLLLLLL LLLL L LLLL   LLLL    L LF LLL  L LLLL     LLLLLLLLLL 
    74   74 L K  E     -LM  20  63D  97  491   39       TT TTTITTT TTTT T TTTT   TTTT    T TT TTT  T TTTT     TTNNTTTTTT 
    75   75 L I  E     -LM  19  62D   0  491    1       II IIIIIII IIII I IIII   IIII    I II III  I IIIF     IIIIIIIIII 
    76   76 L N  S    S-     0   0   86  491   30       SS SSSSSST NSSS S SSSS   RNSS    S SS SSS  S SRSS     SSHHSDSSSS 
    77   77 L S  S    S-     0   0   58  491   62       SS SRRRRRN NRSR S NRRR   SRRS    S SN SGG  S SSSS     RRPPSPSSSS 
    78   78 L L        -     0   0    0  491   27       LL VLLLLLL LVVV L MLLL   VLLL    L VL LLL  L LLLL     LLVVLMLLLL 
    79   79 L L    >   -     0   0   67  491   31       EE ZEEEEEQ EEEE Q EEEE   QEEE    E QQ EQQ  E EEEE     EEEEEEEEEE 
    80   80 L P  G >  S+     0   0   92  491   58       PP PPPPPPQ AAAA F APPP   APPP    P AP PAA  L PPPP     PPEESEDDSP 
    81   81 L E  G 3  S+     0   0  102  491   13       EE ZDEEEEE EEEE E EEEE   EEEE    E EE EEE  E EEEE     EEEEEDEEDE 
    82   82 L D  G <  S+     0   0    1  491    5       DD BDDDDDD DDDD D DDDD   DDDD    D DD DDD  D DDYD     DDDDDDDDDD 
    83   83 L F    <   +     0   0   29  490   72       VI FFFFFFX VAAA F AFFF   LFFF    A AA AFV  F FVAA     FFAAFTMMFF 
    84   84 L G  E    S- R   0 105E  17  491   23       AA AAAAAAA GAAA A AAAA   AAAA    G GA AAA  A AAAA     AAAVVAAAGA 
    85   85 L S  E     -OR  38 104E  24  491   63       ND TVVVVVT ITTT V TVVV   DVVV    T IV HTD  T TTTT     VVTTDTTTDM 
    86   86 L Y  E     -OR  37 103E   0  491    0       YY YYYYYYY YYYY Y YYYY   YYYY    Y YY YYY  Y YYYY     YYYYYYYYYY 
    87   87 L Y  E     -O   36   0E   5  490    4       YY YYYYYYX FYYY Y YYYY   FFYY    Y YY YYF  H YFYY     YYYYYFFFYY 
    88   88 L a  E     -O   35   0E   0  491    0       CC CCCCCCC CCCC C CCCC   CCCC    C CC CCC  C CCCC     CCCCCCCCCC 
    89   89 L Q  E     -OS  34  99E   0  489   48       VL QQQQQQQ QQQQ Q QQQQ   QQQQ    H QQ QQQ  K QVQQ     QQQQLQLLQQ 
    90   90 L H  E     -O   33   0E  22  483   26       QQ ZQQQQQQ QQQQ H QQQQ   QQQH    Q QQ QQQ  Q QQQQ     QQHHQQQQKQ 
    91   91 L H        +     0   0    0  421   89       GS ...YYYG G.YW . WYYY   H.Y.    Y GG SYH  E GSGY     ..SSYSHHYY 
    92   92 L Y  S    S+     0   0  104  454   88       WY YYYSGGN YWDS Y SGGG   YYDR    N YY YNN  L IYNY     YYRRARSSDD 
    93   93 L G  S    S-     0   0   34  422   71       SN LGGTTS. SSSS N SSSS   TGTS    S SN DSS  S SSSN     GG..S.YYNS 
    94   94 L T  S    S-     0   0  104  446   88       FY DSSSSST TSSK N NSSS   TTSN    N TN SWS  Y FSTS     SSEESLLLTS 
    95   95 L P  S    S+     0   0    7  443   51       PP LSSPPPL PNPY W PRPP   PSPW    P PP SPP  P PPPP     LSLLPIPPPP 
    96   96 L P  S    S-     0   0   55  421   75       PP PPPYRWP RPSM P PGTG   WPAP    P PP PPP  P PPsP     GPPPWPYYCP 
    97   97 L L        -     0   0   21  160   88       TT RQS...Y .PIY F .Y..   .RWI    . .. ...  T .Tm.     RRRP.R.... 
    98   98 L T        -     0   0   40  288   41       VV TTTTTTT .TTT T TTTT   TPTT    . .T TT.  V TVT.     TSTTTTTT.. 
    99   99 L F  B     -S   89   0E  18  290   29       II FFFFFFF .FFF F FFFF   FFFF    . .  VV.  L MI .     FFFFFFFF.. 
   100  100 L G        -     0   0    3  294   39       QQ GGGGGGG .GGG G GGGG   DGGG    . .  FL.  Q TQ .     GGGGGGGG.. 
   101  101 L G        -     0   0   52  307   63       AA QQQQQQG .GAG P GQQQ   GQQQ    . .  QQ.  Q QA .     QQGGGGGG.. 
   102  102 L G        -     0   0   11  306   43       MM GGGGGGG .GGG G GGGG   GGGG    . .  GG.  N GM .     GGGGGGGG.. 
   103  103 L T  E     - R   0  86E   0  366   18       TT TSTTTTT TTTT T TTTT   TTTT    T .  TGT  S ST T     TTTTTTTTMT 
   104  104 L K  E     -nR  10  85E  98  363   58       KK KKKKKKK VKKK K KKKK   KRKR    V T  EQV  N RK V     KKKKKKKKV  
   105  105 L L  E     -nR  11  84E   4  343   37          VVVLVVL LLLL V LLVV   LLVL    L V  LVL  Y I  I     VVLLLLLLL  
   106  106 L E  E     -n   12   0E 108  326   51          DEEEEEX QEEE D EEEE   EEED    Q Q   TQ  E G  Q     EEEEEEEEQ  
   107  107 L I  E      n   13   0E 113  301   50          LILIIII AILI I IIII   IIII          LV  L V  P     IIIIIIIIA  
   108  108 L K              0   0  145  268   18          KKKKKKK QKKK K KKKK   KKKK          K     Q  K     KKKKKKKKR  
   109      ! !              0   0    0   0     0  
   110    1 H E              0   0  194  408   30  EEEED          E      Q    QQQ    DDDQ E  E   DD E        D           
   111    2 H V        +     0   0   19  465   12  VVVVV  V       E      V    VVV    VVIV V  V   II V    VVVVI          V
   112    3 H K  E     -A  134   0A 111  467   31  QQQQQ  Q       K      Q    QQQ    QQQQ Q  K   PP Q    QQQQQ          Q
   113    4 H L  E     -A  133   0A   3  489    1  LLLLL  L       L      L    LLL    LLLL L  L   LL L    LLLLL          L
   114    5 H Q  E     -A  132   0A  83  493   70  VVVLV  V       V      Q    QQQ    VVVV V  V   VV V    VVVVV          V
   115    6 H E  E     +A  131   0A   5  498   21  EEEEE  E       E      E    EQE    EEEQ E  E   EE E    EEEEE          E
   116    7 H S  E     +A  130   0A  69  501   13  SSSSS  S       S      S    SSS    SSSS S  S   SS S    SSSSS          S
   117    8 H G        +     0   0   36  505    4  GGGGG  G       G      G    GGG    GGGG G  G   GG G    GGGGG          G
   118    9 H G        +     0   0   29  672   48  GGGGG  G       G      G    GGG    GGGG G  G   GG G    GGGGG          G
   119   10 H D        -     0   0   96  677   40  GGGGG  G       G      G    GGG    DDDG G  D   DV A    GGGGD          G
   120   11 H L  E     +e  224   0B  79  675   16  LLLLL  L       L      L    LLL    LVVV L  L   LV L    LLLLV          L
   121   12 H V  E     -e  225   0B  16  677   33  AVVVV  Q       V      V    VVV    RRRV V  R   RR V    QQQQR          V
   122   13 H Q    >   -     0   0  114  679   51  KQQQK  Q       Q      Q    QQQ    QQQQ P  Q   QQ Q    QQQQQ          Q
   123   14 H P  T 3  S+     0   0   66  678    9  PPPPP  P       P      A    ATA    PPPP P  P   PP P    PPPPP          P
   124   15 H G  T 3  S+     0   0   58  682   32  GGGGG  G       G      G    GGG    GGGG G  G   GG G    GGGGG          G
   125   16 H G    <   -     0   0   25  684   63  ASGGG  G       G      G    GGD    GGGR G  G   GG G    GGGGG          R
   126   17 H S        +     0   0   78  683   31  F.SSS  S       S      S    SSS    SSSS S  S   SS S    SSSSS          S
   127   18 H L  E     - B   0 192A  25  685   25  LLLLL  L       L    L L    LLL    LLLL L  L   LL G    LLLPL          L
   128   19 H K  E     - B   0 191A  93  683   56  RRRRR  R       R    R R    RRR    RKKR R  R   KK R    RRRRK          R
   129   20 H L  E     - B   0 190A   0  688   14  LLLLL  L       L    L L    LLL    LLLL L  L   LL L    LLLLL          L
   130   21 H S  E     -AB 116 189A  28  688   37  TFSSS  S       S    S S    SSS    SSSS P  S   SS S    SSSSS          S
   131   22 H b  E     -AB 115 188A   0  688    0  CCCCC  C       C    C C    CCC    CCCC C  C   CC C    CCCCC          C
   132   23 H A  E     -AB 114 187A  52  688   66  AAAAA  K       V    A E    AAA    KKKV A  V   KK A    KKKKK          T
   133   24 H A  E     +A  113   0A   8  688   49  AAAAA  G       G    A A    AAA    AAAA A  A   AA A    GAGGA          A
   134   25 H S  E     +A  112   0A  58  688   12  SSSSS  T       S    S S    SSS    SSSS S  S   SS S    TTTTS          P
   135   26 H G  S    S+     0   0   56  688    4  GGGGG  G       G    G G    ggg    gGGG G  G   GG G    GGGGG          G
   136   27 H F  S    S-     0   0   33  686   34  FFFFF  F       F    F N    hhh    fFFF F  F   FF F    FFFFF          F
   137   28 H T    >   -     0   0   93  687   50  TTTTT  T       T    T V    GGG    STTT T  T   TT T    DTDTT          T
   138   29 H F  G >  S+     0   0    2  688   41  FFFFF  L       F    F D    YYY    SFFF F  F   FF F    FFFFF          F
   139   30 H S  G 3  S+     0   0   57  688   55  SSSSS  T       N    S R    GGG    SSSS S  K   TS S    SSSSS          G
   140   31 H S  G <  S+     0   0   71  688   60  DSTRT  S       S    N I    GGG    NSST G  D   SS T    DSDSS          D
   141   32 H Y  S <  S-     0   0   44  688   41  YSSVA  A       T    Y D    YYY    YYYY Y  A   YY T    FFFLY          Y
   142   33 H T        -     0   0   30  688   91  WEALW  M       Y    A A    GGG    GYEA W  A   GD S    DRDSY          A
   143   34 H M  E     -FG 207 160C   0  672   46  MMVSM  T       I    I M    MMM    MMMM I  M   MM R    MMMMM          M
   144   35 H S  E     -FG 206 159C   0  685   73  SNYSK  .       N    T G    GGG    SSNH S  S   NH F    TETQS          S
   145   36 H W  E     +FG 205 158C   0  688    0  WWWWW  W       W    W W    WWW    WWWW W  W   WW W    WWWWW          W
   146   37 H V  E     -FG 204 156C   0  688   19  VVVVV  V       V    V F    FFF    VVVV A  F   IV V    VVVVV          V
   147   38 H R  E     -FG 203 155C  10  688   17  HRRRR  R       R    R R    RRR    RRRR R  R   RR R    RRRRR          R
   148   39 H Q  E     -FG 202 154C   9  688    3  QQQQQ  Q       Q    Q Q    QQQ    QQQQ Q  Q   QQ Q    QQQQQ          Q
   149   40 H T    >   -     0   0    9  688   68  AAAAA  A       A    A A    VVI    AAAA A  A   AA A    AAAAA          A
   150   41 H P  T 3  S+     0   0   80  687   10  PPPPP  P       P    P P    PPP    PPPP P  S   PP P    APAPP          P
   151   42 H E  T 3  S-     0   0  151  688   26  GGGGG  G       G    G G    GGG    GGGG G  G   GG G    GGGGG          G
   152   43 H K    <   +     0   0  121  688   32  KKKKK  K       K    K K    KKK    KKKR K  K   KK K    KKKKK          K
   153   44 H R        -     0   0  113  687   43  GGGGG  G       G    G Q    EEE    GGGG K  G   GG G    GGGGG          G
   154   45 H L  E     -G  148   0C   9  688   14  LLLLL  L       L    L R    RRR    LLLL L  P   LL L    LLLLL          L
   155   46 H E  E     -G  147   0C  44  687    5  EEEEE  E       E    E E    EEE    EEEE E  Q   EE E    EAEEE          E
   156   47 H W  E     +G  146   0C  15  687   11  WWWWW  W       W    W F    LLL    WWWW W  W   WW W    YPYWW          W
   157   48 H V  E     -     0   0C   0  687   28  VVVVV  V       L    V V    VVV    VVLV V  V   VV V    VVVIV          V
   158   49 H A  E     -G  145   0C   0  688   38  GSGSV  A       A    S G    AAA    ASSA S  S   SS E    AAAAS          G
   159   50 H S  E     -GH 144 168C   0  688   94  QVWgw  S       G    S Y    AAA    ILNV D  S   YA F    GVGER          F
   160   51 H I  E     -GH 143 167C   4  675   18  II.lv  I       I    I I    III    IIII I  I   II .    III.I          I
   161   52 H N    >   -     0   0   47  682   84  NSRNE  D       A    N S    RRR    YDNS S  T   NS R    NEQ.D          R
   162   53 H N  T 3  S+     0   0   65  684   88  PTYAQ  Y       R    A E    WWW    TTGY G  G   GN V    RKRTT          S
   163   54 H G  T 3  S-     0   0   65  686   68  NDESV  R       G    T G    SSS    SGPD D  D   AD Q    HDDTA          K
   164   55 H G  S <  S+     0   0   30  687   43  GGGSV  N       S    S G    GGG    QSGG S  S   GG G    GGGGG          A
   165   56 H G  S    S+     0   0   74  688   63  GRsNE  N       y    G I    TIR    ASSN S  S   SS s    NRNdS          y
   166   57 H R        +     0   0  163  505   86  STl..  .       s    T .    SSN    ..SY I  N   SG i    DMDkS          t
   167   58 H T  E     -H  160   0C  62  677   52  TTTLK  A       S    T L    TTT    .TTK T  I   TT S    PTPTT          T
   168   59 H Y  E     +H  159   0C  53  686   85  YYHHA  W       Y    D N    YYY    YSYY Y  Y   SY H    DWDWS          E
   169   60 H Y        -     0   0   44  688    9  FYYFF  Y       Y    Y Y    YYY    YYYY Y  Y   YY Y    YYYYY          Y
   170   61 H P    >>  -     0   0   20  688   65  TAAAA  A       A    A G    AAA    AAAA A  T   AA A    AAAAA          A
   171   62 H D  T 34 S+     0   0  148  688   64  DDVVN  S       D    D D    DDD    DDDD A  D   DD D    DPDPD          A
   172   63 H T  T 34 S+     0   0   90  688   57  SSSSS  S       S    S F    SSS    SSSS S  S   SS S    AAASS          S
   173   64 H V  T X> S+     0   0    1  688   42  VVVAV  V       V    V V    VVV    VVVV V  V   VV V    LVVVV          V
   174   65 H K  B 3< S+c  177   0A 142  687   31  KKQQN  Q       K    K K    KKK    KKKK K  K   KK Q    EEQEK          K
   175   66 H G  T 34 S+     0   0   74  687   36  GGGGG  G       G    G G    GGG    GGGG G  G   GG A    GGGGG          G
   176   67 H R  T <4 S+     0   0   36  688   17  WRRRR  R       R    R R    RRR    RRRR R  R   RR R    RRRRR          R
   177   68 H F  E  <  -cD 174 192A   2  688   60  SFFFF  F       F    F F    FFF    FFFF F  F   FF F    FFFFF          F
   178   69 H T  E     - D   0 191A  79  688   38  TTTTT  T       T    T T    TTT    TTTS T  T   TT T    TTTTT          T
   179   70 H I  E     + D   0 190A   5  688   20  IIIII  I       I    I I    III    IIII I  T   II I    IIIII          I
   180   71 H S  E     - D   0 189A  51  684   41  SSSSS  S       S    S S    SSS    SSSS S  S   SS S    SSSSS          S
   181   72 H R  E     - D   0 188A  30  687   60  RRRRR  R       R    R R    RRR    KRRR R  R   RR R    RRRRR          R
   182   73 H D  E > > - D   0 187A  60  686    7  DDNNN  D       D    D D    DDD    DDDD D  D   DD N    DDDDD          D
   183   74 H N  G > 5S+     0   0   48  688   57  NNDDD  N       N    N N    NNN    NNNN N  N   NN D    NDNNN          D
   184   75 H A  G 3 5S+     0   0   99  688   45  AASSS  G       S    S A    VVV    AGGS A  A   GG S    GGGGG          S
   185   76 H K  G < 5S-     0   0  111  688   51  KKKKK  Q       R    K K    KKK    NNNN K  K   NN K    QQQQN          K
   186   77 H N  T < 5 +     0   0   62  688   46  NNNNN  S       N    N N    NND    SSSN N  N   SS N    SSSSS          S
   187   78 H T  E   < -BD 132 182A  16  688   69  TSTTT  T       T    T T    MMM    LLLT T  T   LL T    TMTTL          I
   188   79 H L  E     -BD 131 181A   0  687   56  LLLLL  L       D    L V    VVL    VLLL L  L   LL L    VVVLL          A
   189   80 H Y  E     -BD 130 180A  41  687   46  YYYYY  Y       Y    Y Y    YYY    NHHH Y  Y   HH Y    YYYYH          Y
   190   81 H L  E     -BD 129 179A   0  687    7  LLLLL  L       L    L L    LLL    LLLL L  L   LL L    LLLLL          L
   191   82 H Q  E     -BD 128 178A  76  687   41  QQQQQ  Q       Q    Q Q    QQQ    QQQE Q  Q   QQ Q    QQQQQ          Q
   192   83 H M  E     +BD 127 177A   0  688   11  MMMMM  M       M    M M    MMM    MMMM M  M   MM M    MMMMM          M
   193   84 H S        +     0   0   42  688   54  NNLLI  N       N    N S    NDN    NNNN N  D   NN N    NNNNN          N
   194   85 H S  S    S-     0   0   68  687   24  SSSSS  D       S    S N    SSS    SSST S  R   SS T    SSSSS          S
   195   86 H L        -     0   0    3  686   18  LLLLV  L       L    L L    LLL    LLLL L  L   LL G    LLLLL          L
   196   87 H K    >   -     0   0  102  686   68  KREQT  K       R    R K    KKK    KKKR R  T   KK E    KKKKK          K
   197   88 H S  G >  S+     0   0   70  686   60  TAPAP  A       T    A S    PPP    TAAT A  Q   AA A    AAAAA          T
   198   89 H E  G 3  S+     0   0  126  687   22  EEZZZ  E       E    E E    EEE    EEEE E  E   EE Z    EEEEE          E
   199   90 H D  G <   +     0   0    2  687    3  DDBBB  D       D    D D    DDD    DDDD D  D   DD B    DDDDD          D
   200   91 H T    <   +     0   0   32  688   28  TTTTT  T       T    T T    TTT    TTTT T  T   TT T    TTTTT          T
   201   92 H A  E    S- I   0 223C   8  686    5  AAAAA  A       A    A G    AAA    AAAA A  A   AA A    AAAGA          A
   202   93 H M  E     -FI 148 222C  58  687   48  VVVLV  T       R    V V    VVV    LTTL L  L   MT V    TTTTT          V
   203   94 H Y  E     -FI 147 221C   0  688    1  YYYYY  Y       Y    Y Y    YYY    YYYY Y  Y   YY Y    YYYYY          Y
   204   95 H Y  E     -F  146   0C   7  688    4  YYYYY  Y       Y    Y F    HYT    YYYY Y  Y   YY Y    YYYYY          Y
   205   96 H b  E     -F  145   0C   0  688    1  CCCCC  R       C    C C    CCC    CCCC C  C   CC C    CCCCC          C
   206   97 H V  E     -FJ 144 217C   0  688   23  TAAAA  A       A    A A    AAA    AAAA A  A   AA A    AATAA          T
   207   98 H R  E     -FJ 143 216C  21  687   40  kerrR  k       r    r a    aav    rgrk k  i   rr r    rkrkr          r
   208   99 H H  E     + J   0 214C   6  583   92  hhsa.  g       d    l w    ppp    tsss q  e   ss g    gtggi          e
   209  100 H E  E  >  + J   0 213C  63  625   78  EPLVV  G       Q    L G    VVV    KRRQ T  S   RR G    SDSGR          N
   210  101 H Y  T >4 S-     0   0   80  658   93  FGTAV  Y       Y    I T    GGG    PEEG S  Q   EE Y    TSTCE          W
   211  102 H Y  T 34 S-     0   0  140  672   23  FFFFv  i       Y    F l    FFF    WFFY Y  F   FF F    yIywF          F
   212  103 H Y  T 34 S+     0   0   39  265   92  ....t  n       Y    . k    ...    .... .  .   .. .    s.ss.          .
   213  104 H A  E <<  -J  209   0C   0  403   87  S...S  S       A    T G    ...    .... .  .   .. .    F.FK.          .
   214  105 H M  E     +J  208   0C   0  497   62  L.S.M  I       L    G I    ...    E..F .  .   .. S    I.IV.          .
   215  106 H D  E     +     0   0C  19  615   50  S.ADD  D       D    D E    AAA    D..D .  .   .. D    DDDD.          D
   216  107 H Y  E     -J  207   0C  99  624   65  S.VVV  A       L    Y H    YYY    S..P .  N   .. V    AAAA.          P
   217  108 H W  E     -J  206   0C  23  675    2  WWWWW  W       W    W W    WWW    WWWW W  W   WW W    WWWWW          W
   218  109 H G        -     0   0    0  664   17  CGGGG  G       G    G G    GGG    A  G G  T      G    GGGG           G
   219  110 H Q        -     0   0   91  659   46  ARQQQ  R       P    Q K    QQQ    A  Q K  T      Q    RRRR           Q
   220  111 H G        -     0   0   16  650   16  GGGGG  G       G    G G    GGG    A  G K  K      G    GGGG           G
   221  112 H T  E     -I  203   0C  21  594   27  ..TTT  T       V    . T    TTT    .  T .  T      T    TTTT           T
   222  113 H T  E     -I  202   0C  72  593   76  ..LKP  S       E    . Q    QQQ    .  L .  V      L    SSSS           L
   223  114 H V  E     -I  201   0C   0  596   20  ..VVV  V       V    . V    VVV    .  V .  I      V    VVVV           V
   224  115 H T  E     -e  120   0B  36  593   20  ..TST  T       V    . T    TTT    .  T .  A      S    TTTT           T
   225  116 H V  E     +e  121   0B   6  572    6  A.     V       V    . V    VVV    .  V .              VVVV           V
   226  117 H S        -     0   0   36  566   11  S.     S       S    N S    SSS    .  S .              SSSS           S
   227  118 H S  S    S+     0   0   84  551   22  A.     S       S    P S    SSS    .  S .              SSSS           S
   228  119 H A  S    S+     0   0   70  123   53  G.             A    G             A    V                              
   229  120 H W        -     0   0  123   73   63   W             P    H             W    R                              
   230  121 H R        +     0   0  207   60   75   S             K    R                  R                              
   231  122 H H              0   0  156   54   67                 T                       Q                              
   232  123 H P              0   0  155   35   53                 A                                                      
## ALIGNMENTS  561 -  630
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....7....:....8....:....9....:....0....:....1....:....2....:....3
     1    1 L D              0   0  183  420   16  QD  EQDD     DD  D    D D  D   DDD D DDEEDDDDDQD D DD E D D  Q E  DD  
     2    2 L I        -     0   0   32  462   11  II  NIII     II II    V IIIII  III I IVIIIIIVIII I II I V V  I VVIII  
     3    3 L E        -     0   0  117  463   68  AV  VVVQ     VV ME    V VVVQQ  TMK A VVVVVVVQTVV V QV I L V  V VEVVQ  
     4    4 L L  E     -K   25   0D  10  474    7  LL  LLLM     MM LL    MMLLLMM  MMM M MMLMLLMMMLL L ML L M M  L MMLLL  
     5    5 L T  E     -K   24   0D  64  475    8  SS  TTTT     SS TT    TTTTTTT  TTT T TTTTTTTITTT T TT T T S  T TTTTT  
     6    6 L Q  E     -K   23   0D  13  475    0  QQ  QQQQ     QQ QQ    QQQQQQQ  QQQ Q QQQQQQQQQQQ Q QQ Q Q Q  Q QQQQQ  
     7    7 L T  E    S+K   22   0D  64  475   34  SS  SSSS     SS SS    TTSSSSS  SSS T TTSSSSSSSSS S SS S T S  S TTSSS  
     8    8 L P        -     0   0   46  480    9  PP  PPPP     PP P.    PPPPPPP  PPP P PPPPPPPPPPP P PP P P P  P PPPPP  
     9    9 L V  S    S+     0   0   96  484   67  AA  AAAST A  SS AP    SAAAASS  SSS E AAGAAADSGAA A SA A V S  D ASAAS  
    10   10 L S  E     -n  104   0E  60  485   43  II  IISST T  SF SA    SSSSSSS  SSS S SSTTSSSSSIS I SS T S F  Y SPSFI  
    11   11 L L  E     -n  105   0E  58  489   21  LL  MMLLM L  LL LL    KVLLLLL  LLL L VVLLLLLLLLL M LL L L L  V VVLLL  
    12   12 L S  E     +n  106   0E  60  490   42  SS  SSASA S  AA SA    SEASSSS  SPP A SSSSAAASASA S SP S S A  S SSSSY  
    13   13 L A  E     -n  107   0E   0  490   58  AA  AAVAA V  VV RV    AVKRRAA  VVV V EELVVVVAVAV A AM V V V  V EAGAA  
    14   14 L S    >   -     0   0   47  491   29  SS  SSSSS T  SS SS    AASSSSS  SSS S PPSSSSSSSFS S SS S S S  S PASSS  
    15   15 L V  T 3  S+     0   0   76  491   66  PP  PPLVP P  VV AP    VVQPPVL  PHR P VVPPLLLLPPL P LL P L V  P VVPPP  
    16   16 L G  T 3  S+     0   0   42  491    4  GG  GGGGG G  GG GG    GGGGGGG  GGG G GGGGGGGGGGG G GG G G G  G GGGGG  
    17   17 L E    <   -     0   0   71  491   35  EE  EEQDE D  EE EE    DGEEEDD  DDD D GGEEQQEDQEQ E QQ E D E  E GGEDD  
    18   18 L T        -     0   0   69  491   62  KK  KKRRK R  KK TR    TTTRRRT  RRR R TTRRRRRIRKR K RR R Q K  T TTRRK  
    19   19 L V  E     - L   0  75D  11  491   37  VV  VVAVI V  VV VV    VVVVVVV  VVV V VVAAAAAVVVA V VA A A V  A VVVVI  
    20   20 L T  E     - L   0  74D  67  490   30  TT  TTTTT S  TT TT    TTTTTPT  TTI T TTTTTTTTTTT T ST T S T  T TTTTT  
    21   21 L I  E     - L   0  73D   1  489   17  MM  MMIFI L  MM II    IIIIISI  ILI I IILLIIIMIMI I LI L I M  L IIIII  
    22   22 L T  E     -KL   7  72D  29  489   58  TT  TTSIT S  SS SS    KKNSSPR  TTT N KKSSSSNTNTS T TS S S S  T KNSNT  
    23   23 L a  E     -KL   6  71D   0  490    1  CC  CCCCC C  CC CC    CCCCCGC  CCC C CCCCCCCCCCC C CC C C C  C CCCCC  
    24   24 L R  E     -KL   5  70D 110  490   45  RR  SSRQS R  KK RR    QQKKKHQ  RRR K QQRRRRKQRRR N RK R R K  K QQKKR  
    25   25 L A  E     -K    4   0D  10  490   29  AA  AAAAA A  SS AA    AAAAAAA  AAA A TAAAAASAAAA A AA A S S  A AAAAA  
    26   26 L S  S    S+     0   0   66  490    4  SS  SSSSS S  SS TS    SSSSSSS  SSS S SSSSSSSSSSS S SS S S S  S SSSSS  
    27   27 L E  S    S-     0   0  101  490   38  SS  SSKQS Q  QQ ED    QEQQQEQ  QEQ S QQQQKKQQQSK S QQ Q Q Q  S QEQEQ  
    28   28 L N        +     0   0   83  490   45  SS  SSSDS S  SS SS    SDSSSGG  SGD S SSSSSSSGSSS S DS S S S  S SDSSG  
    29   29 L I    >   -     0   0    5  491   32  VV  VIVII I  LL LV    IIVVVII  III L IIVVVVITVVV V IL V I L  V IILII  
    30   30 L Y  T 3   -     0   0  155  491   81  SN  SSsAs S  ll tS    SYSssSN  NSG t DYsSsslNSSs S Gd S v l  S SYntS  
    31   31 L S  T 3  S+     0   0   53  467   65  ..  ..sNn D  nn qT    SSSssSN  SSS d DSsNssnIN.n . Is T t n  N SSsdS  
    32   32 L Y    <   +     0   0   63  490   52  YY  YYYHY Y  YY NL    YLYYYWE  WYY Y YNYNYYYNYYY Y NY N Y Y  W YLYFY  
    33   33 L L  E     -O   90   0E   0  490    7  MM  MMMLL L  LL LM    LLLLLLL  LLL L LLLLMMLLVMM M LM L L L  L LLLLL  
    34   34 L A  E     -O   89   0E   0  490   71  HH  HHHNH H  AA HH    SANNNAN  VNN A SAAAHHANAHH H HN A E A  A SAHSG  
    35   35 L W  E     -OP  88  48E   1  491    0  WW  WWWWW W  WW WW    WWWWWWW  WWW W WWWWWWWWWWW W WW W W W  W WWWWW  
    36   36 L Y  E     -OP  87  46E   0  491    9  YY  YYYYY Y  YY YY    YYYYYYY  HYY Y YYYYYYYFYYY F LY Y Y Y  Y YYYYY  
    37   37 L Q  E     -OP  86  45E   7  491   28  QQ  QQQQQ Q  QQ QQ    QQQQQQQ  QQQ Q QQQQQQQQQQQ Q QQ Q L Q  Q QQQQQ  
    38   38 L Q  E     -O   85   0E  21  491    4  QQ  QQQKQ Q  QQ QQ    QQQQQQQ  QQQ Q QZQQQQQQQQQ Q QQ Q Q Q  Q QQQKQ  
    39   39 L K    >   -     0   0   51  490    9  KK  KKKKK K  KK KK    KKKKKKK  KKK K KKKKKKKKKKK K EK K K K  K KKKKK  
    40   40 L Q  T 3  S+     0   0  190  491   19  PP  SPPPP S  PP PP    PPPPPPP  PPP T PPPPPPPPPPP P PP P P P  S PPPPP  
    41   41 L G  T 3  S+     0   0   86  491   10  GG  GGGGG H  GG GG    GGGGGGG  GGG G GGGGGGGGGGG G DG G G G  G GGGGG  
    42   42 L K  S <  S-     0   0  126  490   54  SS  TTQEF E  QQ QQ    QQQQQKA  KQQ Q QQQQQQQKQSQ T GQ Q Q Q  Q QQQQN  
    43   43 L S        -     0   0   21  490   55  SS  SSPAS S  SS AQ    PPTAAAS  AAA A PPAPPPPASSP S TP A S S  A PPVAA  
    44   44 L P        -     0   0    4  490   11  PP  PPPPP P  PP PP    PPPPPPP  PPP P PPPPPPPPPPP P IP P P P  P PPPPP  
    45   45 L Q  E     -P   37   0E  74  490   32  KK  KKKKK R  KK RK    KKKRRKK  KKK K KKRRKKKKRKK K KK R K K  K KKRRE  
    46   46 L F  E     +P   36   0E  25  490   42  PP  RRLFL L  LL LL    LLLLLLL  RLV L GLLLLLLLLPL L RL L L L  L RLLLL  
    47   47 L L  E     +     0   0E   4  490    9  WW  WWLLL L  LL LL    LLLLLLL  LLL L LLLLLLLLLWL W LL L L L  L LLLLL  
    48   48 L V  E     -PQ  35  54E   0  491    5  II  IIIII I  II II    IIIIILI  III I IIIIIIIIIII I II I I I  I IIIII  
    49   49 L Y  E >> S+ Q   0  53E  39  491   17  YS  YYYYY K  YY YY    YYYYYYY  YKY Y YYYYYYYYYYK Y YY Y Y Y  Y YYYYY  
    50   50 L N  T 34 S-     0   0   52  491   91  AA  DDLDR Y  WW DL    RSRYDKA  KYV L RKGGLLWGYAY S AA G K W  G KSYWD  
    51   51 L A  T 34 S+     0   0    3  491   45  TT  TTAGT A  AA AA    AAIAAAA  AAA A AAAAAAAAATA T TA A I A  A AAAAS  
    52   52 L K  T <4 S+     0   0  148  491   25  SS  SSSSS S  SS TS    SSSNNPS  SNN S SSTSSSSSSSS S SS S S S  S SSNKY  
    53   53 L T  E  <  -Q   49   0E  47  491   67  NN  KKNFN Q  TT NH    TTNSNGT  NIS T TTSTNSTISNY N SN I N T  T TYKNN  
    54   54 L L  E     -Q   48   0E  60  491   60  LL  LLLLL S  RR LL    LLRLLLL  LLL R LLRRLLRLRLL L LL R R R  R LLLLL  
    55   55 L G    >   -     0   0    9  490   71  AA  AAEKA I  EE AE    EAAAAQQ  QEQ A AEAAEEEEAAE A GE A F E  H AAAEY  
    56   56 L E  T 3  S+     0   0  192  490   35  SS  SSSTS S  SS SS    SSSSSSS  SSS S SSTTSSSDTSS S SS T S S  T SSSSA  
    57   57 L G  T 3  S+     0   0   70  491    5  GG  GGGGG G  GG GG    GGGGGGG  GGR G GGGGGGGGGGG G GG G G G  G GGGGG  
    58   58 L V    <   -     0   0   25  489   11  VV  VVVVV I  VV VV    VVVVVVV  VVV I VVIIVVVVIVV V VI I V V  T VVVVV  
    59   59 L P    >   -     0   0   47  490    7  PP  PPPPP P  PP PP    PPPPPPP  PPP P PPPPPPPPPPP P PP S P P  P PPPPP  
    60   60 L S  T 3  S+     0   0  115  491   57  AA  AAAST S  DD GA    SSDAASS  ASL D SSDAAADSDTA A KA A D D  E PSADA  
    61   61 L R  T 3  S+     0   0   44  491    4  RR  RRRRR R  RR RR    RRRRRMR  RRR R RRRRRRRRRRR R RR R R R  R RRRRR  
    62   62 L F  E <   +M   75   0D   5  491    1  FF  FFFFF F  FF FF    FFFFFFF  FFF F FFFFFFFFFFF F FF F F F  I FFFFF  
    63   63 L S  E     -M   74   0D  55  490   22  SS  SSSSS S  TT RS    KKSSSSS  SSS S RKSSSSSSSSS S SS S S T  S KKSSS  
    64   64 L G  E     +M   73   0D  13  491    2  GG  GGGGG G  GG GG    GGGGGGG  GGG G GGGGGGGGGGG G GG G G G  G GGGGG  
    65   65 L S  E     +M   72   0D  63  491    5  SS  SSSGS S  SS SS    SSSSSSS  SSS S SSSSSSSSSSS S SS S S S  S SSSSS  
    66   66 L G  E     -M   71   0D  36  491   14  GG  GGGGG G  GG GG    GGGGGGG  GGG G GGAGGGGRGGG G RG G G G  G GGGGG  
    67   67 L S  E >   +M   70   0D  79  491    9  SS  SSSSS S  SS SS    SSSSSSY  SSC S SSSSSSSYSSS S SS S S S  S SSSSF  
    68   68 L G  T 3  S-     0   0   16  491   13  GG  GGGAG G  GG GG    GGGGGGG  GGG G GGGGGGGGGGG G GG G G G  G GGGGG  
    69   69 L T  T 3  S+     0   0   67  488   13  TT  NTTTT S  TT TT    TTTTTTT  TTT T TTTTTTTTTTT T ST T T T  T TTTTT  
    70   70 L Q  E <   +LM  24  67D 110  489   27  SS  SSDNS D  DD DD    QEYDDED  DDD D DDDEDDDDDSD S DD E D D  D QEDDD  
    71   71 L F  E     -LM  23  66D   2  491    6  YY  YYFFY F  FF FF    FFFFFFF  YFF F FFFFFFFFFYF Y YF F F F  F FYFFF  
    72   72 L S  E     -LM  22  65D  26  491   30  SS  SSTTS T  TT TT    TTTTTTT  TTT T TTTTTTTTTST S ST T T T  T TTTTT  
    73   73 L L  E     -LM  21  64D   0  491    2  LL  LLLVL L  LL LL    LLLLLLL  LLL L LLLLLLLLLLL L LL L L L  L LLLLL  
    74   74 L K  E     -LM  20  63D  97  491   39  TT  TTNTT S  TT TT    TTTTTTT  TTT T TTTTNNTTSTN T TN N K T  T TTTTT  
    75   75 L I  E     -LM  19  62D   0  491    1  II  IIIII I  II II    IIIIIII  III I IIIIIIIIIII I II I I I  I IIIII  
    76   76 L N  S    S-     0   0   86  491   30  SS  SSHSG N  SS SD    SNNSSSS  SSS N SSSSHQSSSSH S SH T S S  S SSSSS  
    77   77 L S  S    S-     0   0   58  491   62  RR  SSPST S  SS SP    DGNSSSG  SSS R DDRRPPSSNRP R SP S R S  R DGSNS  
    78   78 L L        -     0   0    0  491   27  MV  TMVLM V  VV LV    LVFLLLL  VVL V LLLLVVLLLVV M LV L V V  M LVLML  
    79   79 L L    >   -     0   0   67  491   31  EE  EEEQE E  KK EE    EQQEEQQ  DEE E EEEQEEQEQEE E EE Q E K  E EQEEE  
    80   80 L P  G >  S+     0   0   92  491   58  AA  GAEPA P  AA PA    CCAPPPA  PPP A CCPSEEADAAE A SE S A A  A CCPAC  
    81   81 L E  G 3  S+     0   0  102  491   13  EE  EEEEE E  EE ED    ADDEEEE  EEE D AAEEEEEEEEE E EE G E E  E DDEEE  
    82   82 L D  G <  S+     0   0    1  491    5  DD  DDDDD D  DD DD    DDDDDYD  DDD D DDDDDDDDDDD D DD D D D  D DDDDD  
    83   83 L F    <   +     0   0   29  490   72  AA  AAAFV V  LL AT    AAAGAFA  VVV A AAFFAAVMVVA A FA L L L  A AAASS  
    84   84 L G  E    S- R   0 105E  17  491   23  AA  AAAAA G  AA GA    AAAGAAA  AAT G AAAAAAAAGAA A VA A G A  A AAAAA  
    85   85 L S  E     -OR  38 104E  24  491   63  TT  TTTTT V  VV ET    TTVDHTT  TDT D TTVVTIVTDTT T AT L V V  D TTHVI  
    86   86 L Y  E     -OR  37 103E   0  491    0  YY  YYYYY Y  YY YY    YYYYYYY  YYY Y YYYYYYYYYYY Y YY Y Y Y  Y YYYYY  
    87   87 L Y  E     -O   36   0E   5  490    4  YY  YYYYY Y  YY YY    YYYYYYY  YYY Y YFYYYYYFYYY Y YY F Y Y  Y YYYYY  
    88   88 L a  E     -O   35   0E   0  491    0  CC  CCCCC C  CC CC    CCCCCCC  CCC C CCCCCCCCCCC C CC C C C  C CCCCC  
    89   89 L Q  E     -OS  34  99E   0  489   48  QQ  QHQQQ Q  QQ QQ    QQQQQQQ  QQQ Q QQQQQQQLQLQ Q LQ Q F Q  Q QQQQQ  
    90   90 L H  E     -O   33   0E  22  483   26  QQ  QQHQQ N  QQ QQ    SGQHQQN  QQQ Q SGQQHHQQHQH Q QQ Q Q Q  H SCQQQ  
    91   91 L H        +     0   0    0  421   89  ..  WRSYG G  YY SS    NGGYYFD  HSY S TSYYSSY.HWS R YS Y A Y  T NTSHR  
    92   92 L Y  S    S+     0   0  104  454   88  WW  SSRHS H  YY NW    YYNKKSY  NNN Y YB NRRYHYTG S AS G S Y  D YYRLH  
    93   93 L G  S    S-     0   0   34  422   71  SS  SS.HS S  .S S.    YYNSSSV  SSS E GY N..NTSSE S SE D H S  V GYSKS  
    94   94 L T  S    S-     0   0  104  446   88  SS  NYELI F  SY FN    SSPYYAF  NYL T VT WEELYYNF Y SD W F Y  T SSSLY  
    95   95 L P  S    S+     0   0    7  443   51  NN  PPLPP P  YP PD    SGPLPLC  PPP P GG PLLPLPPP P PP P P P  L SSPPP  
    96   96 L P  S    S-     0   0   55  421   75  PP  PWPFR L  PP  P    SSPSlPS  PPP   FT PPPWPPPP L YP P R P  W SSlPP  
    97   97 L L        -     0   0   21  160   88  PP  ..Y.Y .  R.  W    ...Hq..  ..T   .. WLL.Y..W . .. Y . .  R S.q .  
    98   98 L T        -     0   0   40  288   41  TT  TTTTT T  TT  T    ..TSC..  ..V   .V TTTTT.TT T TT T T T  T S.C .  
    99   99 L F  B     -S   89   0E  18  290   29  FF  FFFFF F  FF  F    .. AF.F  ..I   .F FFFFF.FF F FF F F F  F YYF .  
   100  100 L G        -     0   0    3  294   39  GG  GGGGG G  GG  G    NG SS.W  ..Q   GG GGGGG.GG G GG G G G  G GGR .  
   101  101 L G        -     0   0   52  307   63  GG  GGGPG A  GG  G    GT EQ.P  TTA   GG QAAQG.AG A GG Q G S  G AAP .  
   102  102 L G        -     0   0   11  306   43  GG  GGGGG G  GG  G    SD GG.G  VVM   GG GGGGG.GG G GG G G G  G   A .  
   103  103 L T  E     - R   0  86E   0  366   18  TT  TTTTT T  TT  T    TT A TF  TTT   TT TTTTTTTT T TT T T T  T   Q T  
   104  104 L K  E     -nR  10  85E  98  363   58  KM  KKKKK K  KK  K    VT K VG  QQK   EE RKKKKVKK K KK K K K  R   K    
   105  105 L L  E     -nR  11  84E   4  343   37  LL  LLLVL L  LL  L    IV A LL  AA    VV VLLVLLLL L LL L L L  V   L    
   106  106 L E  E     -n   12   0E 108  326   51  EE  EEEDE E  EE  E    Q  E HN  MM    VV EEEEEQEE E EE E E E  E        
   107  107 L I  E      n   13   0E 113  301   50  II  IIIFI I  II  L       G TL  TT    VV ILLII LI L II I I I  I        
   108  108 L K              0   0  145  268   18  KK  KKKKK K  KK  K       R R   KK    KK KKKKK K  K KK K K K  K        
   109      ! !              0   0    0   0     0  
   110    1 H E              0   0  194  408   30     E     E QQ  E  QE E       QE   D             E Q  Q Q E ED D     QQ
   111    2 H V        +     0   0   19  465   12     E     V VV  V  VV V       VV   I             V V  V V V VV V     VV
   112    3 H K  E     -A  134   0A 111  467   31     E     Q QQ  K  QQQQ       QQ   Q             Q Q  Q Q Q QQ Q     QQ
   113    4 H L  E     -A  133   0A   3  489    1     L     L LL  L  LLLL       LL   L             L L  L L L LL L     LL
   114    5 H Q  E     -A  132   0A  83  493   70     V     Q QQ  L  VVVV       VV   V             Q Q  Q Q Q VV V     VQ
   115    6 H E  E     +A  131   0A   5  498   21     E     Q QE  E  QEEE       EE   E             Q Q  Q E Q EE E     QQ
   116    7 H S  E     +A  130   0A  69  501   13    SS     S SS  S  SSSS       SS   S             S P  P S S SS S     SP
   117    8 H G        +     0   0   36  505    4    GG     G GG  G  GGGG       GG   G             G G  G G G GG G     GG
   118    9 H G        +     0   0   29  672   48    AG     P GG  G  GGGG       GG   G A           P A  T G A GG G     GA
   119   10 H D        -     0   0   96  677   40    EG     E GG  G  GGGG       GG   D E           E E  E R E GD D     GE
   120   11 H L  E     +e  224   0B  79  675   16    LL     L LL  L  VLLL       VL   V L           L L  L S L LL L     LL
   121   12 H V  E     -e  225   0B  16  677   33    VV     V VV  V  VVVV       VV   R V           V V  V V V VR K     VV
   122   13 H Q    >   -     0   0  114  679   51    KK     K QQ  Q  Q.QQ       QQ   Q R           K K  K Q K QQ Q     KK
   123   14 H P  T 3  S+     0   0   66  678    9    PP     P AA  P  PQPP       AP   P P           P P  P S P PP P     PP
   124   15 H G  T 3  S+     0   0   58  682   32    GG     G GG  G  GPGG       GG   G G           G G  G G G KG G     GG
   125   16 H G    <   -     0   0   25  684   63    AE     A DD  G  RGGG       TE   G A           A A  A G A GG G     GA
   126   17 H S        +     0   0   78  683   31    SS     S SS  S  SGSS       SS   S L           S S  S S S SS S     SS
   127   18 H L  E     - B   0 192A  25  685   25    VL     V LL  L  LLLL       LL   L V           V V  V L V LL L     LV
   128   19 H K  E     - B   0 191A  93  683   56    KR     K RR  R  RRRR       RK   K K           K K  K R K KS S     RK
   129   20 H L  E     - B   0 190A   0  688   14    LL     M LL  L  LLLL       LL   L L           M L  L L L LL L     LL
   130   21 H S  E     -AB 116 189A  28  688   37    SS     S SS  S  SSSS       SS   S S           S S  S S S SS S     SS
   131   22 H b  E     -AB 115 188A   0  688    0    CC     C CC  C  CCCC       CC   C C           C C  C C C CC C     CC
   132   23 H A  E     -AB 114 187A  52  688   66    TA     K EE  A  VAAA       TT   K K           K K  K A T AK K     VK
   133   24 H A  E     +A  113   0A   8  688   49    AA     A AA  A  AAVA       AA   A A           A A  A A A AA A     AA
   134   25 H S  E     +A  112   0A  58  688   12    SS     S SS  S  SSSS       SS   S S           S S  S S S SS S     SS
   135   26 H G  S    S+     0   0   56  688    4    GG     G gg  G  GGGG       AG   G G           G G  G G G GG G     GG
   136   27 H F  S    S-     0   0   33  686   34    FF     Y hh  F  FFFF       FF   F F           Y Y  Y I F FL L     FY
   137   28 H T    >   -     0   0   93  687   50    NT     T GG  T  TTTT       NS   T N           T T  T D N DT T     ST
   138   29 H F  G >  S+     0   0    2  688   41    IF     F YY  F  FFFF       LY   F I           F F  F V I FS S     FF
   139   30 H S  G 3  S+     0   0   57  688   55    KR     T GG  A  SSSS       SS   S K           T T  T N K NS S     RT
   140   31 H S  G <  S+     0   0   71  688   60    DS     D GG  D  TSSS       DN   S D           D S  S R D TY Y     DS
   141   32 H Y  S <  S-     0   0   44  688   41    TF     Y YY  F  YSYY       YY   Y Y           Y Y  Y N T YY Y     FY
   142   33 H T        -     0   0   30  688   91    YN     Y GG  Y  AGQW       AV   Y Y           Y W  W A Y AN Y     YW
   143   34 H M  E     -FG 207 160C   0  672   46    MM     M MM  M  MMMM       MM   M M           M M  M M M MM M     MM
   144   35 H S  E     -FG 206 159C   0  685   73    HN     K GG  S  HNHG       HT   Y H           K H  H G H SH N     SH
   145   36 H W  E     +FG 205 158C   0  688    0    WW     W WW  W  WWWW       WW   W W           W W  W W W WW W     WW
   146   37 H V  E     -FG 204 156C   0  688   19    VV     V FF  I  VVVV       VV   I V           V V  V F V VV V     IV
   147   38 H R  E     -FG 203 155C  10  688   17    KR     K RR  R  RRRR       RR   R K           K K  K R K RR R     RK
   148   39 H Q  E     -FG 202 154C   9  688    3    QQ     Q QQ  Q  QQQQ       QQ   Q Q           Q Q  Q Q Q QQ Q     ZQ
   149   40 H T    >   -     0   0    9  688   68    RA     S VV  S  AAAA       AA   A R           S R  R A R AA A     TR
   150   41 H P  T 3  S+     0   0   80  687   10    PP     H PP  P  PPPP       PP   P P           P P  P P P PP P     PP
   151   42 H E  T 3  S-     0   0  151  688   26    EG     G GG  G  GGGG       GG   G E           G G  G G E GG G     GG
   152   43 H K    <   +     0   0  121  688   32    QK     K KK  K  RKKK       KK   K Q           K R  Q T K KK K     KR
   153   44 H R        -     0   0  113  687   43    GG     S EE  A  GGGG       GG   G G           S G  G E G GG G     GG
   154   45 H L  E     -G  148   0C   9  688   14    LL     L RR  P  LLLL       LL   L L           L L  L R L LL L     LL
   155   46 H E  E     -G  147   0C  44  687    5    EE     E EE  E  EEEE       ZE   E E           E E  E E E DE E     ZE
   156   47 H W  E     +G  146   0C  15  687   11    WW     W LL  W  WWWW       WW   W W           W W  W F W WW W     WW
   157   48 H V  E     -     0   0C   0  687   28    II     I VV  L  VVVV       VV   V I           I I  I V I VV V     VI
   158   49 H A  E     -G  145   0C   0  688   38    GA     G AA  S  AAKS       AT   S G           G G  G A G AA A     SG
   159   50 H S  E     -GH 144 168C   0  688   94    RF     D AA  F  VVLl       LN   Y W           D R  N G R SR R     YR
   160   51 H I  E     -GH 143 167C   4  675   18    II     I II  I  IIIl       II   I I           I I  I V I IV V     II
   161   52 H N    >   -     0   0   47  682   84    DN     N RR  R  SWST       SR   N D           N D  N R D SY H     GD
   162   53 H N  T 3  S+     0   0   65  684   88    PS     P WW  N  YSSG       YP   G P           P P  P W P IS S     GP
   163   54 H G  T 3  S-     0   0   65  686   68    AR     N SS  K  DDSN       GD   A E           N N  S S A KN N     SN
   164   55 H G  S <  S+     0   0   30  687   43    NG     N GG  A  GGGG       GE   G N           N S  N D S TG G     GS
   165   56 H G  S    S+     0   0   74  688   63    GN     G VL  n  NSGG       ST   S G           G G  G A G hG G     SG
   166   57 H R        +     0   0  163  505   86    NE     G EE  t  YQTS       BE   S N           G G  G Y N aS S     TG
   167   58 H T  E     -H  160   0C  62  677   52    TK     T TT  T  KKIT       TK   T T           T T  T T T TT T     LT
   168   59 H Y  E     +H  159   0C  53  686   85    KY     S YY  E  YYYY       YF   S I           S K  N D K LN N     YK
   169   60 H Y        -     0   0   44  688    9    YY     Y HH  Y  YYYY       YY   Y Y           Y Y  Y Y Y YY Y     YY
   170   61 H P    >>  -     0   0   20  688   65    DG     N KK  N  AAAA       AS   A D           N N  N A D AA A     AN
   171   62 H D  T 34 S+     0   0  148  688   64    PE     Q DD  P  DDDN       DD   D P           Q E  E D P DD D     DE
   172   63 H T  T 34 S+     0   0   90  688   57    KS     K SS  S  SSSS       SS   S K           K K  R S K SS S     SK
   173   64 H V  T X> S+     0   0    1  688   42    FV     F VV  V  VVVV       VV   V F           F F  F V F VV V     VF
   174   65 H K  B 3< S+c  177   0A 142  687   31    QK     K KK  K  KKKK       R.   K Q           K K  K K Q KK K     KK
   175   66 H G  T 34 S+     0   0   74  687   36    GG     G GG  G  GGGG       G.   G G           G S  G G D EG G     GS
   176   67 H R  T <4 S+     0   0   36  688   17    KR     K RR  R  RCRR       RR   R K           K K  K R K RR R     RK
   177   68 H F  E  <  -cD 174 192A   2  688   60    AF     A FF  F  FFFF       FF   F A           A A  A F A FF F     FA
   178   69 H T  E     - D   0 191A  79  688   38    TT     T TT  T  STTT       TT   T S           T T  T T T TT T     TT
   179   70 H I  E     + D   0 190A   5  688   20    II     L II  I  ITII       IV   I I           L L  L I I II I     IL
   180   71 H S  E     - D   0 189A  51  684   41    TS     T SS  S  SSSS       SS   S T           T T  T S T SS S     ST
   181   72 H R  E     - D   0 188A  30  687   60    AR     V RR  R  RRRR       RR   R A           V V  S R A RW W     RV
   182   73 H D  E > > - D   0 187A  60  686    7    DD     D DD  D  DDDD       BD   D D           D D  D D D DD D     DD
   183   74 H N  G > 5S+     0   0   48  688   57    TN     K NN  D  NNNN       IN   N T           K K  K N T DK K     NK
   184   75 H A  G 3 5S+     0   0   99  688   45    SA     S AT  T  SAAA       SA   G S           S P  S N S SA A     AP
   185   76 H K  G < 5S-     0   0  111  688   51    SD     S KK  Q  NKKK       KR   N S           S S  S K S QS S     QS
   186   77 H N  T < 5 +     0   0   62  688   46    NN     S NN  N  NNNN       BN   S N           S S  S N N SS S     KS
   187   78 H T  E   < -BD 132 182A  16  688   69    TS     T MM  V  TTTT       TS   L T           T T  T T T ML L     ST
   188   79 H L  E     -BD 131 181A   0  687   56    AL     A VV  L  LLLL       LV   L A           A A  A V A VL L     LA
   189   80 H Y  E     -BD 130 180A  41  687   46    YF     Y YY  Y  HYFY       YS   H Y           Y Y  Y Y Y YS S     YY
   190   81 H L  E     -BD 129 179A   0  687    7    LL     M LL  L  LLLL       LN   L L           M M  M L L LL L     LM
   191   82 H Q  E     -BD 128 178A  76  687   41    QQ     Q QQ  Q  EQQQ       ZS   Q Q           Q Q  E Q Q QQ Q     ZQ
   192   83 H M  E     +BD 127 177A   0  688   11    LM     L MM  M  MMMM       MM   M L           L L  L M L MM M     ML
   193   84 H S        +     0   0   42  688   54    SS     N NN  N  NSSN       KF   N S           N S  S G S NN N     BS
   194   85 H S  S    S-     0   0   68  687   24    SS     S SS  T  TNSI       TL   S S           S S  S S S NS S     SS
   195   86 H L        -     0   0    3  686   18    LL     L LL  L  LLLL       LQ   L L           L L  L L L LL L     LL
   196   87 H K    >   -     0   0  102  686   68    TR     T KK  R  RRRT       RR   K T           T T  T E T KK K     RT
   197   88 H S  G >  S+     0   0   70  686   60    SV     S PP  A  TAAV       TV   A S           S S  S A S TT T     TS
   198   89 H E  G 3  S+     0   0  126  687   22    ED     E EE  E  EEDE       EE   E E           E E  E G E EE E     ZE
   199   90 H D  G <   +     0   0    2  687    3    DD     D DD  D  DDDY       DD   D D           D D  D D D DD D     BD
   200   91 H T    <   +     0   0   32  688   28    TT     S TT  T  TMMT       TT   T T           S S  S T T TT T     TS
   201   92 H A  E    S- I   0 223C   8  686    5    AA     A AA  A  AAAA       AA   A A           A A  A A A AA A     AA
   202   93 H M  E     -FI 148 222C  58  687   48    VI     V VV  I  LMMV       VT   T V           V V  V L V LL L     VV
   203   94 H Y  E     -FI 147 221C   0  688    1    YY     Y YY  Y  YYYY       YY   Y Y           Y Y  Y Y Y YY Y     YY
   204   95 H Y  E     -F  146   0C   7  688    4    YY     Y YY  Y  YYYY       YY   Y Y           Y Y  Y Y Y YY Y     YY
   205   96 H b  E     -F  145   0C   0  688    1    CC     C CC  C  CCCC       CC   C C           C C  C C C CC C     CC
   206   97 H V  E     -FJ 144 217C   0  688   23    AA     A AA  A  AAAA       AA   A A           A A  A A A TA A     AA
   207   98 H R  E     -FJ 143 216C  21  687   40    Rr     R aa  k  krrr       kr   r r           R r  r a G vt t     aR
   208   99 H H  E     + J   0 214C   6  583   92    .h     . pp  t  srdk       tf   s d           . d  r a . na w     w.
   209  100 H E  E  >  + J   0 213C  63  625   78    GN     D VV  T  QDDA       RG   R G           . E  G A . LG E     S.
   210  101 H Y  T >4 S-     0   0   80  658   93    WW     R GG  A  GNGR       BD   E Y           D D  Y G . QT D     TY
   211  102 H Y  T 34 S-     0   0  140  672   23    lF     Y FF  V  YFLf       FY   F F           y Y  Y Y y FH F     Fy
   212  103 H Y  T 34 S+     0   0   39  265   92    d.     Y ..  .  ...a       ..   . Y           y .  . . g .. .     .y
   213  104 H A  E <<  -J  209   0C   0  403   87    A.     A ..  .  ..RG       .G   . A           V A  . . N .. .     SA
   214  105 H M  E     +J  208   0C   0  497   62    M.     M ..  .  F.QT       .P   . M           F M  F . F RG .     LM
   215  106 H D  E     +     0   0C  19  615   50    DD     D AA  K  DLEC       .D   . D           D D  D S D DQ .     BD
   216  107 H Y  E     -J  207   0C  99  624   65    YP     Y YY  M  PTPP       .F   . Y           Y Y  Y Y Y SD .     YY
   217  108 H W  E     -J  206   0C  23  675    2    WW     W WW  W  WWWW       WW   W W           W W  W W W WW W     WW
   218  109 H G        -     0   0    0  664   17    GG     G GG  G  GTSS       GG     G           G G  G G G PG A     GG
   219  110 H Q        -     0   0   91  659   46    QQ     Q QQ  L  QKNM       QQ     Q           Q Q  Q Q Q AP A     ZQ
   220  111 H G        -     0   0   16  650   16    GG     G GG  G  GGGD       GG     G           G G  G G G GI A     GG
   221  112 H T  E     -I  203   0C  21  594   27    TT     T TT  K  T...       TT     T           T T  T T T .A .     BT
   222  113 H T  E     -I  202   0C  72  593   76    SL     S QQ  I  L...       LL     S           T S  T Q T .G .     LS
   223  114 H V  E     -I  201   0C   0  596   20    VV     V VV  I  V...       VV     V           L V  L V L .V .     VV
   224  115 H T  E     -e  120   0B  36  593   20    TT     T TT     T..T       TS     T           T T  T T T .R .     T 
   225  116 H V  E     +e  121   0B   6  572    6    VI     V VV     V.ML       VV     V           V V  V V V .V .     V 
   226  117 H S        -     0   0   36  566   11    SS     S SS     TRKS       ST     S           S S  S S S GG .     S 
   227  118 H S  S    S+     0   0   84  551   22    SS     S SS     SVAP        S     S           S S  S S S AT .     S 
   228  119 H A  S    S+     0   0   70  123   53    AA               SPG                                        G       
   229  120 H W        -     0   0  123   73   63     S               F                                          W       
   230  121 H R        +     0   0  207   60   75     T               R                                                  
   231  122 H H              0   0  156   54   67     K               E                                                  
   232  123 H P              0   0  155   35   53     G               S                                                  
## ALIGNMENTS  631 -  700
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....4....:....5....:....6....:....7....:....8....:....9....:....0
     1    1 L D              0   0  183  420   16  NDQQ    D DDDDDDDDQ       E   DDDD QKE D      DE   DNNDDDEEEEEEQQDDD D
     2    2 L I        -     0   0   32  462   11  IIII    I IIIIIIIVI       I   IIII III III    IV   IIIIIINIIIIIIIIII I
     3    3 L E        -     0   0  117  463   68  MTVV    V VVVVVVVQL       V   VQQK VVQ VVV    TT   VVVVVVVVVVVVVVQTV V
     4    4 L L  E     -K   25   0D  10  474    7  MMLL    MMLLLLLMMML       L  LLMMMMLMMLLLL    RM   LLLLLMLLLLLLLLMML M
     5    5 L T  E     -K   24   0D  64  475    8  TTTT    TTTTTTTTTIT       T  TTTTTTTTTTTTT    TT   TTTTTTTTTTTTTTNTT T
     6    6 L Q  E     -K   23   0D  13  475    0  QQQQ    QQQQQQQQQQQ       Q  QQQQQQQQQQQQQ    QQ   QQQQQQQQQQQQQQQQQ Q
     7    7 L T  E    S+K   22   0D  64  475   34  SSTT    TTSSSSSSSSS       S  SSTSSSSSSTSSS    SS   SSSSSSSSSSSSSSTSS S
     8    8 L P        -     0   0   46  480    9  PPPP    PPPPPPPPPPP       P  PPPPPPPPPPPPP    PP   PPPPPPPPPPPPPPPPP Q
     9    9 L V  S    S+     0   0   96  484   67  SSEE    SSAAAAADDSA       A  GDSSSADSASAAA    SS   AAAAADAAAAAAAASGA T
    10   10 L S  E     -n  104   0E  60  485   43  SSSS    SSSSSSSSSSI       TS TSSLSTYSSPSSS    SS   SSSSSSIIIIIIIITSS F
    11   11 L L  E     -n  105   0E  58  489   21  LLLL    VVLLLLLLLLM       LL LLLLLLVLLVLLR    LL   LLLLLLMTTTTTMMLLL M
    12   12 L S  E     +n  106   0E  60  490   42  SPAA    SSAAAAAAASS       SA SSASSSSSSSASA    SP   AAAAAAAAAAAASSSAA S
    13   13 L A  E     -n  107   0E   0  490   58  AVVV    AAVVVVVVVAA       LV LVVAALVAAAKGA    VV   VVVVVVAAAAAAAAVVV T
    14   14 L S    >   -     0   0   47  491   29  SSSS    AASSSSSSSSS       SS SSSSSSSSSASSS    SS   SSSSSSSSSSSSSSSSS S
    15   15 L V  T 3  S+     0   0   76  491   66  PPPP    VVLLLLLLLLP       PL PLVVLPPPLVQPP    HH   LLLLLLLLLLLLPPILL V
    16   16 L G  T 3  S+     0   0   42  491    4  GGGG    GGGGGGGGGGG       GG GGGGGGGGGGGGG    GG   GGGGGGGGGGGGGGGGG G
    17   17 L E    <   -     0   0   71  491   35  DDDD    GGQQQQQEEDQ       EQ DEEDEEEEDGEEE    ED   QQQQQEQQQQQQQQEQQ D
    18   18 L T        -     0   0   69  491   62  RRTT    TTRRRRRRRIK       RR RRKRRRTRRTTRR    RR   RRRRRRKKKKKKKKRRR R
    19   19 L V  E     - L   0  75D  11  491   37  VVVV    VVAAAAAAAVV       AA AVVVVAAVVVVVV    VV   AAAAAAVVVVVVVVVVA V
    20   20 L T  E     - L   0  74D  67  490   30  TTTT    TTTTTTTTTTT       ST TTTTTTTTTTTTT    TT   TTTTTTTTTTTTTTITT S
    21   21 L I  E     - L   0  73D   1  489   17  IIII    IIIIIIIIIMM       LI LVMLILLIIIIIM    IL   IIIIIIMIIIIIMMIMI V
    22   22 L T  E     -KL   7  72D  29  489   58  TTRR    KNSSSSSNNTT       SS SNSSSSTNTSNSS    TT   SSSSSNTTTTTTTTNNS T
    23   23 L a  E     -KL   6  71D   0  490    1  CCCC    CCCCCCCCCCC       CC CCCCCCCCCCCCC    SC   CCCCCCCCCCCCCCCCC C
    24   24 L R  E     -KL   5  70D 110  490   45  GRKK    QQRRRRKKKQS       RR RKKKRRKKQQKKK    RR   RRRKKKSSSSSSSSHRR K
    25   25 L A  E     -K    4   0D  10  490   29  AAAA    AAAAAAASSAA       AA ALSAAAAAASAAA    AA   AAAAASAAAAAAAAAAA A
    26   26 L S  S    S+     0   0   66  490    4  SSSS    SSSSSSSSSSS       SS SSSSSSSSTSSSS    SS   SSSSSSSSSSSSSSSSS S
    27   27 L E  S    S-     0   0  101  490   38  QESS    EEEEEEQQQQS       QE QQQQEQSEQKQQQ    QQ   EEEQQQSSSSSSSSEQQ Q
    28   28 L N        +     0   0   83  490   45  NDSS    SDSSSSSSSGS       SS SSSNNSSSGSRSG    GG   SSSSSSSSSSSSSSNNS N
    29   29 L I    >   -     0   0    5  491   32  IILL    IIVVVVVVVTV       VV LVLIIVTIIVVVI    II   VVVVVVVVVVVVVVIIV V
    30   30 L Y  T 3   -     0   0  155  491   81  NYtt    GSdddddllNS       Ad rllNNSStNySsS    SS   dddddlsSSSSSSSNYs G
    31   31 L S  T 3  S+     0   0   53  467   65  SDqq    NAsssssnnI.       Ts snnKNS.dTnSsD    NS   nssssns.......SSn T
    32   32 L Y    <   +     0   0   63  490   52  WSRL    ENFFFFYYYNY       YY QYYYISYLWCYYY    GN   FFFYYYYYYYYSYYWNY N
    33   33 L L  E     -O   90   0E   0  490    7  LLLL    LLMMMMMLLLM       LM LLLLLLILLLLLL    LL   MMMMMLLMMMMLMMLVM V
    34   34 L A  E     -O   89   0E   0  490   71  AHAA    AANNNHNAANY       AN VAANAAAYASAHN    HH   NHHNNAHHHHHHHHSNH A
    35   35 L W  E     -OP  88  48E   1  491    0  WWWW    WWWWWWWWWWW       WW WWWWWWWWWWWWW    WW   WWWWWWWWWWWWWWWWW W
    36   36 L Y  E     -OP  87  46E   0  491    9  YYYY    YYFFFYYYYFY       YY YFYYYYYYYYYYY    YY   FYYYYYYYYYYYYYHYY Y
    37   37 L Q  E     -OP  86  45E   7  491   28  QQQQ    QQQQQQQQQQQ       QQ QQQQQQQQQQQQQ    QQ   QQQQQQQQQQQQQQQQQ Q
    38   38 L Q  E     -O   85   0E  21  491    4  QQQQ    QQQQQQQQQQQ       HQ QQQQKQQHQQQQQ    KQ   QQQQQQQQQQQQQQQQQ Q
    39   39 L K    >   -     0   0   51  490    9  IRKK    KKKKKKNKKKK       KK KNKKKKKKKKKKK    KK   KKKKKKKKKKKKKKKKR K
    40   40 L Q  T 3  S+     0   0  190  491   19  PPSS    PPPPPPPPPPP       PP PPPLEPSPPPPPP    PP   PPPPPPSSSSSSSSPPP P
    41   41 L G  T 3  S+     0   0   86  491   10  GGGG    GGGGGGGGGGG       GG GGGGDGGGGGGGG    GG   GGGGGGGGGGGGGGGGG G
    42   42 L K  S <  S-     0   0  126  490   54  QKQQ    QQQQQQQQQKS       QQ QQQEGQQQKQQQQ    QH   QQQQQQATTTTTTTNQQ Q
    43   43 L S        -     0   0   21  490   55  AAAA    PPPPPPSPPAS       AP RPSASAAAAPAAA    AP   PPPPPPSSSSSSSSAAP S
    44   44 L P        -     0   0    4  490   11  PPPP    PPPPPPPPPPP       PP PPPPVPPPLPPPP    PP   PPPPPPPPPPPPPPPPP P
    45   45 L Q  E     -P   37   0E  74  490   32  KKKK    KKKKKKKKKKR       RK RKKKKRKRKKKRR    KK   KKKKKKKKKKKKKKQRK K
    46   46 L F  E     +P   36   0E  25  490   42  LLLL    LLLLLLLLLLL       LL LLLLLLLTFLLLL    LL   LLLLLLPPPPPPRRLLL A
    47   47 L L  E     +     0   0E   4  490    9  LLLL    LLLLLLLLLLL       LL LLLLLLLLLLLLL    LI   LLLLLLLWWWWWWWLLL L
    48   48 L V  E     -PQ  35  54E   0  491    5  IIII    IIIIIIIIIII       II IIIIIIIIIIIII    II   IIIIIIIIIIIIIIIII I
    49   49 L Y  E >> S+ Q   0  53E  39  491   17  YYYY    YYYYYYYYYYY       YY YYYYYYYYSYYYW    YY   YYYYYYHYYYYYYYYYK Y
    50   50 L N  T 34 S-     0   0   52  491   91  KGNH    RAAAARAWWGD       DA GWWNYGWWKRGWD    GR   ALLATWREEEEEDDKAY S
    51   51 L A  T 34 S+     0   0    3  491   45  AAAG    AAAAAAAAAAT       AA VAATTAVAAAAAA    AA   AAAAAATIIIIITTAAA A
    52   52 L K  T <4 S+     0   0  148  491   25  SSSS    SSSSSSSSSSS       SS SSSNSSSTTSSNT    NN   SSSSSSSSSSSSSSSSS S
    53   53 L T  E  <  -Q   49   0E  47  491   67  NNTS    KDNNNNNTTIN       NN NATNNSTNINKRN    TS   NNNNNTNKKKKKKKNSN Y
    54   54 L L  E     -Q   48   0E  60  491   60  LLRL    LLQQQLLRRLL       RL RRRLLRRLLLRLL    LL   QLLLLRLLLLLLLLYRL P
    55   55 L G    >   -     0   0    9  490   71  QQQQ    AAGGGEEEEEA       AE AQEQQVHEHAGAY    QQ   GEEEEEAAAAAAADHAE Y
    56   56 L E  T 3  S+     0   0  192  490   35  SPSS    SSSSSSSSSAS       TS TSSTSTTSTSSSP    SS   SSSSSSSSSSSSSSTTS S
    57   57 L G  T 3  S+     0   0   70  491    5  GGGG    GGGGGGGGGGG       GG GGGGGGGGGGGGG    GG   GGGGGGGGGGGGGGWGG G
    58   58 L V    <   -     0   0   25  489   11  IVVV    VVVVVIIVVVV       II IVVIVITVVVVVV    VV   VVVIIVVVVVVVVVVIV V
    59   59 L P    >   -     0   0   47  490    7  PPPP    SPPPPPPPPPP       PP PPPPPPPPSPPPP    PP   PPPPPPPPPPPPPPPPP P
    60   60 L S  T 3  S+     0   0  115  491   57  SSDS    SSAAAAADDSV       AA DADSSDEASSDAA    SS   AAAAADAAAAAAAASGA H
    61   61 L R  T 3  S+     0   0   44  491    4  RRRR    RRRRRRRRRRR       RR RRRRRRRRRRRRR    RR   RRRRRRRRRRRRRRRRR R
    62   62 L F  E <   +M   75   0D   5  491    1  FFFF    FFFFFFFFFFF       FF FFFFFFIFFFFFF    FF   FFFFFFFFFFFFFFFFF F
    63   63 L S  E     -M   74   0D  55  490   22  SSSS    KKSSSSSSSSS       SS SMTSSSSSSKSSS    IS   SSSSSSSSSSSSSSSSS T
    64   64 L G  E     +M   73   0D  13  491    2  GGGG    GGGGGGGGGGG       GG GGGGGGGGGGGGG    GG   GGGGGGGGGGGGGGGGG G
    65   65 L S  E     +M   72   0D  63  491    5  SSSS    SSSSSSSSSRS       SS SSSSSSSSSSRSS    SS   SSSSSSSSSSSSSSSSS S
    66   66 L G  E     -M   71   0D  36  491   14  GGGG    GGGGGGGGGRG       GG GGGGGGGRGGGGG    LG   GGGGGGGGGGGGGGGGG G
    67   67 L S  E >   +M   70   0D  79  491    9  SSSS    SSSSSSSSSYS       SS ASSSSSSSTSSSS    SS   SSSSSSSSSSSSSSSSS S
    68   68 L G  T 3  S-     0   0   16  491   13  GGGD    GGGGGRGGGGA       GG GGGGGEGGWGGGG    GG   GRRGGGGGGGGGAAGGG G
    69   69 L T  T 3  S+     0   0   67  488   13  ATTT    TTTTTTTTTTT       TT TTTTKTTTTTTTT    KT   TTTTTTTTTTTTTTTTT T
    70   70 L Q  E <   +LM  24  67D 110  489   27  DDDD    EEDDDDDDDDS       DD DEDDDDDDDQDDD    DD   DDDDDDSSSSSSSSDDD D
    71   71 L F  E     -LM  23  66D   2  491    6  YYYF    FYFFFFFFFFY       FF FFFYYYFFFFFFF    FF   FFFFFFYYYYYYYYYFF F
    72   72 L S  E     -LM  22  65D  26  491   30  TTTT    TTSSSTTTTTS       TT TSTTSTTTTTTTS    TT   STTTTTSSSSSSSSSTT T
    73   73 L L  E     -LM  21  64D   0  491    2  FLFL    LLLLLLLLLLL       LL LLFLLLLLLLLRL    LL   LLLLLLLLLLLLLLLLL L
    74   74 L K  E     -LM  20  63D  97  491   39  TTTT    TTNNNTNTTTT       TN TTTTTTTSTTTTT    IT   NTTNNTTTTTTTTTSTN T
    75   75 L I  E     -LM  19  62D   0  491    1  IIII    IIIIIIIIIII       II IIIIIFIIIIIII    II   IIIIIIIIIIIIIISII I
    76   76 L N  S    S-     0   0   86  491   30  SSSN    SSHHHNHSSST       SH SSSSSSSSSSNSS    SS   HDDHHSSSSSSNTTSSH S
    77   77 L S  S    S-     0   0   58  491   62  SSRR    GGPPPPPSSSR       SP RSSSGSRSSENSN    SS   PPPPPSSSSSSTSSSNP N
    78   78 L L        -     0   0    0  491   27  MLVV    VVMMMVVLLLM       LV LLVLLLMMLVFLM    LQ   MVVVVLVMMMMMMMLLV V
    79   79 L L    >   -     0   0   67  491   31  DEEE    QQEEEEEQQEQ       EE EQKQEQEEEQQEE    EE   EEEEEQEEEEEEQQQQE Q
    80   80 L P  G >  S+     0   0   92  491   58  PPAA    CCEEEAEAADA       PE PAAPSAAPPCAPA    PP   EAAEEAAAAAAAAAPAE S
    81   81 L E  G 3  S+     0   0  102  491   13  EEDE    DADDDDEEEEE       AE EEEEEGEEEDDEE    EE   DDDEEEEEEEEEEEEEE E
    82   82 L D  G <  S+     0   0    1  491    5  DDDD    DDDDDDDDDDD       DD DDDDDDDDDDDDD    ED   DDDDDDDDDDDDDDDDD D
    83   83 L F    <   +     0   0   29  490   72  VVAA    AATTTVAVVMA       FA FVLVIVAAAAAAA    AF   TAAAAVDAAAAAAAIVT L
    84   84 L G  E    S- R   0 105E  17  491   23  AAGG    GAAAAAAAAAA       AA AAAAAAGAAAAAA    AA   AAAAAAAAAAAAAAAGA A
    85   85 L S  E     -OR  38 104E  24  491   63  TNND    ITMMMTTVVTT       VT VVVTTVDITTVHV    TT   MTTTTVTIIIIITTTDT E
    86   86 L Y  E     -OR  37 103E   0  491    0  YYYY    YYYYYYYYYYY       YY YYYYYYYYYYYYY    YY   YYYYYYYYYYYYYYYYY Y
    87   87 L Y  E     -O   36   0E   5  490    4  YHYY    YYFFFYYYYFY       YY YYYFYYYYYYYYY    YY   FYYYYYYYYYYYYYYYY F
    88   88 L a  E     -O   35   0E   0  491    0  CCCC    CCCCCCCCCCC       CC CCCCCCCCCCCCC    CC   CCCCCCCCCCCCCCSCC C
    89   89 L Q  E     -OS  34  99E   0  489   48  QLKQ    QQQQQQQQQLQ       QL QQQLQQQLQQQQQ    QQ   QQQQQQQQQQQQQQVQQ Q
    90   90 L H  E     -O   33   0E  22  483   26  QQQQ    QSQQQQQQQQQ       HQ QQQQQH QQGQQQ    QQ   QQQQQQQQQQQQQQQEH Q
    91   91 L H        +     0   0    0  421   89  HTHS    DASSSSSYYHW       RS YYYHGY TYYYSY    GH   SNNSSYW  W WWWAGS Y
    92   92 L Y  S    S+     0   0  104  454   88  NNYR    WDKKKNNYDSS       NY GYYSYY YKYDRD    WN   KNNNNYS  N TSSKYW N
    93   93 L G  S    S-     0   0   34  422   71  SSTS    NYEEEEE.TYS       NE SDSSTS NSSNSS    DI   EEEEESG  Y YSSSNE S
    94   94 L T  S    S-     0   0  104  446   88  YFTD    SSVVVDDSILY       WS SSYRPT VSAVYS    YS   VDDDDTY  P PNNLYI Y
    95   95 L P  S    S+     0   0    7  443   51  PPPP    NGPPPPPTPPP       PP LTPPPS PPGPPP    PP   PPPPPPP  L LPPPPP P
    96   96 L P  S    S-     0   0   55  421   75  PP      nsWPWYYPTYp       pf YYPHTP  PSPlH    PP   YWYFW F  I ILLPPL Y
    97   97 L L        -     0   0   21  160   88  ..      nv.Y...Y..l       fy .. ...  ...q.    T.   ..... .  . ...... .
    98   98 L T        -     0   0   40  288   41  ..      NTTTTTTS.TT       TT TT ..S  .S.CT    V.   TTTTT .  T TTTT.T T
    99   99 L F  B     -S   89   0E  18  290   29  ..      FFFFFFFFFFF       FF FF ..F  .F.FY    T.   FFFFF .  F FFFV.F F
   100  100 L G        -     0   0    3  294   39  ..      GGGGGGGGGGG       GG GG ..G  .G.SG    Q.   GGGGG G  G GGGI.G G
   101  101 L G        -     0   0   52  307   63  TT      GGGGGGGQGGA       PS QQ G.Q  . .PQ    AA   GGGSS S  A AAAK.A G
   102  102 L G        -     0   0   11  306   43  VV      GGGGGGGGGGG       GG GG D.G  . .EG    MV   GGGGG G  G GGGR.G G
   103  103 L T  E     - R   0  86E   0  366   18  TT      TTTTTTTTTTT       TT TT T.T  T TQT    TT   TTTTT T  T TTTTTT T
   104  104 L K  E     -nR  10  85E  98  363   58  QQ      EEKKKKKKKKK       RK KK NMK  V VKK    KQ   KKKKK K  K KKKHVK K
   105  105 L L  E     -nR  11  84E   4  343   37  AA      VVLLLLLLVLL       VL LL HLV  L L L    TA   LLLLL L  L LLLILL L
   106  106 L E  E     -n   12   0E 108  326   51  MM      VVEEEEEEEEE       DE EE NQE  Q Q T    SM   EEEEE E  E EEECQE E
   107  107 L I  E      n   13   0E 113  301   50  IT      VVIIIIIIIKL       VI II IVI    P F    QT   IIIII I  L LLLI I I
   108  108 L K              0   0  145  268   18  KK      KKKKKKKKKKK       KK KN N K    R N    KK   KKKKK K  K KKKK K K
   109      ! !              0   0    0   0     0  
   110    1 H E              0   0  194  408   30                     QQQQQQE                DE E                      Q 
   111    2 H V        +     0   0   19  465   12                     VVVVEEV                VV V                      A 
   112    3 H K  E     -A  134   0A 111  467   31                     QQQQQQQ                IQ Q                      Q 
   113    4 H L  E     -A  133   0A   3  489    1                     LLLLLLL  L             LLLL                      V 
   114    5 H Q  E     -A  132   0A  83  493   70                     QQQQVMQ  E             TVQQ                      V 
   115    6 H E  E     +A  131   0A   5  498   21                     QQQQEEQ  Q             EEEQ                      E 
   116    7 H S  E     +A  130   0A  69  501   13                     PPPPSSS  S             SSSS                      S 
   117    8 H G        +     0   0   36  505    4                     GGGGGGG  G             GGGG                      G 
   118    9 H G        +     0   0   29  672   48      AAAA           TAAAGGP  G             GGPP  AAA                 G 
   119   10 H D        -     0   0   96  677   40      EEEE           EEEEGGE  G             DDGE  EEE                 S 
   120   11 H L  E     +e  224   0B  79  675   16      LLLL           LLLLLLL  V             VLTL  LLL                 V 
   121   12 H V  E     -e  225   0B  16  677   33      MAAV           VVVVVVV  V             KAVV  VVV                 V 
   122   13 H Q    >   -     0   0  114  679   51      KRRR           KKKKTTK  Q             KKKK  RKR                 Q 
   123   14 H P  T 3  S+     0   0   66  678    9      PPPS           PPPPLLP  P             PPPP  PPP                 P 
   124   15 H G  T 3  S+     0   0   58  682   32      GGGG           GGGGGGG  G             GGSG  GGG                 G 
   125   16 H G    <   -     0   0   25  684   63      AAAA           AAAAGGA  R             EGEA  AAA                 R 
   126   17 H S        +     0   0   78  683   31      SSSS           SSSSSSS  S             SSSS  SSL                 S 
   127   18 H L  E     - B   0 192A  25  685   25      VVVV           VVVVLLV  L             LQLV  VVV                 L 
   128   19 H K  E     - B   0 191A  93  683   56      KKKK           KKKKKKK  R             RKRK  KKK                 R 
   129   20 H L  E     - B   0 190A   0  688   14      ILLL           LLLLLLM  L             LLLM  LLL                 L 
   130   21 H S  E     -AB 116 189A  28  688   37      SSSS           SSSSSSS  S             SSTS  SSS                 S 
   131   22 H b  E     -AB 115 188A   0  688    0      CCCC           CCCCCCC  C             CCCC  CCC                 C 
   132   23 H A  E     -AB 114 187A  52  688   66      KKKT           KKKKKKK  A             KATK  KTK                 I 
   133   24 H A  E     +A  113   0A   8  688   49      AAAA           AAAAAAA  A             AGVA  AAA                 A 
   134   25 H S  E     +A  112   0A  58  688   12      TSSS           SSSSSSS  S             SSSS  SSS                 S 
   135   26 H G  S    S+     0   0   56  688    4      GGGG           GGGGGGG  G             GRGG  GGG                 G 
   136   27 H F  S    S-     0   0   33  686   34      YYYF           YYYYIIY  I             FFFY  YFF                 F 
   137   28 H T    >   -     0   0   93  687   50      TTTN           TTTTDDT  F             DTET  TNN                 S 
   138   29 H F  G >  S+     0   0    2  688   41      FFFI           FFFFFFF  T             FFLF  FII                 F 
   139   30 H S  G 3  S+     0   0   57  688   55      STTK           TTTTSST  L             SSST  TKK                 S 
   140   31 H S  G <  S+     0   0   71  688   60      SSSD           SSSSHHD  T             SSSD  DDD                 G 
   141   32 H Y  S <  S-     0   0   44  688   41      YYYY           YYYYYYY  Y             YYYY  YTY                 S 
   142   33 H T        -     0   0   30  688   91      WWWY           WWWWGGY  G             AYHY  EYY                 A 
   143   34 H M  E     -FG 207 160C   0  672   46      IMMM           MMMMIIM  I             MMMM  MMM                 M 
   144   35 H S  E     -FG 206 159C   0  685   73      EQQH           HHHHSSK  H             HNHK  HHH                 H 
   145   36 H W  E     +FG 205 158C   0  688    0      WWWW           WWWWWWW  W             WCWW  WWW                 W 
   146   37 H V  E     -FG 204 156C   0  688   19      VVVV           VVVVVVV  V             VVIV  VVV                 L 
   147   38 H R  E     -FG 203 155C  10  688   17      KKKK           KKKKRRK  R             RHRK  KKK                 R 
   148   39 H Q  E     -FG 202 154C   9  688    3      QQQQ           QQQQQQQ  Q             QQQQ  QQQ                 Q 
   149   40 H T    >   -     0   0    9  688   68      RRRR           RRRRAAS  A             PAPS  TRR                 I 
   150   41 H P  T 3  S+     0   0   80  687   10      PPPP           PPPPPPH  P             PPPH  PPP                 P 
   151   42 H E  T 3  S-     0   0  151  688   26      GGGE           GGGGGGG  G             GGGG  VEE                 G 
   152   43 H K    <   +     0   0  121  688   32      HQQQ           QRRRKKK  K             KNKK  HQQ                 K 
   153   44 H R        -     0   0  113  687   43      GGGG           GGGGGGS  G             GGGS  GGG                 G 
   154   45 H L  E     -G  148   0C   9  688   14      LLLL           LLLLLLL  L             LLLL  LLL                 L 
   155   46 H E  E     -G  147   0C  44  687    5      EEEE           EEEEEEE  E             EEEE  EEE                 E 
   156   47 H W  E     +G  146   0C  15  687   11      WWWW           WWWWWWW  W             WWWW  WWW                 W 
   157   48 H V  E     -     0   0C   0  687   28      IIII           IIIIIII  V             IVII  III                 V 
   158   49 H A  E     -G  145   0C   0  688   38      GGGG           GGGGAAG  A             AGGG  GGG                 A 
   159   50 H S  E     -GH 144 168C   0  688   94      EAAW           NRRRYYD  G             FQVD  ARW                 V 
   160   51 H I  E     -GH 143 167C   4  675   18      IIII           IIIIIII  L             IVII  III                 I 
   161   52 H N    >   -     0   0   47  682   84      LYYD           NDDDYYN  W             SNAN  HDD                 S 
   162   53 H N  T 3  S+     0   0   65  684   88      PPPP           PPPPPPP  Y             YPTP  PPP                 Y 
   163   54 H G  T 3  S-     0   0   65  686   68      GGGE           SNNNNNN  G             PNGN  GAE                 D 
   164   55 H G  S <  S+     0   0   30  687   43      SDDN           NSSSYYN  T             SGGN  SNN                 G 
   165   56 H G  S    S+     0   0   74  688   63      GGGG           GGGGGGG  N             gGSG  GGG                 N 
   166   57 H R        +     0   0  163  505   86      SDDD           GGGGSSG  .             t..G  GNN                 H 
   167   58 H T  E     -H  160   0C  62  677   52      TTTT           TTTTVVT  K             TSTT  TTT                 K 
   168   59 H Y  E     +H  159   0C  53  686   85      NRRE           NKKKDDS  N             HTAS  AKI                 L 
   169   60 H Y        -     0   0   44  688    9      YYYY           YYYYYYY  Y             YHIY  YYY                 Y 
   170   61 H P    >>  -     0   0   20  688   65      NTTA           NNNNAAN  A             SLAN  NDD                 S 
   171   62 H D  T 34 S+     0   0  148  688   64      EQQP           EEEESSQ  E             QTDQ  QPP                 D 
   172   63 H T  T 34 S+     0   0   90  688   57      KKKK           KKKKWWK  S             SDSK  KKK                 S 
   173   64 H V  T X> S+     0   0    1  688   42      FFFF           FFFFVVF  V             VPLF  FFF                 V 
   174   65 H K  B 3< S+c  177   0A 142  687   31      KKKQ           KKKKNNK  K             QKKK  KQQ                 K 
   175   66 H G  T 34 S+     0   0   74  687   36      GGGG           SSSSGGG  G             GGNG  GGG                 G 
   176   67 H R  T <4 S+     0   0   36  688   17      KKKK           KKKKRRK  R             RRRK  KKK                 R 
   177   68 H F  E  <  -cD 174 192A   2  688   60      AAAA           AAAAFFA  F             FFVA  AAA                 F 
   178   69 H T  E     - D   0 191A  79  688   38      TTTT           TTTTTTT  T             TTTT  TTS                 T 
   179   70 H I  E     + D   0 190A   5  688   20      FLLM           LLLLIIL  I             VIIL  LII                 I 
   180   71 H S  E     - D   0 189A  51  684   41      TTTT           TTTTSST  S             SSTT  TTT                 S 
   181   72 H R  E     - D   0 188A  30  687   60      AAAA           VVVVLLV  R             RRKV  AAA                 R 
   182   73 H D  E > > - D   0 187A  60  686    7      DDDD           DDDDDDD  .             EDDD  DDD                 D 
   183   74 H N  G > 5S+     0   0   48  688   57      TKKT           KKKKNNK  D             NNNK  KTT                 N 
   184   75 H A  G 3 5S+     0   0   99  688   45      SSSS           SPPPAAS  N             SAGS  SSS                 S 
   185   76 H K  G < 5S-     0   0  111  688   51      SSSS           SSSSQQS  S             NKKS  SSS                 K 
   186   77 H N  T < 5 +     0   0   62  688   46      NSSN           SSSSNNS  K             SNKS  SNN                 S 
   187   78 H T  E   < -BD 132 182A  16  688   69      TTTT           TTTTTTT  D             MTQT  TTT                 L 
   188   79 H L  E     -BD 131 181A   0  687   56      AAAA           AAAAVVA  T             LLVA  AAA                 L 
   189   80 H Y  E     -BD 130 180A  41  687   46      YYYY           YYYYFFY  L             YHYY  YYY                 F 
   190   81 H L  E     -BD 129 179A   0  687    7      MMML           MMMMLLM  Y             LLLM  MLL                 L 
   191   82 H Q  E     -BD 128 178A  76  687   41      QQQQ           QQQQQQQ  L             QQQQ  EQQ                 H 
   192   83 H M  E     +BD 127 177A   0  688   11      LLLL           LLLLMML  M             MMML  LLL                 V 
   193   84 H S        +     0   0   42  688   54      SSSS           SSSSIIN  N             NNNN  SSS                 N 
   194   85 H S  S    S-     0   0   68  687   24      SSSS           SSSSSSS  S             SSGS  SSS                 S 
   195   86 H L        -     0   0    3  686   18      LLLL           LLLLLLL  L             LLML  LLL                 L 
   196   87 H K    >   -     0   0  102  686   68      TAAT           TTTTTTT  R             RKET  TTT                 T 
   197   88 H S  G >  S+     0   0   70  686   60      SSSS           SSSSAAS  A             ATVS  SSS                 S 
   198   89 H E  G 3  S+     0   0  126  687   22      EEEE           EEEEAAE  D             EKKE  EEE                 A 
   199   90 H D  G <   +     0   0    2  687    3      DDDD           DDDDDDD  D             DDDD  DDD                 D 
   200   91 H T    <   +     0   0   32  688   28      SSST           SSSSTTS  T             TTTS  STT                 T 
   201   92 H A  E    S- I   0 223C   8  686    5      AAAA           AAAAAAA  A             AAAA  AAA                 A 
   202   93 H M  E     -FI 148 222C  58  687   48      VVVV           VVVVTTV  V             M.MV  VVV                 I 
   203   94 H Y  E     -FI 147 221C   0  688    1      YDYY           YYYYYYY  Y             YLYY  YYY                 Y 
   204   95 H Y  E     -F  146   0C   7  688    4      YYYY           YYYYFFY  Y             YYYY  YYY                 Y 
   205   96 H b  E     -F  145   0C   0  688    1      CCCC           CCCCCCC  C             CCCC  CCC                 C 
   206   97 H V  E     -FJ 144 217C   0  688   23      AAAN           AAAAAAA  A             ATAA  TAA                 A 
   207   98 H R  E     -FJ 143 216C  21  687   40      rrrr           Rrrrrrr  r             RrrR  rrr                 r 
   208   99 H H  E     + J   0 214C   6  583   92      ryvh           .stdggk  q             Dda.  sps                 y 
   209  100 H E  E  >  + J   0 213C  63  625   78      RDPS           RHTYTTD  G             SISD  SHP                 F 
   210  101 H Y  T >4 S-     0   0   80  658   93      YYYL           GYYDRRY  L             QTGR  YYY                 Y 
   211  102 H Y  T 34 S-     0   0  140  672   23      YYYY           WYYyLLY  I             FYYY  YyY                 Y 
   212  103 H Y  T 34 S+     0   0   39  265   92      ....           E..y...  H             ...W  .y.                 S 
   213  104 H A  E <<  -J  209   0C   0  403   87      AAAA           AAAA...  E             ..NY  .VA                 A 
   214  105 H M  E     +J  208   0C   0  497   62      MMMM           MMMM..F  M             ..FF  FGM                 M 
   215  106 H D  E     +     0   0C  19  615   50      DDDD           DDDDDDD  D             P.DD  DED                 D 
   216  107 H Y  E     -J  207   0C  99  624   65      YYYY           YYYYLLY  D             SYYV  YNY                 T 
   217  108 H W  E     -J  206   0C  23  675    2      WWWW           WWWWWWW  W             WVWW  WWW                 W 
   218  109 H G        -     0   0    0  664   17      GGGG           GGGGGGG  G             NAGG  GGG                 G 
   219  110 H Q        -     0   0   91  659   46      QQQQ           QQQQQQQ  K             LTQA  QQQ                 R 
   220  111 H G        -     0   0   16  650   16      GGGG           GGGGGGG  G             PGGG  GGG                 G 
   221  112 H T  E     -I  203   0C  21  594   27      TTTT           TTTTTTT  T             STTT  TTT                 T 
   222  113 H T  E     -I  202   0C  72  593   76      SSSS           SSSSLLT  A             SLMT  TTS                 T 
   223  114 H V  E     -I  201   0C   0  596   20      VVVV           VVVVVVL  V             KIVV  LLV                 V 
   224  115 H T  E     -e  120   0B  36  593   20      TTTT           TTTTTTT  T             KYTT  TTT                 I 
   225  116 H V  E     +e  121   0B   6  572    6      VVVV           VVVVIIV  V             IIVV  VVV                 V 
   226  117 H S        -     0   0   36  566   11      SSSS           SSSSSSS  S             S TS  SSS                 S 
   227  118 H S  S    S+     0   0   84  551   22      SSSS           SSSSSSS  S             N SS  SSS                 S 
   228  119 H A  S    S+     0   0   70  123   53                              A                                       A 
   229  120 H W        -     0   0  123   73   63                                                                      S 
   230  121 H R        +     0   0  207   60   75                                                                      T 
   231  122 H H              0   0  156   54   67                                                                      K 
   232  123 H P              0   0  155   35   53                                                                      G 
## ALIGNMENTS  701 -  770
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....1....:....2....:....3....:....4....:....5....:....6....:....7
     1    1 L D              0   0  183  420   16      DE D D DDDQ D QD   DDD    D DDDDQQQE     EE  KDD D EQEEDD D D   DD
     2    2 L I        -     0   0   32  462   11      IN I I VIIVIIIII   III    VFIIIIIIII     LI  III I IIIIIT III  III
     3    3 L E        -     0   0  117  463   68      QL Q V LQQIVQVTQ   TTV    VEVVVVLVLV     VV  VVQ Q VVVVVV IVV  VMM
     4    4 L L  E     -K   25   0D  10  474    7      ML L M MMMLLMLMM   MML    MLLLLMLLLL     LL  LLM M MLLLLL LLM  LMM
     5    5 L T  E     -K   24   0D  64  475    8      TT T S TTTTTTTTT   TTT    TTTTATTTTT     TTS TTT T TTTTTT TTT  TTT
     6    6 L Q  E     -K   23   0D  13  475    0      QQ Q Q QQQQQKQQQ   QQQ    QQQQQQQQQQ     QQQ QQQ Q QQQQQQ QQQ  QQQ
     7    7 L T  E    S+K   22   0D  64  475   34      SS S S TSSSTSSSS   SSS    TTSSSSSSSS     TSS SST S SSSSSS SSS  TYS
     8    8 L P        -     0   0   46  480    9      TP P P PPPPPPRPP   PPP    PPPPPPPPPP     PPP PPT P PPPPPP PPP  PPP
     9    9 L V  S    S+     0   0   96  484   67      SA S S LSSASSASS   SSE    ASAAADAAAA    APGA AAS S ADADAA AAD  LSS
    10   10 L S  E     -n  104   0E  60  485   43      SI S S SLSTPSSLS   SSS    SSSSSSIIIT    SSTS SSS L TYLFSS SSS  SST
    11   11 L L  E     -n  105   0E  58  489   21      LM L L LLMLVVLLL   LLL    VVLLLLMMML    LLLL LLL L LVLQLL LLL  LLL
    12   12 L S  E     +n  106   0E  60  490   42      SS A P PSSSSSSSP   PPA    SEAATVSSSS    ASSA AAS S SSSSAA AAA  SCP
    13   13 L A  E     -n  107   0E   0  490   58      AA V V VAVLGAGVA   LVV    EAVVVVAAAL    VPLV VVA A LVKVKK AAV  VTV
    14   14 L S    >   -     0   0   47  491   29      SS S S SSSSAPSTS   SSS    PASSSSSSSS    SSFS SSS S SSATSS SSS  SSS
    15   15 L V  T 3  S+     0   0   76  491   66      LP A V LVLPVVPPV   HRP    VVLLLLPPPP    LVPL LLL V PPLPQQ QAP  PQR
    16   16 L G  T 3  S+     0   0   42  491    4      GG G G GGGGGGGGG   GGG    GGGGGGGGGG    GGGG RGG G GGIKGG GGG  GGG
    17   17 L E    <   -     0   0   71  491   35      DE E E DDDEGSEDD   DDD    GGQQQEQQQE    QEEQ QQD D EEEEEE GEE  EED
    18   18 L T        -     0   0   69  491   62      RK K K QRTRSIRTT   RRR    TTRRRRKKKR    RTRR RRR R RTKKTT TRR  PTR
    19   19 L V  E     - L   0  75D  11  491   37      VV V V AVVAVVVVV   VVV    VVAAAAVVVA    AVAA AAV V AVVVVV VVV  AVV
    20   20 L T  E     - L   0  74D  67  490   30      XT T T STTTTATTt   TTT    TTTTTTTTTT    TRTT TTT T TTTTTT TTS  STT
    21   21 L I  E     - L   0  73D   1  489   17      XM M L ILILIIIIi   III    IIIIIIMMML    IILI III L LFIIII IML  IIL
    22   22 L T  E     -KL   7  72D  29  489   58      XT S S SNTSNNSSS   NTN    KKSSSNTTTS    SRSS SSS N STTTNN NSN  SST
    23   23 L a  E     -KL   6  71D   0  490    1      CC C C CCCCCCCCC   CCC    CCCCCCCCCC    CCCC CYC C CCCCCC CCC  CCC
    24   24 L R  E     -KL   5  70D 110  490   45      SS K K RKRRQQKRR   KKK    QQKKRRSSSR    RLRR RRR K RKRRKK KKK  RQR
    25   25 L A  E     -K    4   0D  10  490   29      AA S S SAAAAAAAA   AAA    ASAAASAAAA    AAAA AAA A AAAAAA AAS  SAA
    26   26 L S  S    S+     0   0   66  490    4      SS S S SSSSSSSSS   SSS    SSSSSSSSSS    SSSS SSS S SSSSSS SSS  SSS
    27   27 L E  S    S-     0   0  101  490   38      QS Q Q QQQQQQQQQ   QQS    QQQQQQSSSQ    EDQE EKQ Q QSQQQQ QQQ  QQQ
    28   28 L N        +     0   0   83  490   45      GS S S SNDSSSSDS   DHS    SSSSSSSSSS    SFSS SSD N SSSSSS SGS  SGG
    29   29 L I    >   -     0   0    5  491   32      IV V L IIVVIIVII   IIL    IIVVVVVVVV    VLVV VII I VVIIVV LIL  LII
    30   30 L Y  T 3   -     0   0  155  491   81      SS l l vYGSSgsSS   GSt    YGddslSSSS    eFsd dsS Y SGSGSS ySy  eSS
    31   31 L S  T 3  S+     0   0   53  467   65      N. n n tKISNssKN   GNn    STsssn...N    sNss ssN K SSTSSN dNn  nNN
    32   32 L Y    <   +     0   0   63  490   52      XY Y Y YNYSEYYYY   YSY    GYYYYYYYYY    LGYF FYY N SWNSYY LYY  FYY
    33   33 L L  E     -O   90   0E   0  490    7      XV L L LLVLLLLLL   LLL    LLMMMLMMML    MVLM MML L LILLLL LLL  LLL
    34   34 L A  E     -O   89   0E   0  490   71      XY A A EENASSHNH   HHA    AANNHAHHHA    QSAN HHN E AAHHNS AHA  SNH
    35   35 L W  E     -OP  88  48E   1  491    0      WW W W WWWWWWWWW   WWW    WWWWWWWWWW    WWWW WWW W WWWWWW WWW  WWW
    36   36 L Y  E     -OP  87  46E   0  491    9      FY Y Y YYFYYYYYY   YYY    YYYYYYYYYY    YYYF YNY Y YYHYYY HYY  YYY
    37   37 L Q  E     -OP  86  45E   7  491   28      QL Q Q LQQQQQQQQ   QQQ    QZQQQQQQQQ    QQQQ QQQ Q QQQQQQ QQQ  QQQ
    38   38 L Q  E     -O   85   0E  21  491    4      QQ Q Q QQQQQQQQK   QQQ    ZZQQQQQQQQ    QQQQ QQQ Q QQQQQQ QQQ  QQQ
    39   39 L K    >   -     0   0   51  490    9      KK K K KKKKKKKKK   KKK    KKKKKKKKKK    KKKK KKK K KKKKKK KKK  KKK
    40   40 L Q  T 3  S+     0   0  190  491   19      PP P P PHPPPPPHP   LPR    PPPPPPSSSP    PPPP PPP H PSPPPP PAP  PPP
    41   41 L G  T 3  S+     0   0   86  491   10      DG G G GGGGGGGGG   GGG    GGGGGGGGGG    GEGG GGD G GGNDGG GGG  GGG
    42   42 L K  S <  S-     0   0  126  490   54      GS Q Q QEKQQQQQQ   QQQ    QQQQQQTTTQ    QKQQ QQG E QQQQQQ QQQ  QQQ
    43   43 L S        -     0   0   21  490   55      TS S S SASAPPASA   AAT    PPPPPASSSV    PPAP SPT A AAASAA AAS  SAA
    44   44 L P        -     0   0    4  490   11      VP P P PPPPPPPPP   PPP    PPPPPPPPPP    PPPP PPV P PPPPPP PPP  PPP
    45   45 L Q  E     -P   37   0E  74  490   32      KR K K KKRRKKRKK   KKQ    KKKKKKKKKR    KTRK KRK K KKKKKK KRK  QKK
    46   46 L F  E     +P   36   0E  25  490   42      LL L L LLHLLLLLL   LLL    LLLVLLRRRL    LLLL LLL L LLLLLL QLL  LLL
    47   47 L L  E     +     0   0E   4  490    9      LL L L LLMLLLLLL   LLL    LLLLLLWWWL    LLLL LLL L LLLLLL LLL  LLL
    48   48 L V  E     -PQ  35  54E   0  491    5      II I I IIIIIIIII   III    IIIIIFIIII    IIII III I IIVIII III  III
    49   49 L Y  E >> S+ Q   0  53E  39  491   17      YY Y Y YYYYYYYYS   RRY    YYYFKSYYYY    YSYY YYY Y YYKKYY YRS  YYN
    50   50 L N  T 34 S-     0   0   52  491   91      YD W W KYRGLRRNY   HYG    KRAAYWDDDR    AGGA RVY Y GLYYGK YYW  EYG
    51   51 L A  T 34 S+     0   0    3  491   45      TT A A VTAAAAATA   AAA    AAAAAATTTA    AATA AVT T AAAAAA AAA  ANA
    52   52 L K  T <4 S+     0   0  148  491   25      SS S S SNTSSSSNT   TNS    SSSSSSSSSS    SSSS SSS N SSSSSS STS  TNS
    53   53 L T  E  <  -Q   49   0E  47  491   67      SN T A NNNSTTNNS   STT    TTNNNTKKKN    NDSN NNR N STQQDS TTN  NSS
    54   54 L L  E     -Q   48   0E  60  491   60      LL R R RLLRLLLLL   LLR    LLLLLRLLLR    VLRQ LLL L RRTSRR RLR  RLL
    55   55 L G    >   -     0   0    9  490   71      XA E E FQAAAAEHA   QEA    AAEEEEAAAT    EEAG EEH Q AHIIAA AHE  ALQ
    56   56 L E  T 3  S+     0   0  192  490   35      SS S S STDTSSSSS   SSS    SSSSSSSSST    STTS SSS T TTSSSS SSS  SSP
    57   57 L G  T 3  S+     0   0   70  491    5      GG G G GGGGGGGGG   GGG    GGGGGGGGGG    GGGG GGG G GGGGGG GGG  GGG
    58   58 L V    <   -     0   0   25  489   11      VV V V VIVIVVVIV   VVI    VVIIVVVXVI    VVIV VVV I ITVVVV VVV  VVV
    59   59 L P    >   -     0   0   47  490    7      PP P P PSPPPPPPP   PPP    SSPPPPPPPP    PPPP PPP S PPPPPP PPP  PPP
    60   60 L S  T 3  S+     0   0  115  491   57      SV D D DSSDSSASS   SSD    SSAAADAAAD    APDA AAS S DESSDD DAD  DLS
    61   61 L R  T 3  S+     0   0   44  491    4      RR R R RRRRRRRRR   RRR    RRRRRRRRRR    RRRR RRR R GRQRRR RRR  RRR
    62   62 L F  E <   +M   75   0D   5  491    1      FF F F FFFFFFFFF   FFF    FFFFFFFFFF    FFFF FFF F FIFFFF FFF  FFL
    63   63 L S  E     -M   74   0D  55  490   22      SS T T SSSSKSSSS   SSS    KKSSSSSSXS    SSSS SSS S SSSSSS SSS  SSS
    64   64 L G  E     +M   73   0D  13  491    2      GG G G GGGGGGGGG   GGG    GGGGGGGGGG    GGGG GGG G GGGGGG GGG  GGG
    65   65 L S  E     +M   72   0D  63  491    5      SS S S SSSSSSSSS   ISS    SSSSSSSSSS    SSSS SSS S SSSSSS SSS  SSS
    66   66 L G  E     -M   71   0D  36  491   14      GG G G GGRGGGGGG   GGG    GGGGGGGGGG    GGGG GGG G GGGGGG GGG  GRG
    67   67 L S  E >   +M   70   0D  79  491    9      SS S S SSSSSSSSS   SYS    SSSSSSSSSS    SSSS SSS S SSSSSS SSS  SSS
    68   68 L G  T 3  S-     0   0   16  491   13      GG G G GGGGGGGGG   GGG    GGGGGGAAAG    GGEG RGG G GGGGGG GGG  GGG
    69   69 L T  T 3  S+     0   0   67  488   13      XT T T TTSTTTTTT   TTT    TTTTTTTTTT    TTTT TTT T TTTTTT TTT  TTT
    70   70 L Q  E <   +LM  24  67D 110  489   27      DS D D DDDEEQDDD   DDD    EEDDDDSSSD    DDDD DDD D EDDDDD DDD  DDD
    71   71 L F  E     -LM  23  66D   2  491    6      YY F F FYYFFFFYF   FFF    FFFFFFYYYF    FYFF FFY Y FFFFFF FFF  FYF
    72   72 L S  E     -LM  22  65D  26  491   30      SS T T TTSTTTTTT   TTT    TTTTTTSSST    STTS TTS T TTTTTT TST  TST
    73   73 L L  E     -LM  21  64D   0  491    2      LL L L LLLLLLLLL   LLL    LLLLLLLLLL    LLLL LLL L LLLLLF LLL  LLL
    74   74 L K  E     -LM  20  63D  97  491   39      TT T S KTTTTTTTT   TTT    TTNNNTTTTT    NTTN TDT T TTTTTT TTT  KTT
    75   75 L I  E     -LM  19  62D   0  491    1      II I I IIIIIIIII   III    IIIIIIIIII    IIII III I IIIIII III  III
    76   76 L N  S    S-     0   0   86  491   30      SS S S SSSSSSSSS   SIS    SSHHHPTTTS    HGSH DHS S SSSNNS SSS  SSS
    77   77 L S  S    S-     0   0   58  491   62      NR S S RSSSDSSSG   SSR    DGPPPGSSSR    PGRP PPN S SRSSNN NNS  RSS
    78   78 L L        -     0   0    0  491   27      LM V V VLLLLMLVL   LLV    LVVVVLMMML    VVLM VVL L LMLLFF FVL  VLL
    79   79 L L    >   -     0   0   67  491   31      EE Q K EQEEEQEEK   EEE    EEEEEQQQQD    EQEE EEE Q EEEEQQ QEQ  EEE
    80   80 L P  G >  S+     0   0   92  491   58      PA A T APSPCCPTP   PPV    CCEEEAAAAP    EAPE AEQ P PAPAAP AAA  APP
    81   81 L E  G 3  S+     0   0  102  491   13      EE E E EEEEADEEE   EED    AAEEEEEEEE    DEED DEE E EEEEDE EEE  EEE
    82   82 L D  G <  S+     0   0    1  491    5      DD D D DDDDDDDDD   DDD    DDDDDDDDDD    DDDD DDD D DDDDDD DDD  DDD
    83   83 L F    <   +     0   0   29  490   72      IA L L LVVFADAAF   AAA    AAAADVAAAF    IAFT AAI V VAVAAA AAV  AVV
    84   84 L G  E    S- R   0 105E  17  491   23      AA A A GAAAAAAGA   AAG    AAAAAAAAAA    AAAA AAA A GAAAAA AAA  GAA
    85   85 L S  E     -OR  38 104E  24  491   63      TT V V VTDVTTHVT   TTD    TTTTAVTTTV    MTVM TTT T VDTTVV VVA  VTN
    86   86 L Y  E     -OR  37 103E   0  491    0      YY Y Y YYYYYYYYY   YYY    YYYYYYYYYY    YYYY YYY Y YYYYYY YYY  YYY
    87   87 L Y  E     -O   36   0E   5  490    4      YY Y Y YYHYYYYYH   FHY    FYYYYYYYYY    FYYF YYF Y YYYYYY YYY  YFD
    88   88 L a  E     -O   35   0E   0  491    0      CC C C CCCCCCCCC   CCC    CCCCCCCCCC    CCCC CCC C CCCCCC CCC  CCC
    89   89 L Q  E     -OS  34  99E   0  489   48      QQ H Q FYLQQQQFQ   QQQ    ZQQQQQQQQQ    QLQQ QQQ Y QQQQLQ QQQ  QLQ
    90   90 L H  E     -O   33   0E  22  483   26      QQ Q Q QQQKSNQQQ   QQQ    GGQQHQQQQQ    QGQQ QRQ Q QQQQQQ QQQ  QQQ
    91   91 L H        +     0   0    0  421   89      YW   Y GYYYYLYHS   GSS    STSSSYWWWY    SGYS DIG Y DLSSYS GYY  HNY
    92   92 L Y  S    S+     0   0  104  454   88      ST   Y SNDSYNKKN   YSY    TYNNWYSSSG    RYGK NRS N YYNSNY YDY  KDS
    93   93 L G  S    S-     0   0   34  422   71      KS   S HSESGKSSS   SFE    YYEEERSSSS    KSSE EET S SNSSDN NNS  EDS
    94   94 L T  S    S-     0   0  104  446   88      FY   Y FGYSSSYWA   FYT    GZDDIINNNS    VGSV DAL G WFNLEN TYF  SLY
    95   95 L P  S    S+     0   0    7  443   51      PP   P PPPPSSPPP   PPP    GSPPPPPPPP    PSIP PYP P PPPPPP PAP  PPP
    96   96 L P  S    S-     0   0   55  421   75      WF   L YHPPALlFS   RPL    GALWLYLLLP    WaFA YTP H PLPHPP PPP  PPP
    97   97 L L        -     0   0   21  160   88      ..   . ......q..   T..    ..........    .l.R ... . ...... ..Q  ...
    98   98 L T        -     0   0   40  288   41      TT   T TGT...C..   V.T    YSTTTTTTT.    TTTT T.. . .TT... ..C  ...
    99   99 L F  B     -S   89   0E  18  290   29      FF   F FFV...F..   I.R    FFFFFFFFF.    FFFF FF. . .HV... ..F  ...
   100  100 L G        -     0   0    3  294   39      GG   G GAI..KS..   Q.G    GGGGGGGGG.    GGGG GG. G .RL... ..S  ...
   101  101 L G        -     0   0   52  307   63      GS   A GQQTGYQ..   ATE    GGASAQAAST    GAPG SG. E TGQ... ..   .TT
   102  102 L G        -     0   0   11  306   43      GG   G GLGVAGK..   MVE    GGGGGGGGGV    GGGG GG. G VGN..P ..   .VV
   103  103 L T  E     - R   0  86E   0  366   18      TT   T TTSITKSTT   TTT    TTTTTATTTI    TTTT TTT S ITMTTT TT   TTT
   104  104 L K  E     -nR  10  85E  98  363   58      KK   K KKKQVKCV    KQM    EEKKKKKKKQ    KNKK KKM S RGKVVV VV   VQQ
   105  105 L L  E     -nR  11  84E   4  343   37      LL   L LQILLLLL    TAP    VVLLL LLLL    LVVL LLI T HVILLL LL   IAT
   106  106 L E  E     -n   12   0E 108  326   51      EE   V ER EQSHQ    SIT    VVEE  XEEE    EEDE EE  L ENKQQQ QQ   QMM
   107  107 L I  E      n   13   0E 113  301   50      IL   L IS T VI     QTP    VVLI  LLXI    IIII II  A RIVPPA PP    TT
   108  108 L K              0   0  145  268   18      KK   K KK K  Q     KKK    KKKK  KKK     KKKK     K K KRRR RR    KK
   109      ! !              0   0    0   0     0  
   110    1 H E              0   0  194  408   30  QQQQ  E Q D         QQE                 QQQQ    Q   Q        E   QD   
   111    2 H V        +     0   0   19  465   12  VVVV  V V V         VVV                 VVVV    V   V        V   VI   
   112    3 H K  E     -A  134   0A 111  467   31  QQQK  Q Q Q         ZQQ                 QQQQ    Q   Q Q      Q   QQ   
   113    4 H L  E     -A  133   0A   3  489    1  LLLL  L L L         LLL                 LLLL    L   L L      L   LL   
   114    5 H Q  E     -A  132   0A  83  493   70  QQQH  V V Q         VQQ                 QQQQ    Q   I V      V   QV   
   115    6 H E  E     +A  131   0A   5  498   21  QQQQ  E Q E         ZQQ                 QQQQ    E   Q E      E   QE   
   116    7 H S  E     +A  130   0A  69  501   13  PPPS  S S S         SPS                 LPPP    S   S S      S   SS   
   117    8 H G        +     0   0   36  505    4  GGGG  G G G         GGG                 GGGG    G   G G      G   GG   
   118    9 H G        +     0   0   29  672   48  AAAP  A A P         GAP   PAAP          AAAA    P   S G      G   PG   
   119   10 H D        -     0   0   96  677   40  EEEE  E E D         GEE   GEEG          EEEE    E   E D      D   ED   
   120   11 H L  E     +e  224   0B  79  675   16  LLLV  V V L         ALL   LLLL          LLLL    L   L L      L   LV   
   121   12 H V  E     -e  225   0B  16  677   33  VVVV  K K V         VVV   VVMV          VVVV    V   R R      G   KK   
   122   13 H Q    >   -     0   0  114  679   51  RKKK  K K K         ZKK   AKKA          KKKK    K   K Q      K   KR   
   123   14 H P  T 3  S+     0   0   66  678    9  PPPP  P P P         PPP   PPPP          PPPP    P   P P      P   PP   
   124   15 H G  T 3  S+     0   0   58  682   32  GGGG  G G S         GGG   SGGS          GGGG    G   G G      G   GA   
   125   16 H G    <   -     0   0   25  684   63  SAAA  A A Q         RAA   QAAQ          AAAA    A   A G      G   EE   
   126   17 H S        +     0   0   78  683   31  SSSS  S S S         SSS   SSSS          SSSS    S   S S      P   TS   
   127   18 H L  E     - B   0 192A  25  685   25  VVVV  V V L         LVV   LVVL          VVVV    V   V L      L   VL   
   128   19 H K  E     - B   0 191A  93  683   56  KKKK  K K S         RKK   SKKS          KKKK    K   K R      T   KR   
   129   20 H L  E     - B   0 190A   0  688   14  LLLL  V V L         LLM   ILII          LLLL    M   V L      L   IL   
   130   21 H S  E     -AB 116 189A  28  688   37  SSSS  S S T         SSS   TSST          SSSS    S   S S      S   SS   
   131   22 H b  E     -AB 115 188A   0  688    0  CCCC  C C C         CCC   CCCC          CCCC    C   C C      C   CC   
   132   23 H A  E     -AB 114 187A  52  688   66  KKKK  K K T         AKK   TTKT          KKKK    K   K K      V   KQ   
   133   24 H A  E     +A  113   0A   8  688   49  AAAA  A A V         AAA   VAAV          AAAA    A   A A      A   AG   
   134   25 H S  E     +A  112   0A  58  688   12  SSSS  S S T         SSS   SSTS          SSSS    S   S S      S   SS   
   135   26 H G  S    S+     0   0   56  688    4  GGGG  G G g         GGG   GGGG          GGGG    G   G G      G   GG   
   136   27 H F  S    S-     0   0   33  686   34  YYYY  Y Y s         FYY   FFYF          YYYY    Y   Y L      F   YY   
   137   28 H T    >   -     0   0   93  687   50  TTTI  T T I         STT   SNTS          TTTT    K   T T      T   PN   
   138   29 H F  G >  S+     0   0    2  688   41  FFFF  F F T         FFF   LIFL          FFFF    F   F Y      F   FF   
   139   30 H S  G 3  S+     0   0   57  688   55  TTTT  S T S         STT   TKSS          TTTT    S   T S      S   TG   
   140   31 H S  G <  S+     0   0   71  688   60  SSSS  S S G         TSD   SDSR          SSSS    S   N S      N   ND   
   141   32 H Y  S <  S-     0   0   44  688   41  YYYY  Y Y Y         YYY   YTYY          YYYY    S   Y Y      Y   YY   
   142   33 H T        -     0   0   30  688   91  WWWD  Y A T         AWY   GYWS          WWWW    V   A Y      A   GH   
   143   34 H M  E     -FG 207 160C   0  672   46  MMMI  M M W         MMM   VMIV          MMMM    M   L M      M   MM   
   144   35 H S  E     -FG 206 159C   0  685   73  HHHD  H H H         HHK   HHEH          QHHH    H   N H      N   NS   
   145   36 H W  E     +FG 205 158C   0  688    0  WWWW  W W W         WWW   WWWW          WWWW    W   W W      W   WW   
   146   37 H V  E     -FG 204 156C   0  688   19  VVVV  V V I         VVV   VVVV          VVVV    V   L V      T   VI   
   147   38 H R  E     -FG 203 155C  10  688   17  KKKR  R R R         RKK   RKKR          KKKK    K   R R      R   KR   
   148   39 H Q  E     -FG 202 154C   9  688    3  QQQQ  Q Q Q         QQQ   QQQQ          QQQQ    Q   Q Q      Q   QQ   
   149   40 H T    >   -     0   0    9  688   68  RRRT  A A F         ARS   PRRP          RRRR    K   A A      Y   AA   
   150   41 H P  T 3  S+     0   0   80  687   10  PPPP  P P P         PPH   PPPP          PPPP    A   P P      P   PP   
   151   42 H E  T 3  S-     0   0  151  688   26  GGGE  G G G         GGG   GEGG          GGGG    G   G G      G   GG   
   152   43 H K    <   +     0   0  121  688   32  RRRQ  Q Q N         KRK   KQHK          QRRR    Q   Q K      K   QK   
   153   44 H R        -     0   0  113  687   43  GGGG  G R K         GGS   GGGG          GGGG    G   G G      G   GG   
   154   45 H L  E     -G  148   0C   9  688   14  LLLL  L L L         LLL   LLLL          LLLL    L   L L      L   LL   
   155   46 H E  E     -G  147   0C  44  687    5  EEEE  E E E         ZEE   EEEE          EEEE    E   E E      E   KE   
   156   47 H W  E     +G  146   0C  15  687   11  WWWW  W W W         WWW   WWWW          WWWW    W   W W      W   WW   
   157   48 H V  E     -     0   0C   0  687   28  IIII  M M M         LII   LIIL          IIII    I   M V      L   MI   
   158   49 H A  E     -G  145   0C   0  688   38  GGGG  G G A         SGG   GGGG          GGGG    G   G A      A   GA   
   159   50 H S  E     -GH 144 168C   0  688   94  RRRW  I W Y         VRD   VREM          ERRR    Y   W R      V   WY   
   160   51 H I  E     -GH 143 167C   4  675   18  IIII  I I I         III   IIII          IIII    I   I V      M   II   
   161   52 H N    >   -     0   0   47  682   84  DDDF  N N H         SDN   WDLW          DDDD    N   N Y      R   NS   
   162   53 H N  T 3  S+     0   0   65  684   88  PPPP  P A Y         YPP   APPG          PPPP    P   T H      Y   TY   
   163   54 H G  T 3  S-     0   0   65  686   68  NNNG  S G S         BNN   GAGG          SNNN    Y   N D      D   SN   
   164   55 H G  S <  S+     0   0   30  687   43  SSSE  G N G         GSN   GNSG          DSSS    N   T G      G   TG   
   165   56 H G  S    S+     0   0   74  688   63  GGGG  G G N         BGG   SGGS          SGGG    D   G N      S   GN   
   166   57 H R        +     0   0  163  505   86  GGGS  S N .         BGG   .NS.          YGGG    V   K Y      Q   ET   
   167   58 H T  E     -H  160   0C  62  677   52  TTTT  T T T         ZTT   TTTT          TTTT    T   A I      Q   SQ   
   168   59 H Y  E     +H  159   0C  53  686   85  KKKE  S K D         YKS   NKND          NKKK    K   T G      Y   TY   
   169   60 H Y        -     0   0   44  688    9  YYYY  Y Y F         YYY   YYYY          YYYY    Y   Y Y      Y   FY   
   170   61 H P    >>  -     0   0   20  688   65  NNNN  A S N         ANN   NDNN          NNNN    N   A A      V   AA   
   171   62 H D  T 34 S+     0   0  148  688   64  EEEE  Q Q P         AEQ   SPES          QEEE    G   Q D      D   DD   
   172   63 H T  T 34 S+     0   0   90  688   57  KKKK  K K S         SKK   AKKA          KKKK    K   A S      S   DV   
   173   64 H V  T X> S+     0   0    1  688   42  FFFF  F F L         VFF   LFFL          FFFF    F   F V      L   FV   
   174   65 H K  B 3< S+c  177   0A 142  687   31  KKKK  Q Q K         KKK   MQKK          KKKK    K   T K      K   KK   
   175   66 H G  T 34 S+     0   0   74  687   36  SSSG  G G S         GSG   SGGS          GSSS    G   G G      G   GG   
   176   67 H R  T <4 S+     0   0   36  688   17  KKKR  R R R         RKK   RKKR          KKKK    K   R R      Q   RR   
   177   68 H F  E  <  -cD 174 192A   2  688   60  AAAA  V V I         FAA   LAAL          AAAA    A   F F      F   FF   
   178   69 H T  E     - D   0 191A  79  688   38  TTTT  T T S         TTT   STTS          TTTT    T   V T      T   DT   
   179   70 H I  E     + D   0 190A   5  688   20  LLLL  M I I         ILL   IIFI          LLLL    L   F I      I   FI   
   180   71 H S  E     - D   0 189A  51  684   41  TTTS  T T T         STT   STTS          TTTT    T   S S      S   SS   
   181   72 H R  E     - D   0 188A  30  687   60  VVVV  R R R         RVV   KAAK          VVVV    S   L W      R   LR   
   182   73 H D  E > > - D   0 187A  60  686    7  DDDD  D D D         BDD   DDDD          DDDD    D   D D      D   EN   
   183   74 H N  G > 5S+     0   0   48  688   57  KKKK  T T T         BKK   NTTN          TKKK    K   T K      N   TN   
   184   75 H A  G 3 5S+     0   0   99  688   45  PPPS  S S S         SPS   SSSS          SPPP    S   S A      S   SP   
   185   76 H K  G < 5S-     0   0  111  688   51  SSSS  T A K         KSS   KSSK          SSSS    S   V N      K   AS   
   186   77 H N  T < 5 +     0   0   62  688   46  SSSS  S S N         BSS   SNNS          SSSS    S   S S      H   NS   
   187   78 H T  E   < -BD 132 182A  16  688   69  TTTT  T T Q         TTT   QTTQ          TTTT    T   T L      I   TM   
   188   79 H L  E     -BD 131 181A   0  687   56  AAAA  V A F         MAA   VAAV          AAAA    A   T L      V   AL   
   189   80 H Y  E     -BD 130 180A  41  687   46  YYYY  Y Y F         YYY   FYYF          YYYY    Y   Y S      Y   YY   
   190   81 H L  E     -BD 129 179A   0  687    7  MMMM  M M L         LMM   LLML          MMMM    M   L L      L   LL   
   191   82 H Q  E     -BD 128 178A  76  687   41  QQQE  E E Q         EQQ   KQQK          QQQQ    E   Q Q      Q   QQ   
   192   83 H M  E     +BD 127 177A   0  688   11  LLLL  L L L         MLL   MLLM          LLLL    L   I M      M   IM   
   193   84 H S        +     0   0   42  688   54  SSST  S S N         NSN   NSSN          SSSS    S   S N      E   NN   
   194   85 H S  S    S-     0   0   68  687   24  SSSR  S S S         SSS   SSSS          SSSS    S   S S      S   NG   
   195   86 H L        -     0   0    3  686   18  LLLL  L L V         LLL   LLLL          LLLL    L   L L      L   LL   
   196   87 H K    >   -     0   0  102  686   68  TTTT  R R T         RTT   QTTQ          TTTT    T   K K      R   KK   
   197   88 H S  G >  S+     0   0   70  686   60  SSSS  S S A         ASS   TSST          SSSS    S   A T      T   ST   
   198   89 H E  G 3  S+     0   0  126  687   22  EEEE  E E E         EEE   DEED          EEEE    E   E E      R   EE   
   199   90 H D  G <   +     0   0    2  687    3  DDDD  D D D         NDD   DDDD          DDDD    D   D D      D   DD   
   200   91 H T    <   +     0   0   32  688   28  SSSS  T T T         TSS   TTST          SSSS    S   T T      T   MT   
   201   92 H A  E    S- I   0 223C   8  686    5  AAAA  A A A         AAA   AAAA          AAAA    A   A A      A   AA   
   202   93 H M  E     -FI 148 222C  58  687   48  VVVV  V V T         VVV   MVVM          VVVV    V   V L      M   TM   
   203   94 H Y  E     -FI 147 221C   0  688    1  YYYY  Y Y Y         YYY   YYYY          YYYY    Y   Y Y      Y   YY   
   204   95 H Y  E     -F  146   0C   7  688    4  YYYF  Y Y Y         YYY   YYYY          YYYY    Y   F Y      R   FY   
   205   96 H b  E     -F  145   0C   0  688    1  CCCC  C C C         CCC   CCCC          CCCC    C   C C      C   CC   
   206   97 H V  E     -FJ 144 217C   0  688   23  AAAA  A A A         AAA   AAAA          AAAA    A   A A      N   AA   
   207   98 H R  E     -FJ 143 216C  21  687   40  rrRR  r r r         rRr   rrrr          SrRR    R   R t      h   Rr   
   208   99 H H  E     + J   0 214C   6  583   92  ss.G  p y y         gYy   wgrp          .yY.    S   . e      a   Wr   
   209  100 H E  E  >  + J   0 213C  63  625   78  SS.D  A S G         TDD   PDGK          HGD.    A   D T      P   EG   
   210  101 H Y  T >4 S-     0   0   80  658   93  FFIY  A G N         DYW   YAST          YDY.    Y   R T      G   VS   
   211  102 H Y  T 34 S-     0   0  140  672   23  YYYy  F y Y         YyY   YMFY          yYyW    y   W f      F   yF   
   212  103 H Y  T 34 S+     0   0   39  265   92  ...r  S r Y         .s.   ..Y.          s.s.    d   . a      K   g.   
   213  104 H A  E <<  -J  209   0C   0  403   87  AAAY  R P A         .Y.   A.AA          SAY.    G   . C      G   Y.   
   214  105 H M  E     +J  208   0C   0  497   62  MMGF  F H M         .FF   M.MM          SMF.    I   N Q      L   V.   
   215  106 H D  E     +     0   0C  19  615   50  DDDD  D D D         .DD   DDDD          DDDD    A   D K      A   P.   
   216  107 H Y  E     -J  207   0C  99  624   65  YYYL  Y Y Y         .YV   YYYY          YYYY    Y   Y L      S   Y.   
   217  108 H W  E     -J  206   0C  23  675    2  WWWW  W W W         WWW   WWWW          WWWW    W   W W      Y   WW   
   218  109 H G        -     0   0    0  664   17  GGGG  G G G         GGG   GGGG          GGGG    G   G E      A   GK   
   219  110 H Q        -     0   0   91  659   46  QQQQ  Q Q Q         ZQA   QQQQ          QQQQ    Q   Q D      H   QR   
   220  111 H G        -     0   0   16  650   16  GGGG  G G G         GGG   GGGG          GGGG    G   G S      G   GN   
   221  112 H T  E     -I  203   0C  21  594   27  TTTT  T T T         TTT   TTTT          TTTT    T   T .      T   TG   
   222  113 H T  E     -I  202   0C  72  593   76  SSST  L L S         LTT   SSSS          TSTT    T   Q .      I   TM   
   223  114 H V  E     -I  201   0C   0  596   20  VVVV  V   V         VLV   VVVV          LVLL    V   V .      Q   VV   
   224  115 H T  E     -e  120   0B  36  593   20  TTTT  T   T         TTT   TTTT          TTTT    T   T .      S   T    
   225  116 H V  E     +e  121   0B   6  572    6  VVVV  V   V         IVV   VVVV          VVVV    V   V .      I   V    
   226  117 H S        -     0   0   36  566   11  SSSS  S   S         SSS   SSSS          SSSS    S   S .      S   S    
   227  118 H S  S    S+     0   0   84  551   22  SSSS  S   S         SSS   SSSS          SSSS    S   S .          S    
   228  119 H A  S    S+     0   0   70  123   53     G      A                                     G     .          A    
   229  120 H W        -     0   0  123   73   63            K                                           W               
   230  121 H R        +     0   0  207   60   75            T                                           A               
   231  122 H H              0   0  156   54   67            T                                           A               
   232  123 H P              0   0  155   35   53            P                                           A               
## ALIGNMENTS  771 -  840
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....8....:....9....:....0....:....1....:....2....:....3....:....4
     1    1 L D              0   0  183  420   16  Q   D DDDZDND D     D D DDDDDDDEDDEDDQE DDD    EED                    
     2    2 L I        -     0   0   32  462   11  I   IIIIVIIII I I   I I IVIVIIIIIIVIPII III    IIT                    
     3    3 L E        -     0   0  117  463   68  V   QVVVVVVVL V V   V E VVQVVVMVVVVVMVV IVV    VTV                    
     4    4 L L  E     -K   25   0D  10  474    7  L   MMMMMLLLM M M   L L MMMLMLMMMMLMLML MMM    LMM                    
     5    5 L T  E     -K   24   0D  64  475    8  T   TTTTTTTTT T T   T T TTNTTTTTTTTTTTT TTT    TIT                    
     6    6 L Q  E     -K   23   0D  13  475    0  Q   QQQQQZQQQ Q Q   Q Q QQQQQQQQQQQQQQQ QQQ    QQQ                    
     7    7 L T  E    S+K   22   0D  64  475   34  T   STTTTSSSS A S   S S STTTTSSSSSSTTTS STS    SSS                    
     8    8 L P        -     0   0   46  480    9  P   PPPPPPPPQ T P   P P PPPPPPPPPPPPAPP PPP    PSP                    
     9    9 L V  S    S+     0   0   96  484   67  E   SSLLLGAAK P L   A L LLSVLADAGDALSPG ALL    GSE                    
    10   10 L S  E     -n  104   0E  60  485   43  S   SSSSSTSSF S S   S T SSTTSSSTSSSSPST SSS    SSS                    
    11   11 L L  E     -n  105   0E  58  489   21  L   LKLLLLLLL V L   L L LLLLLLLLLLVLVVL LLL    LLL                    
    12   12 L S  E     +n  106   0E  60  490   42  A   SSSPPSAAS S P   A S PSSLPTASAASPSSS APP    ASS                    
    13   13 L A  E     -n  107   0E   0  490   58  V   AVVVVLVVT V V   V V VVVIVVVLVVVVAGL AIV    AVV                    
    14   14 L S    >   -     0   0   47  491   29  S   TPSTSSSSS T S   S T TSSSTSSSSSSTAAS STT    SSS                    
    15   15 L V  T 3  S+     0   0   76  491   66  P   VVPPLPLLV P L   L I PLIIPPLPVLLPVVP PPP    QRA                    
    16   16 L G  T 3  S+     0   0   42  491    4  G   GGGGGGGGG G G   G G GGGGGGGGGGGGGGG GGG    GGG                    
    17   17 L E    <   -     0   0   71  491   35  D   DDEEDZQQD E D   Q Q EDEGEQEEDEEESGE GEE    EDE                    
    18   18 L T        -     0   0   69  491   62  T   RTPPQRRRR S Q   R P PQRQPSRRSRSPTTR MPP    RRS                    
    19   19 L V  E     - L   0  75D  11  491   37  V   VVAAAAAAV V A   A A AAVAAAVAVVVTVVA VAA    VVV                    
    20   20 L T  E     - L   0  74D  67  490   30  T   TTSSSATTS F S   T S SSISSTDTTTTSTTT TSS    TKT                    
    21   21 L I  E     - L   0  73D   1  489   17  I   LIIIILIIV I I   I I IIIIIIMLIIIIIIL III    MII                    
    22   22 L T  E     -KL   7  72D  29  489   58  R   LNSSSSSST S S   S S SSNSSSKSNNKSSNS NSS    TTR                    
    23   23 L a  E     -KL   6  71D   0  490    1  C   CCCCCCCCC C C   C C CCCCCCCCCCCCCCC CCC    CCC                    
    24   24 L R  E     -KL   5  70D 110  490   45  K   EQRRRRRRK R R   R K RRHRRRTRKKKRQQR KRR    TRK                    
    25   25 L A  E     -K    4   0D  10  490   29  A   AASSSAAAA S S   A S SSASSAAASSASAAA AAS    TSA                    
    26   26 L S  S    S+     0   0   66  490    4  S   SSSSSSSSS S S   S S SSSSSSSSSSSSSSS SSS    SSS                    
    27   27 L E  S    S-     0   0  101  490   38  S   QQQQQQEEQ K Q   E Q QQEQQEQQQQQQQEQ QQQ    SES                    
    28   28 L N        +     0   0   83  490   45  S   SSSSSSSSN S S   S S SSNSSNSSSSSSSSS SSS    SDG                    
    29   29 L I    >   -     0   0    5  491   32  L   VVNLLLVVV L L   V L LLILLIVVLLLLVIV LLL    VII                    
    30   30 L Y  T 3   -     0   0  155  491   81  t   lyLlvsvdG l v   d l lvNvlgYSflllySd fll    sSS                    
    31   31 L S  T 3  S+     0   0   53  467   65  q   tnDttnssT t t   s t ntStthHSnnttnNn dtn    sSN                    
    32   32 L Y    <   +     0   0   63  490   52  Y   FRYYYYLFN Y Y   F Y YFWYYNYSYYYYNWY YYY    NYH                    
    33   33 L L  E     -O   90   0E   0  490    7  L   LLLLLLMMV L L   M L LLLLLLLLLLLLLLL LLL    LLI                    
    34   34 L A  E     -O   89   0E   0  490   71  A   AANNNAHHA Y H   H N HQSHYHAAAAEAAAG NDD    HNA                    
    35   35 L W  E     -OP  88  48E   1  491    0  W   WWWWWWWWW W W   W W WWWWWWWWWWWWWWW WWW    WWW                    
    36   36 L Y  E     -OP  87  46E   0  491    9  Y   YFYYYYFYY F Y   Y L YYHFYYYYYHFYFYY YYY    YYY                    
    37   37 L Q  E     -OP  86  45E   7  491   28  Q   QQLLLQQQQ L L   Q L LLQLLQQQQQQLQQQ QLL    QQQ                    
    38   38 L Q  E     -O   85   0E  21  491    4  Q   QQQQQQQQK Q Q   Q Q QQQQQQQQQQQQQQQ QQQ    QQQ                    
    39   39 L K    >   -     0   0   51  490    9  K   KKKKKKKKK R K   K R KKKKKKKKKKKKKKR KKK    KKK                    
    40   40 L Q  T 3  S+     0   0  190  491   19  S   PPAAAPPPP P P   P P PPPPPPPPPPRPPPP PPP    PPS                    
    41   41 L G  T 3  S+     0   0   86  491   10  G   KGGGGGGGG G G   G G GGGGGGGGGGGGGGG GGG    GGG                    
    42   42 L K  S <  S-     0   0  126  490   54  Q   KQQQQQQQQ Q Q   Q Q QQNQQQQQQQKQQQQ QQQ    AQK                    
    43   43 L S        -     0   0   21  490   55  A   APSSSAPPS S S   P S SSASSRAAAAFSPPA ASS    SAA                    
    44   44 L P        -     0   0    4  490   11  P   PPPPPPPPP P P   P P PPPPPPPPPPIPPPP PPP    PPP                    
    45   45 L Q  E     -P   37   0E  74  490   32  K   KKRQKRKKK Q K   K K RKQQQKKRKKKQKKR KQQ    RKK                    
    46   46 L F  E     +P   36   0E  25  490   42  L   LLLLLLLLP L L   L R LLLLLLPLLQSLLPL LLL    LLL                    
    47   47 L L  E     +     0   0E   4  490    9  L   LLLLLLLLL L L   L L LLLLLLLLLILLLLL LLL    LLL                    
    48   48 L V  E     -PQ  35  54E   0  491    5  I   IIPIIMIIM I I   I I IIIIIIIIIIIIIII III    III                    
    49   49 L Y  E >> S+ Q   0  53E  39  491   17  Y   YYEYYYYYY Y Y   Y Y YYYYYSYYYLYYYYY YYY    YYY                    
    50   50 L N  T 34 S-     0   0   52  491   91  L   DKQTKGGLS R K   R L LKKQESSGWWRAAEG LLL    RGE                    
    51   51 L A  T 34 S+     0   0    3  491   45  G   AADLVVAAA L V   A V GVAVVAAAAAVVAAA AGG    TTA                    
    52   52 L K  T <4 S+     0   0  148  491   25  S   SSSSSSSSS F S   S S SSSSSSSSSSSSSSS SSS    SNS                    
    53   53 L T  E  <  -Q   49   0E  47  491   67  S   NTQYNSNNY H N   N K NNNNNNTSSTNYNKS KNN    TST                    
    54   54 L L  E     -Q   48   0E  60  491   60  L   LLRRRRRLR L R   L L RRYRRLRRRRLRLLR RRR    PLR                    
    55   55 L G    >   -     0   0    9  490   71  Q   EAAAFAGEY A F   E D AFHFAGPAAVHAAAA DAA    AED                    
    56   56 L E  T 3  S+     0   0  192  490   35  S   TSSSSTSSS S S   S S SSTSSSSTSSSSSST SSS    SST                    
    57   57 L G  T 3  S+     0   0   70  491    5  G   GGGGGGGGG G G   G G GGWGGGGGGGGGGGG GGG    GGG                    
    58   58 L V    <   -     0   0   25  489   11  V   VVVVVIVVV V V   I V VVVVVVIIVVVVVVV VVV    VVV                    
    59   59 L P    >   -     0   0   47  490    7  P   PPPPPPPPP P P   P P PPPPPPPPSPPPPPP PPP    SPP                    
    60   60 L S  T 3  S+     0   0  115  491   57  S   SSDDDDAAD D D   D D DDSDDADDDDPDSSD DDD    ASD                    
    61   61 L R  T 3  S+     0   0   44  491    4  R   RRRRRRRRR R R   R R RRRRRRRRQRRRRQR RRR    RRR                    
    62   62 L F  E <   +M   75   0D   5  491    1  F   FFFFFFFFF F F   F F FFFFFFFFFYFFFFF FFF    FFF                    
    63   63 L S  E     -M   74   0D  55  490   22  S   SKSSSSSST S S   S T SSSSSSSSSSSSKKS SSS    SSS                    
    64   64 L G  E     +M   73   0D  13  491    2  G   EGGGGGGGG G G   G G GGGGGAGGGGGGGGA GGG    GGG                    
    65   65 L S  E     +M   72   0D  63  491    5  S   SSSSSSSSS S S   S S SSSSSSSSSSSSSSS SSS    SSS                    
    66   66 L G  E     -M   71   0D  36  491   14  G   GGGGGGGGG G G   G G GGGGGGGGGGGGGGG GGG    GGG                    
    67   67 L S  E >   +M   70   0D  79  491    9  S   SSSSSSSSS S S   S S SSSSSSSSSSSSSSS SSS    SSS                    
    68   68 L G  T 3  S-     0   0   16  491   13  G   GGGGGGGRG G G   R G GGGGGGGGGGGGGGG GGG    GGG                    
    69   69 L T  T 3  S+     0   0   67  488   13  T   TTTTTATTT T T   T T TTTTTTTTTTTTTTT TTT    TTT                    
    70   70 L Q  E <   +LM  24  67D 110  489   27  D   DQDDDDDDD A D   D D DDDDDDDEDDDDQQD DDD    SDD                    
    71   71 L F  E     -LM  23  66D   2  491    6  F   FFFFFFFFF F F   F F FFYFFFFFFFFFFFF FFF    YYF                    
    72   72 L S  E     -LM  22  65D  26  491   30  T   TTTTTTSTT T T   T T TTSTTTTTTTTTTTT TTT    STT                    
    73   73 L L  E     -LM  21  64D   0  491    2  L   FLLLLLLLL L L   L L LLLLLLLLLLLLLLL LLL    LLF                    
    74   74 L K  E     -LM  20  63D  97  491   39  T   TTRKKTITT R K   T K KKSKKTTTTTTKTTS TKK    TTT                    
    75   75 L I  E     -LM  19  62D   0  491    1  I   IIIIIIIII I I   I I IISIIIIIIIIIIII III    III                    
    76   76 L N  S    S-     0   0   86  491   30  N   SSGSSSHDS S S   D S SSSSSNSSSSSSNSS SSS    SSS                    
    77   77 L S  S    S-     0   0   58  491   62  R   GDRRRRPPN R R   P R RRSRRPNSSSSRGGR NRR    SSR                    
    78   78 L L        -     0   0    0  491   27  V   LVVVVLMVV V V   V V VMLVVVFLLLLVVVL FVV    ILV                    
    79   79 L L    >   -     0   0   67  491   31  E   ZQEQEZEEQ E E   E E EEQEEEQEQQEEQQE QQE    EEE                    
    80   80 L P  G >  S+     0   0   92  491   58  A   PCAAAPEAS A A   A A AAPPAEAPAAAACCP AAA    APA                    
    81   81 L E  G 3  S+     0   0  102  491   13  E   ZAEEEEDDE E E   D E DEEEETEEEEEEDAE EEE    EED                    
    82   82 L D  G <  S+     0   0    1  491    5  D   BDDDDDDDD D D   D D DDDDDDDDDDDDDDD DDD    DDD                    
    83   83 L F    <   +     0   0   29  490   72  A   FAAVLFSAL V L   V L VLILVAAFVVVVAAF AAV    AVA                    
    84   84 L G  E    S- R   0 105E  17  491   23  G   AAGGGAAAA G G   A G GGAGGAAAAAAGAAA AGG    TAG                    
    85   85 L S  E     -OR  38 104E  24  491   63  D   VTIVIVMTE V V   T V IITVVNVVVIIVTTV VVV    TTD                    
    86   86 L Y  E     -OR  37 103E   0  491    0  Y   YYYYYYYYY Y Y   Y Y YYYYYYYYYYYYYYY YYY    YYY                    
    87   87 L Y  E     -O   36   0E   5  490    4  Y   YYYYFYFYF Y F   Y Y YFYYYYCYCYYYYYY YYY    YFY                    
    88   88 L a  E     -O   35   0E   0  491    0  C   CCCCCCCCC C C   C C CCSCCCCCCCCCCCC CCC    CCC                    
    89   89 L Q  E     -OS  34  99E   0  489   48  Q   QRMMSQHQQ M S   Q W MSVLMQEQQQFMAQQ MMM    QQQ                    
    90   90 L H  E     -O   33   0E  22  483   26  Q   ZVQQQQQQQ Q Q   Q Q QQQQQQQQQQQQAHQ QQQ    QQQ                    
    91   91 L H        +     0   0    0  421   89  T   YARRTYTNF H S   S G ATARGGYYEFHARVY NAA    WEY                    
    92   92 L Y  S    S+     0   0  104  454   88  L   DSSLTGKNN L T   N T LTKTIKYSYHTLYMG YLL    DPN                    
    93   93 L G  S    S-     0   0   34  422   71  S   TTFEHSEER E H   E H QHSHQEGNSSHQSNS DEQ    SQN                    
    94   94 L T  S    S-     0   0  104  446   88  N   LNYIVSVDY Y V   V F SVLNLSNWSAWAGYS DVT    SGW                    
    95   95 L P  S    S+     0   0    7  443   51  P   PNPPPPPPP P P   P P PPPPPPPPPPPPPSF PPP    PHP                    
    96   96 L P  S    S-     0   0   55  421   75  L   SIYYPFWLL Y P   L Q YWPPPPPHPPPPAiG P P    PhL                    
    97   97 L L        -     0   0   21  160   88  T   ......... . .   . . ...  ..T .  .f.        .gT                    
    98   98 L T        -     0   0   40  288   41  V   TVTTTTTTT T T   T T TT.  T.V T  .G.        .PV                    
    99   99 L F  B     -S   89   0E  18  290   29  I   FFFFFFFFF F F   F F FF.   .I F  .S.        .SI                    
   100  100 L G        -     0   0    3  294   39  Q   GGGGGGGGG G G   G G GG.   .Q S  .N.        .SQ                    
   101  101 L G        -     0   0   52  307   63  T   VGQQGQGAS G G   A G QG.   .P    .PQ        .NT                    
   102  102 L G        -     0   0   11  306   43  H   AGGGGGGGG G G   G G GG.   .E    GGG        .GN                    
   103  103 L T  E     - R   0  86E   0  366   18  T   STTTTSTTT T T   T T TTT   TT    STT        TST                    
   104  104 L K  E     -nR  10  85E  98  363   58  K   KERKKKDKK K K   K K KKV   VK     IK        RIK                    
   105  105 L L  E     -nR  11  84E   4  343   37  T   VVLLLLLLL L L   L L LLI   LT     VV         LT                    
   106  106 L E  E     -n   12   0E 108  326   51  S   EVEEEEEEE E E   D E EEK    S     EE         DS                    
   107  107 L I  E      n   13   0E 113  301   50  L   SVVIIIILL I I   L I IIV    T     VI         IL                    
   108  108 L K              0   0  145  268   18      KKRRKK KK K K   K K KK     R     RK         K                     
   109      ! !              0   0    0   0     0  
   110    1 H E              0   0  194  408   30               E Q DEE Q Q                     QE             E         
   111    2 H V        +     0   0   19  465   12               E V VVV V V                   VVVV             V         
   112    3 H K  E     -A  134   0A 111  467   31               K Q QQQ K Q                   TQQQ             Q         
   113    4 H L  E     -A  133   0A   3  489    1               L L LLL L L               L   LLLL             L         
   114    5 H Q  E     -A  132   0A  83  493   70               V Q QQQ Q Q               T   DQQQ             Q         
   115    6 H E  E     +A  131   0A   5  498   21               E Q EEQ E Q               Q   EQQQ             E         
   116    7 H S  E     +A  130   0A  69  501   13               S P SSS S S               S   SSPS             S         
   117    8 H G        +     0   0   36  505    4               G G GGG G G               E   RGGG             G         
   118    9 H G        +     0   0   29  672   48   PPP         G A PPP P A               A   GAAP   ATAPAPPAPPPTAPPPPAPP
   119   10 H D        -     0   0   96  677   40   EGG         G E GHE G E               V   GEEE   EEEEEGGEGGGEEGDGGEGG
   120   11 H L  E     +e  224   0B  79  675   16   LLL         L L LLL L L               I   LLFL   LLLLLLLILLLLLLLLLLLL
   121   12 H V  E     -e  225   0B  16  677   33   VVV         V V VVV V V               K   QVVV   VMAVAVVVVVVMMVVVVVVV
   122   13 H Q    >   -     0   0  114  679   51   RAQ         E K KKK A M               R   TRKK   KKRKRAARQAAKKQAAAKQA
   123   14 H P  T 3  S+     0   0   66  678    9   PPP         P P PPP P P               P   PAPP   PPPPPPPPPPPPPPPPPPPP
   124   15 H G  T 3  S+     0   0   58  682   32   GSS         G G SGG S G               E   GGGG   RGGGGSSGSSSGGSSSSGSS
   125   16 H G    <   -     0   0   25  684   63   AQQ         G A QAD Q A               E   GSAA   AAAAAQQAQQQAAQQQQAQQ
   126   17 H S        +     0   0   78  683   31   SSS         S S TSS S S               S   SSSS   SSSSSSSLSSSSSSSSSSSS
   127   18 H L  E     - B   0 192A  25  685   25   VLL         L V VVV L V               H   LVVV   VVVVVLLVLLLVVLLLLVLL
   128   19 H K  E     - B   0 191A  93  683   56   KSS         R K SKK S K               R   TKKK   KKKKKSSKSSSKKSSSSKSS
   129   20 H L  E     - B   0 190A   0  688   14   MII         L L LMM I M               L   LMLI   LILVLIILIIIIIIIIILII
   130   21 H S  E     -AB 116 189A  28  688   37   STT         S S TSS T S               T   VSSS   SSSSSTTSTTTSSTTTTSTT
   131   22 H b  E     -AB 115 188A   0  688    0   CCC         C C CCC C C               C   CCCC   CCCCCCCCCCCCCCCCCCCC
   132   23 H A  E     -AB 114 187A  52  688   66   KTT         V K TKK T K               T   KKKK   TKKKKTTKTTTKKTTTTTTT
   133   24 H A  E     +A  113   0A   8  688   49   AVV         G A VAA V A               T   GAAA   AAAAAVVAVVVAAVIVVAVV
   134   25 H S  E     +A  112   0A  58  688   12   SSS         S S TSS S S               S   SSSS   STSSSSSSSSSTTSSSSSSS
   135   26 H G  S    S+     0   0   56  688    4   GGG         G G gGG G G               G   GGGG   GGGGGGGGGGGGGGGGGGGG
   136   27 H F  S    S-     0   0   33  686   34   YFF         F Y iYY F Y               F   FYYY   FYYYYFFFFFFYYFFFFFFF
   137   28 H T    >   -     0   0   93  687   50   TSS         R T TTT S T               T   TTTT   NTTATSSNSSSTTSSSSNSS
   138   29 H F  G >  S+     0   0    2  688   41   FLL         F F TFF L F               F   FFFF   IFFFFLLILLLFFLLLLILL
   139   30 H S  G 3  S+     0   0   57  688   55   TTT         S T GTT T T               S   STTT   KSTTTTTKTTTSSTTTTKTT
   140   31 H S  G <  S+     0   0   71  688   60   DSS         G S NND S D               S   SSSD   DSSSSSSDSGSSSSSSNDSS
   141   32 H Y  S <  S-     0   0   44  688   41   YYY         Y Y YYY Y H               Y   SYYY   TYYYYYYYYYYYYYYYYTYY
   142   33 H T        -     0   0   30  688   91   VGG         P W RVY G W               E   TGLY   YWWNWGGYGGGWWGGGDYGG
   143   34 H M  E     -FG 207 160C   0  672   46   IVV         I M WMM V I               M   MIMM   MIMMMVVMVVVIIVVVVMVV
   144   35 H S  E     -FG 206 159C   0  685   73   SHH         G Q SHD H H               H   HNHN   HEHYLHHHHNNEEHHHTHHH
   145   36 H W  E     +FG 205 158C   0  688    0   WWW         W W WWW W W               W   WWWW   WWWWWWWWWWWWWWWWWWWW
   146   37 H V  E     -FG 204 156C   0  688   19   VVV         V V IVV V V               I   VVVV   VVVVVVVVVVVVIVVVVVVV
   147   38 H R  E     -FG 203 155C  10  688   17   KRR         R K RKK R K               R   RKNK   KKKKKRRKRRRKKRRRRKRR
   148   39 H Q  E     -FG 202 154C   9  688    3   QQQ         Q Q QQQ Q Q               Q   QQQQ   QQQQQQQQQQQQQQQQQQQQ
   149   40 H T    >   -     0   0    9  688   68   RPS         S R FMS P R               A   ARRS   RRRSRPPRSPPRRSPPPRSP
   150   41 H P  T 3  S+     0   0   80  687   10   TPP         P P PPH P P               P   PPPH   PPPHPPPPPPPPPPPPPPPP
   151   42 H E  T 3  S-     0   0  151  688   26   GGG         G G GGG G G               G   GGGG   EGGGGGGEGGGGGGGGGEGG
   152   43 H K    <   +     0   0  121  688   32   QKK         R Q NQK K Q               K   KQRK   QHQKQKKQKKRHHKKKKQKK
   153   44 H R        -     0   0  113  687   43   GGG         G G KGS G G               G   GGGS   GGGSGGGGGGVGGGGGGGGG
   154   45 H L  E     -G  148   0C   9  688   14   LLL         P P LLL L L               L   LLLL   LLLLLLLLLLLLLLLLLLLL
   155   46 H E  E     -G  147   0C  44  687    5   EEE         E E EEE E E               E   EEEE   EEEEEEEEEEEEEEEEEEEE
   156   47 H W  E     +G  146   0C  15  687   11   WWW         W W WWW W W               W   WWWW   WWWWWWWWWWWWWWWWWWWW
   157   48 H V  E     -     0   0C   0  687   28   ILL         L I III L I               I   VIII   IIIIILLILLLIILLLLILL
   158   49 H A  E     -G  145   0C   0  688   38   GGG         A G GGG G G               A   AGGG   GGGGGGGGGGAGGGVGGGGG
   159   50 H S  E     -GH 144 168C   0  688   94   EVV         M E YYY V A               Y   GYRD   REAYAVVWVMVEEVVVVRVV
   160   51 H I  E     -GH 143 167C   4  675   18   III         I I III I I               I   IIII   IIIIIIIIIIIIIIIIIIII
   161   52 H N    >   -     0   0   47  682   84   YWW         Q D YHY W E               S   YNDN   DLYDYWWDWWWLLWWWWDWW
   162   53 H N  T 3  S+     0   0   65  684   88   PAS         S P YPP A T               T   SPPP   PPPPPAAPSGGPPSSANPRA
   163   54 H G  T 3  S-     0   0   65  686   68   GGG         S S SYN G S               S   DGNN   AGGYGGGEGDDGGGDGDAGG
   164   55 H G  S <  S+     0   0   30  687   43   NGG         G D GNN G D               G   GNSN   NSDNDGGNGGGSGGGGGNGG
   165   56 H G  S    S+     0   0   74  688   63   GSS         n I TDG S S               S   SGGG   GGGGGSSGSSTGGSSSTGSS
   166   57 H R        +     0   0  163  505   86   N..         e Y .GG . Y               T   YYGG   NTDGD..N...TF....N..
   167   58 H T  E     -H  160   0C  62  677   52   TTT         T T IST I T               I   TTTT   TTTTTTTTTTTTTTTTTTTT
   168   59 H Y  E     +H  159   0C  53  686   85   YND         K D TKS N T               N   YKTS   KNRSRNNIDDNNTDTNSKDN
   169   60 H Y        -     0   0   44  688    9   YYY         Y Y YYY Y Y               Y   YYYY   YYYYYYYYYYYYYYYYYYYY
   170   61 H P    >>  -     0   0   20  688   65   NNN         S N NDN N N               S   ANNN   GNANTNNDNNHNNNNNHDNN
   171   62 H D  T 34 S+     0   0  148  688   64   ESA         D Q PDQ S H               P   PEEQ   PEQQQSSPASSEEASSSPAS
   172   63 H T  T 34 S+     0   0   90  688   57   KAA         S E SKK A K               S   AKHK   KKYKKAAKAAAKQAAAAKAA
   173   64 H V  T X> S+     0   0    1  688   42   FLF         V F LFF L F               V   VFFF   FFFFFLLFFLLFFFLLLFFL
   174   65 H K  B 3< S+c  177   0A 142  687   31   KMI         R K TEK M K               K   KKRK   QKKKKMMQIKIKRIKMIQMM
   175   66 H G  T 34 S+     0   0   74  687   36   DSS         G G SGG S G               G   GGSG   GGDGGSSGSSSGGSSSSGSS
   176   67 H R  T <4 S+     0   0   36  688   17   MRR         R K RKK R K               R   RKKK   KKRKKRRKRRRKKRRRRKRR
   177   68 H F  E  <  -cD 174 192A   2  688   60   ALL         F A TAA L A               F   ATAA   AAAAALLALLLAALLLLALL
   178   69 H T  E     - D   0 191A  79  688   38   TSS         T T TTT S T               T   TTTT   ATTTTSSSSSTTTSSSTTSS
   179   70 H I  E     + D   0 190A   5  688   20   LII         I L ILL I L               I   ILLL   IFVLLIIIIIIFFIIIIIII
   180   71 H S  E     - D   0 189A  51  684   41   TSS         S T TTT S T               S   STTT   TITTTSSTSSSITSSSSTTS
   181   72 H R  E     - D   0 188A  30  687   60   VKK         R V RSV K V               R   RVIV   AAAVAKKAKKKAAKKKKAKK
   182   73 H D  E > > - D   0 187A  60  686    7   DDD         D D DDD D D               D   DDDD   DDDDDDDDDDDDDDDDDDDD
   183   74 H N  G > 5S+     0   0   48  688   57   KNN         N T TKK N K               N   NKKK   TTKKKNNTNNNTTNNNNTNN
   184   75 H A  G 3 5S+     0   0   99  688   45   SSS         S S SSS S S               P   GSPS   SSSSSSSSSSFSSSSSFSSS
   185   76 H K  G < 5S-     0   0  111  688   51   SKK         Q S KSS K S               S   QSSS   SSSSSKKSKKKSSKKKKSKK
   186   77 H N  T < 5 +     0   0   62  688   46   NSS         G S NSS S S               S   SSSS   NNSSSSSNSSRNNSSSSNSS
   187   78 H T  E   < -BD 132 182A  16  688   69   TQQ         T T QTT Q T               K   TTTA   TTTTTQQTQQQTTQQQQTQQ
   188   79 H L  E     -BD 131 181A   0  687   56   AVV         S A FAA V V               L   VAAT   AAAAAVVAVVVAAVVVVAVV
   189   80 H Y  E     -BD 130 180A  41  687   46   YFF         Y Y FYY F Y               Y   KYYY   YYYYYFFYFFFYYFFFYYFF
   190   81 H L  E     -BD 129 179A   0  687    7   MLF         L M LMM L M               L   LMMM   LMMMMLLLFLLMMFLLLLFL
   191   82 H Q  E     -BD 128 178A  76  687   41   QKK         Q Q EEE K Q               Q   QQQE   QQQHQKKQKKKQQKKKKQKK
   192   83 H M  E     +BD 127 177A   0  688   11   LMM         M L MLL M L               M   LLLL   LLLLLMMIMMLLLMMMLLMM
   193   84 H S        +     0   0   42  688   54   TNN         N S NSH N S               N   NRSR   SSNNSNNSNNTSSNNNNTNN
   194   85 H S  S    S-     0   0   68  687   24   SSS         N S SSS S S               S   SSSS   SSSSSSSSSSSSSSSSSSSS
   195   86 H L        -     0   0    3  686   18   LLL         L L LLL L L               L   LLLL   LLLLLLLLLLLLLLLLLLLL
   196   87 H K    >   -     0   0  102  686   68   TQQ         R T TTT Q T               K   KTTT   TTATAQQTQQQTTQQQQTQQ
   197   88 H S  G >  S+     0   0   70  686   60   STA         S S ASS T S               T   ASSS   SSSSSTTSATTSSATTSSAT
   198   89 H E  G 3  S+     0   0  126  687   22   EDN         E E EEE D E               E   EEEE   EEEEEDDEDDDEEDDDDEDD
   199   90 H D  G <   +     0   0    2  687    3   DDD         E D DDD D D               D   DDDD   DDDDDDDDDDDDDDDDDDDD
   200   91 H T    <   +     0   0   32  688   28   STT         S S TSS T S               S   TSSS   TSSSSTTTTTTSSTTTTTTA
   201   92 H A  E    S- I   0 223C   8  686    5   AAA         A A AAA A A               A   GAAA   AAAAAAAAAAAAAAAAAAAA
   202   93 H M  E     -FI 148 222C  58  687   48   VMI         R V TVV M V               V   TVVV   VVVVVMMVIRTVVIMMTVIM
   203   94 H Y  E     -FI 147 221C   0  688    1   YYY         Y Y YYY Y Y               Y   YYYY   YYYYYYYYYYYYYYYYYYYY
   204   95 H Y  E     -F  146   0C   7  688    4   FYY         Y Y YYY Y Y               Y   FFYY   FYYYYYYYYYYYYYYYYYYY
   205   96 H b  E     -F  145   0C   0  688    1   CCC         C C CCC C C               C   CCCC   CCCCCCCCCCCCCCCCCCCC
   206   97 H V  E     -FJ 144 217C   0  688   23   AAA         V A AAA A A               A   AAAA   ATAAAAAAAAAAAAAAAAAA
   207   98 H R  E     -FJ 143 216C  21  687   40   rrr         r R Rrr r r               R   krrR   rrrrrrtrrrrrrrrrrrkr
   208   99 H H  E     + J   0 214C   6  583   92   rtr         p . .ny g g               D   agl.   sqhkdsrytyrqtiyyrhsd
   209  100 H E  E  >  + J   0 213C  63  625   78   GGR         R R DGS L P               A   RGG.   SSSGGSVGYDPSLYGVPDSG
   210  101 H Y  T >4 S-     0   0   80  658   93   AGY         Y Y YNY R Y               Q   GSRG   FDPLNPYWYLFDAYNWLWYG
   211  102 H Y  T 34 S-     0   0  140  672   23   YYY         Y Y YFY Y Y               y   FYYy   YYFYFYYYyYYYYyYYYFYY
   212  103 H Y  T 34 S+     0   0   39  265   92   ..Y         E G ..S . .               v   ...d   ........rY...rW...Y.
   213  104 H A  E <<  -J  209   0C   0  403   87   AAA         T G AYY I .               N   .Y.P   P..G.AA.IAA.GIYAA.AA
   214  105 H M  E     +J  208   0C   0  497   62   MMM         M Q MFG M F               C   .FFF   M..M.MMFMML.VMFMM.MM
   215  106 H D  E     +     0   0C  19  615   50   DDD         S D DDA D D               H   .DDD   D.DDDDDDDDD.DDDDDVDD
   216  107 H Y  E     -J  207   0C  99  624   65   YYY         F Y YYY Y Y               D   .YYV   Y.YYYYYVYYY.FYVYYYYY
   217  108 H W  E     -J  206   0C  23  675    2   WWW         W W WWW W W               W   WWWW   WWWWWWWWWWWWWWWWWWWW
   218  109 H G        -     0   0    0  664   17   GGG         G G GGG G G               T    GGG   GGGGGGGGGGGGGGGGGGGG
   219  110 H Q        -     0   0   91  659   46   QQQ         P Q QQQ Q Q               T    QQT   QQQQQQQAQQQQQQAQQQQQ
   220  111 H G        -     0   0   16  650   16   GGG         G G GGG   G               A    GGG   GGGGGGGGGGGGGGGGGGGG
   221  112 H T  E     -I  203   0C  21  594   27   TTT         V T TTT   T               .    TTT   TTTTTTTTTTTTTTTTITTT
   222  113 H T  E     -I  202   0C  72  593   76   SSS         E S STL   T               L    TTT   STTSTSSTSSSTSSTSSLSS
   223  114 H V  E     -I  201   0C   0  596   20   VVV         V V VLV   V               M    LLV   VLLVLVVVVVVLVVVVVVVV
   224  115 H T  E     -e  120   0B  36  593   20   TTA         F T TTT   T               T    TTT   TTTTTTTTTTTTTTTTTTTT
   225  116 H V  E     +e  121   0B   6  572    6   VVV         V V VV    V                    VVV   VVVVVVVVVVVVVVVVVVVV
   226  117 H S        -     0   0   36  566   11   SSS         S S SS    S                    SSS   SSSSSSSSSSSSSSSSSSSS
   227  118 H S  S    S+     0   0   84  551   22   SSS         S S SS    S                    SSS   SSSSSSSSSSSSSSSSSASS
   228  119 H A  S    S+     0   0   70  123   53               A E       G                                              
   229  120 H W        -     0   0  123   73   63               P S                                                      
   230  121 H R        +     0   0  207   60   75               K Q                                                      
   231  122 H H              0   0  156   54   67               T S                                                      
   232  123 H P              0   0  155   35   53               A                                                        
## ALIGNMENTS  841 -  910
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....5....:....6....:....7....:....8....:....9....:....0....:....1
     1    1 L D              0   0  183  420   16        Q  DDDDDDDD DD       E   DDDD  EDEDED    QQ        DDD Q        
     2    2 L I        -     0   0   32  462   11        I LIIIIIIIV IV  I    L   IVIII VILITI    VI        IIV I        
     3    3 L E        -     0   0  117  463   68        V VVVVVVVVV VV  V    V   VVQVV VVVQVV    VV        VVQ V        
     4    4 L L  E     -K   25   0D  10  474    7       LMMMMLMMMMLM MM  L    L   MMMMM LMLMMM    ML        MMMML        
     5    5 L T  E     -K   24   0D  64  475    8       TTTTTTTTTTTT TT  T    T   TTTTT TTTTTT    TT        TTTTT        
     6    6 L Q  E     -K   23   0D  13  475    0       QQQQQQQQQQQQ QQ  Q    Q   QQQQQ QQQQQQ    QQ        QQQQQ        
     7    7 L T  E    S+K   22   0D  64  475   34       TTTTSSSSATST TT  S    S   STSST STTSST    TT        TASTT        
     8    8 L P        -     0   0   46  480    9       PPPPPPPPVAPP PP  P    P   PPPPP PPPPPP    PP        PAPPP        
     9    9 L V  S    S+     0   0   96  484   67       SSASTLLLFPAV LL  A    L   SVSDA ALSAAL    EE        AFSED        
    10   10 L S  E     -n  104   0E  60  485   43       PSSPFSSSSSSS SS  S    S   SSSSS SSPLTS    SS        SSYSS        
    11   11 L L  E     -n  105   0E  58  489   21       VVVVLLLLNALL LL  L    L   LLMLL VLVLLL    LL        VNLLL        
    12   12 L S  E     +n  106   0E  60  490   42       SSESAPPPPLAP PP  A    P   TSSAR SPSSSP    SA        SPAAS        
    13   13 L A  E     -n  107   0E   0  490   58       AAVAVVVVVVVV VV  V    V   VVVVE VFAALV    VV        EVAVV        
    14   14 L S    >   -     0   0   47  491   29       AAAATTTTTTSS SS  S    T   TSSSK STASST    PS        PTSSS        
    15   15 L V  T 3  S+     0   0   76  491   66       VVVVAPPPLPLL LL  L    P   ALLLV LPVVPP    VP        VLPPP        
    16   16 L G  T 3  S+     0   0   42  491    4       GGGGSGGGGGGG GG  G    G   GGGGT GGGGGG    GG        GGGGG        
    17   17 L E    <   -     0   0   71  491   35       GGGGKEEETEQG DD  Q    E   EGDQI EEGEEE    GD        GTEDE        
    18   18 L T        -     0   0   69  491   62       TTTTKPPPSSRQ QQ  R    P   KQTRS RATSRP    RT        TSSRR        
    19   19 L V  E     - L   0  75D  11  491   37       VVVVVAAAAVAA AA  A    A   VTVVV VAVVAA    VV        VAVVV        
    20   20 L T  E     - L   0  74D  67  490   30       TTTTTSSSSSTS SS  T    S   TSTEN TSTTTS    ST        TSSTT        
    21   21 L I  E     - L   0  73D   1  489   17       IIIIIIIIIIII II  I    I   MIIM. IIIILI    II        IFIII        
    22   22 L T  E     -KL   7  72D  29  489   58       SNKSSSSSSSSS SS  S    S   SSTK. KSNTSS    NR        KSSNN        
    23   23 L a  E     -KL   6  71D   0  490    1       CCCCCCCCCCCC CC  C    C   CCCC. CCCCCC    CC        CCCCC        
    24   24 L R  E     -KL   5  70D 110  490   45       QQQQTRRRRRKR RR  K    R   KRRK. KRKQRR    KK        QRKKK        
    25   25 L A  E     -K    4   0D  10  490   29       SSAAASSSSSAS SS  A    S   SSAA. ASTSAS    AA        ASAAA        
    26   26 L S  S    S+     0   0   66  490    4       TSSSSSSSSSSS SS  S    S   SSSS. SSSSSS    SS        SSSSS        
    27   27 L E  S    S-     0   0  101  490   38       KQQQEQQQKKQQ QQ  Q    Q   QQQQ. QQQQQQ    TS        QKNST        
    28   28 L N        +     0   0   83  490   45       SSSSSNSSSSSS SS  S    S   SSDS. SSSNSS    SS        SSKSS        
    29   29 L I    >   -     0   0    5  491   32       IVIVLLLLLLLL IL  V    L   LLVVI LLVIVL    IL        ILSTI        
    30   30 L Y  T 3   -     0   0  155  491   81       yySyyllllldv vv  d    l   lvGSD llyDSl    St        FqiGS        
    31   31 L S  T 3  S+     0   0   53  467   65       bgTnhbdnttst tt  s    n   ntINS ttnNSt    Nq        BtnNN        
    32   32 L Y    <   +     0   0   63  490   52       YRYNYYYYYYYY YY  F    F   YYYYW YYFISY    SL        BYNHY        
    33   33 L L  E     -O   90   0E   0  490    7       LLLLLLLLLLML LL  M    M   LLVLL LLLLLL    LL        LLLLL        
    34   34 L A  E     -O   89   0E   0  490   71       ASSSADNDYYNH EH  N    D   TYNDA HDSAAY    HA        AYANG        
    35   35 L W  E     -OP  88  48E   1  491    0       WWWWWWWWWWWW WW  W    W   WWWWW WWWWWW    WW        WWWWW        
    36   36 L Y  E     -OP  87  46E   0  491    9       YFYFYYYYYFYY YY  Y    Y   HYFYY FYYCYY    YY        YYYYY        
    37   37 L Q  E     -OP  86  45E   7  491   28       QQQQQLLLLLQL LL  Q    L   QLQQQ QLQQQL    QQ        QLZQQ        
    38   38 L Q  E     -O   85   0E  21  491    4       ZQQQKZQQQQQQ QQ  Q    Q   QQQQQ QQQQQQ    QQ        KQZQQ        
    39   39 L K    >   -     0   0   51  490    9       KKKKKKKKKRKK KK  K    R   KKKKP KKKKKK    KK        .KKKK        
    40   40 L Q  T 3  S+     0   0  190  491   19       PPPPPPPPPPPP PP  P    P   PPPPP PPPTPP    PS        PPPSP        
    41   41 L G  T 3  S+     0   0   86  491   10       GGGGEGGQGGGG GG  G    G   GGGVG GGGQGG    GG        GGGGG        
    42   42 L K  S <  S-     0   0  126  490   54       QQQQQZQQQQQQ XQ  Q    Q   QQKKK KQQNQQ    KQ        ZQKQQ        
    43   43 L S        -     0   0   21  490   55       PPRPSSSSSCPS XS  P    S   PSSAP SSPPAS    AA        PSAAA        
    44   44 L P        -     0   0    4  490   11       PPPPPPPPPPPP XP  P    P   PPPPP IPPPPP    PP        PPNPP        
    45   45 L Q  E     -P   37   0E  74  490   32       KKKKKZZQQQKQ KK  K    Q   KQRKK KQKKRQ    KK        KQKKK        
    46   46 L F  E     +P   36   0E  25  490   42       ARLLLLLLLLLL LL  L    L   MLHLL RLLLLL    LL        GLLLL        
    47   47 L L  E     +     0   0E   4  490    9       LLLLLLLLLLLL LL  L    L   LLMLL MLLLLL    LL        LLLLL        
    48   48 L V  E     -PQ  35  54E   0  491    5       IIIIIIIILIII II  I    I   IIIII IIIIII    II        LIIII        
    49   49 L Y  E >> S+ Q   0  53E  39  491   17       YYYYYYYYYYYY YY  Y    Y   YYYYY YYYCYH    AY        YYSYY        
    50   50 L N  T 34 S-     0   0   52  491   91       TRRKGLALQRAR GK  T    L   WKRAA QAKYGE    YD        TQSHD        
    51   51 L A  T 34 S+     0   0    3  491   45       AAAAAGLGMMAV IV  T    G   AVAAA VVAAAV    AG        BMGGS        
    52   52 L K  T <4 S+     0   0  148  491   25       SSSSSSSSSSSS SS  S    S   SSTSD SSSYSS    SS        YSSST        
    53   53 L T  E  <  -Q   49   0E  47  491   67       STTTNNNNNNNN NN  N    N   TNNSE NNTSSN    SS        TNTTN        
    54   54 L L  E     -Q   48   0E  60  491   60       LLLLRRRRLLLR RR  L    R   RRLRL LRLLRR    LL        LLLLH        
    55   55 L G    >   -     0   0    9  490   71       AAAAYAAAAAEF FF  E    A   EFAAE DAEVAA    QQ        AAQAY        
    56   56 L E  T 3  S+     0   0  192  490   35       SSSSISSSSSSS SS  S    S   SSDSS SSSDTS    SS        SSSSS        
    57   57 L G  T 3  S+     0   0   70  491    5       GGGGGGGGGGGG GG  G    G   GGGGG GGGGGG    GG        GGGGG        
    58   58 L V    <   -     0   0   25  489   11       VVVVVVVVVVIV VV  I    V   VVVVV VVVIIV    VV        VVTVT        
    59   59 L P    >   -     0   0   47  490    7       PSSPPPPPPPPP PP  P    P   PPPPP PPPPPP    PP        SPPPP        
    60   60 L S  T 3  S+     0   0  115  491   57       SSSSDNDDDDAD DD  A    D   DDSDA SDSSDD    AS        SDSAA        
    61   61 L R  T 3  S+     0   0   44  491    4       RRRRRRRRRRRR RR  R    R   RRRRH RRRRRR    RR        RRRRW        
    62   62 L F  E <   +M   75   0D   5  491    1       FFFFFFFFFFFF FF  F    F   FFFFF FFFFFF    FF        FFFFF        
    63   63 L S  E     -M   74   0D  55  490   22       TTKKTSSSSSSS SS  S    S   TSSSS SSKSSS    SS        SSSSS        
    64   64 L G  E     +M   73   0D  13  491    2       GGGGGGGGSGGG GG  A    G   GGGGG GGGgGG    GG        GGGgG        
    65   65 L S  E     +M   72   0D  63  491    5       SSSSSSSSSSSS SS  S    S   SSSSS SSSsSS    SS        GSSsS        
    66   66 L G  E     -M   71   0D  36  491   14       GGGGGGGGGGGG GG  G    G   GGRGG GGGGGG    GG        GGGGG        
    67   67 L S  E >   +M   70   0D  79  491    9       SSSSSSSSSSSS SS  S    S   SSSSS SSSSSS    SS        SSSSS        
    68   68 L G  T 3  S-     0   0   16  491   13       GGGGGGGGGGGG GG  G    G   GGGGG GGGGGG    GG        GGDgG        
    69   69 L T  T 3  S+     0   0   67  488   13       TTTTTTTTTTTT TT  T    T   TTSTT TTTTTT    TT        TTTtT        
    70   70 L Q  E <   +LM  24  67D 110  489   27       ZQEQDBDDDADD DD  D    D   DDDDD DDQQED    DD        BDDDD        
    71   71 L F  E     -LM  23  66D   2  491    6       FFFFFFFFFFFF FF  F    F   FFYFY FFFYFF    FF        FFFYF        
    72   72 L S  E     -LM  22  65D  26  491   30       TTTTTTTTTTTT TT  T    T   TTSTT TTTSTT    TT        TTTTT        
    73   73 L L  E     -LM  21  64D   0  491    2       LLLLLLLLLLLL LL  L    L   LLLLL LLLLLL    LL        LLLLL        
    74   74 L K  E     -LM  20  63D  97  491   39       TSTPTKKKRRNK KK  N    K   TKTTT TKTKTK    TT        TRTTT        
    75   75 L I  E     -LM  19  62D   0  491    1       LIIIIIIIIIII II  I    I   IIIII IIIIII    II        IIIII        
    76   76 L N  S    S-     0   0   86  491   30       SSSSSSSSSSHS SS  H    S   SSSSS SSSSSS    SN        SSRSS        
    77   77 L S  S    S-     0   0   58  491   62       DDGGSRRRRRPR RR  P    R   SRSSS SRGGSR    SR        DRSSN        
    78   78 L L        -     0   0    0  491   27       VVVVVVVVVVVV VV  V    V   VVLLV LVVLLV    IV        LVLAF        
    79   79 L L    >   -     0   0   67  491   31       ZQEEQZEEEEEE EE  E    E   QEEQE EEQQEE    EE        EEEEE        
    80   80 L P  G >  S+     0   0   92  491   58       CCCCVAAAAAEP AA  E    A   APSAA PACPPA    AA        CAFTT        
    81   81 L E  G 3  S+     0   0  102  491   13       DDADEZEEEEEE EE  E    E   EEEEE EEDEEE    DE        AEQEE        
    82   82 L D  G <  S+     0   0    1  491    5       DDDDDBDDDDDD DD  D    D   DDDDD DDDDDD    DD        BDDDD        
    83   83 L F    <   +     0   0   29  490   72       AAAALVVVVVAL VL  T    V   LLVVV VVAIVV    AA        AVFAA        
    84   84 L G  E    S- R   0 105E  17  491   23       AAAATGGGGGAG GG  A    G   AGAAG AGAAGG    GG        AGAGG        
    85   85 L S  E     -OR  38 104E  24  491   63       TTTTHVVVVVTD IV  T    V   VVDVH IVTTVV    DD        TVVDN        
    86   86 L Y  E     -OR  37 103E   0  491    0       YYYYYYYYYYYY YY  Y    Y   YYYYY YYYYYY    YY        YYYYY        
    87   87 L Y  E     -O   36   0E   5  490    4       YYYYYYYYYYYY YF  Y    Y   YYHSY YYYYYY    YY        YYYYY        
    88   88 L a  E     -O   35   0E   0  491    0       CCCCCCCCCCCC CC  C    C   CCCCC CCCCCC    CC        CCCCC        
    89   89 L Q  E     -OS  34  99E   0  489   48       GLQQAMMMAMHL FS  Q    M   QYLQQ YLAQQM    QQ        EAZQH        
    90   90 L H  E     -O   33   0E  22  483   26       GGQGQQZQHQQQ QQ  Q    Q   NQQQE QQGQQQ    QQ        XNZQQ        
    91   91 L H        +     0   0    0  421   89       ANGTFAAGNQSS GT  S    G   DGYRT HAEAEG    SY        TLYSR        
    92   92 L Y  S    S+     0   0  104  454   88       DYWNYLLLLRET IT  N    L   YTDYV SLYVII    SR        GQNYL        
    93   93 L G  S    S-     0   0   34  422   71       YDSTSQQQEEDH HH  E    Q   RHESS HQSSEQ    SS        VEESS        
    94   94 L T  S    S-     0   0  104  446   88       TCSGYTATLYPF VV  D    T   SYYSS SASTSL    WS        SLPFY        
    95   95 L P  S    S+     0   0    7  443   51       GSSNPPPPPPWP PP  P    P   VPPPD PPSPPP    PP        ZPYPP        
    96   96 L P  S    S-     0   0   55  421   75       YsnNLLIQYYTP YP  Y    Y   TPPPK V tPEP    LL        bYYLV        
    97   97 L L        -     0   0   21  160   88       .fnI.......  .Y  .    .   .TT.. . t..     T.        k..TT        
    98   98 L T        -     0   0   40  288   41       STVVTTTTTT.  TT  T    T   .VV.L S T..     V.        GTTVV        
    99   99 L F  B     -S   89   0E  18  290   29       FFFFFFFFFFF  FF  F    F   FMI.L L V..     I.        FFFII        
   100  100 L G        -     0   0    3  294   39       GGGGGGGGGGG  GG  G    G   GQQ.G V G.S     Q.        GGGPQ        
   101  101 L G        -     0   0   52  307   63       GGGTAGQQGGS  GG  G    Q   STQ.G A S.Q     T.        GGATT        
   102  102 L G        -     0   0   11  306   43       GGGGGGGGGGG  GG  G    G   GLN.G G G.G     S.        GGGHI        
   103  103 L T  E     - R   0  86E   0  366   18       TTTTTTTTTTT  TT  T    T   TTLTT K TTS     TT         TTTT        
   104  104 L K  E     -nR  10  85E  98  363   58       EEEEKNRKKKK  RK  K    K   KKTVK K EVR     KV         KMKK        
   105  105 L L  E     -nR  11  84E   4  343   37       VVVVLVLVLLL  LL  L    L   LMVLR K YIN     TV         LLTT        
   106  106 L E  E     -n   12   0E 108  326   51       VVVVEEEEEEE  EE  E    E   E QQE S TQN     SQ         EESS        
   107  107 L I  E      n   13   0E 113  301   50       VVVVLIIIIII  IM  L    I   I Q   L L V     LT         ILLL        
   108  108 L K              0   0  145  268   18       KKKKKKKKKKK  KK  K    K   K K   K          R         KK          
   109      ! !              0   0    0   0     0  
   110    1 H E              0   0  194  408   30      Q            E  E  QQQQ QQQ     D      QEED        QQ     QQQQQQQQ
   111    2 H V        +     0   0   19  465   12      V            V  V  VVVV VVV     V      VAVV        VV     VVVVVVVV
   112    3 H K  E     -A  134   0A 111  467   31      Q            Q  K  QQQQ HQR     Q      QQQQ        QQ     QQQQQQQQ
   113    4 H L  E     -A  133   0A   3  489    1      L            L  LL LLLV LLL     L      LLLL        LL     LLLLLLLL
   114    5 H Q  E     -A  132   0A  83  493   70      Q            V  EQ QQKQ VLQ     V      QQQV        VV     QQQQQQQV
   115    6 H E  E     +A  131   0A   5  498   21      E            K  EQ QQEQ QEE     E      QQQE        QQ     QQQQQQQE
   116    7 H S  E     +A  130   0A  69  501   13      S            S  SP PPSS SSS     S      WSSS        SS     PPPPPPPS
   117    8 H G        +     0   0   36  505    4      G            V  GG GGGG GGG     G      GGGG        GG     GGGGGGGG
   118    9 H G        +     0   0   29  672   48  PAPPP            G  PT TAPA AAP     G      AAAG  PAPPAAAA     AATAAAAA
   119   10 H D        -     0   0   96  677   40  GEGGG            D  PE EEGE EVS     D      GEED  GEGGEEEE     EEEEEEEE
   120   11 H L  E     +e  224   0B  79  675   16  LLLLQ            L  LL LLLL VLL     L      LLLL  LLLLLXLL     LLLLLLLV
   121   12 H V  E     -e  225   0B  16  677   33  VVVVV            V  EV VVVA KAV     R      VVVR  VAVVVVRR     VVVVVVVR
   122   13 H Q    >   -     0   0  114  679   51  ARAAK            K  EK KKAR KRK     Q      KRRQ  KRAQRKKK     KKKKKKKK
   123   14 H P  T 3  S+     0   0   66  678    9  PPPPP            P  SP PPPP PPP     P      PPAP  PPPPSPPP     PPPPPPPP
   124   15 H G  T 3  S+     0   0   58  682   32  SGSSS            G  GG GGSW GGS     G      SGGG  SGSSGGGG     GGGGGGGG
   125   16 H G    <   -     0   0   25  684   63  QAQQQ            G  GA AAQA ATQ     G      ETSG  QAQQAAAA     AAAAAAAA
   126   17 H S        +     0   0   78  683   31  SLSST            S  TS SSSS SST     S      TSSS  TSSSSSSS     SSSSSSSS
   127   18 H L  E     - B   0 192A  25  685   25  LVLLL            L  VV VVLV VVL     L      LVVL  VVLLVVVV     VVVVVVVV
   128   19 H K  E     - B   0 191A  93  683   56  SKSSS            R  KK KKSK KKS     S      SKKR  SKSSKKKK     KKKKKKKR
   129   20 H L  E     - B   0 190A   0  688   14  ILIIL            A  IL LLIL VIL     L      LIML  LLIILLII     LLLLLLLV
   130   21 H S  E     -AB 116 189A  28  688   37  TSTTT            S  SS SSTS SST     S      TSSS  TSTTSSSS     SSSSSSSS
   131   22 H b  E     -AB 115 188A   0  688    0  CCCCC            C  CC CCCC CCC     C      CCCC  CCCCCCCC     CCCCCCCC
   132   23 H A  E     -AB 114 187A  52  688   66  TKTTT            A  KQ KKTK KKT     K      AKKK  TKTTTTKK     KKTKKKKK
   133   24 H A  E     +A  113   0A   8  688   49  VAVVV            A  AA AAVA AAV     A      VAAA  VAIVAAAA     AAAAAAAA
   134   25 H S  E     +A  112   0A  58  688   12  SSSSS            S  SS SSSS SSS     S      FASS  TSSSSSSS     SSSSSSSS
   135   26 H G  S    S+     0   0   56  688    4  GGGGG            G  GG GGGG GGG     G      GGGG  gGGGGGGG     GGGGGGGG
   136   27 H F  S    S-     0   0   33  686   34  FFFFF            F  YY YYFY DYF     L      GYYL  iYFFFFYY     YYYYYYYY
   137   28 H T    >   -     0   0   93  687   50  SNSSS            T  TT TTPN SNS     T      STTT  TTSSNNTT     TTTTTTTT
   138   29 H F  G >  S+     0   0    2  688   41  LILLL            F  FF FFLF FFL     N      FFFY  TFLLIIFF     FFFFFFFF
   139   30 H S  G 3  S+     0   0   57  688   55  TKTTT            S  TT TTTN STT     S      STTS  GSTTKKTT     TTTTTTTT
   140   31 H S  G <  S+     0   0   71  688   60  SDSSN            S  YS SSSS SST     Y      GNSS  NDSSDDDD     SSSSSSSG
   141   32 H Y  S <  S-     0   0   44  688   41  YYYYN            Y  SF YYHY YYY     Y      YYYY  YYYYYTYY     YYYYYYYY
   142   33 H T        -     0   0   30  688   91  GYGGG            N  SW WWGW AWS     Y      YWGF  RYGGYYYY     WWWWWWWY
   143   34 H M  E     -FG 207 160C   0  672   46  VMVVV            M  IM MMVM IMV     M      WIIM  WIVVMMMM     MMMMMMMM
   144   35 H S  E     -FG 206 159C   0  685   73  HHHNH            N  HH HHSQ HLG     H      SGNH  SNHHNHYY     HHHHHHHN
   145   36 H W  E     +FG 205 158C   0  688    0  WWWWW            W  WW WWWW WWW     W      WWWW  WWWWWWWW     WWWWWWWW
   146   37 H V  E     -FG 204 156C   0  688   19  VVVVT            V  VV VVVV VVV     V      IVVV  IVVVVVVV     VVVVVVVV
   147   38 H R  E     -FG 203 155C  10  688   17  RKRRR            H  KK KKRK RKR     R      RKKR  RNRRKKRR     KKKKKKKR
   148   39 H Q  E     -FG 202 154C   9  688    3  QQQQQ            K  QQ QQQQ QQQ     Q      QEQQ  QQQQQQQQ     QQQQQQQQ
   149   40 H T    >   -     0   0    9  688   68  PRPPA            S  AR RRPR ARA     A      PRRA  FRPSRRAA     RRRRRRRA
   150   41 H P  T 3  S+     0   0   80  687   10  PPPPP            P  PP PPPP PPP     P      PPPP  PTPPPPPP     PPPPPPPP
   151   42 H E  T 3  S-     0   0  151  688   26  GEGGG            G  GG GGGG GGG     G      GGGG  GGGGEEGG     GGGGGGGG
   152   43 H K    <   +     0   0  121  688   32  KQKKK            K  KQ QRKQ QQK     K      RHQK  NQKKQQQQ     RRRRRRRH
   153   44 H R        -     0   0  113  687   43  GGGGG            G  GG GGGG RGA     G      GGGG  KGGGGGGG     GGGGGGGG
   154   45 H L  E     -G  148   0C   9  688   14  LLLLL            L  LL LLLL LLL     L      LLLL  LLLLLLLL     LLLLLLLL
   155   46 H E  E     -G  147   0C  44  687    5  EEEEE            Q  KE EEEE AEE     E      EEEE  EEEEEEEE     EEEEEEEE
   156   47 H W  E     +G  146   0C  15  687   11  WWWWW            W  WW WWWW WWW     W      WWWW  WWWWWWWW     WWWWWWWW
   157   48 H V  E     -     0   0C   0  687   28  LILLV            V  MI IILI MIL     V      IIIV  IILLVIMM     IIIIIIII
   158   49 H A  E     -G  145   0C   0  688   38  GGGGG            T  GG GGGG GGG     A      GGGA  GGVGGGGG     GGGGGGGG
   159   50 H S  E     -GH 144 168C   0  688   94  VWVVV            Y  WN NRVA wAG     Q      EDYR  YEVVWRYY     RRRRRRRY
   160   51 H I  E     -GH 143 167C   4  675   18  IIIII            .  II IIII iLI     V      IIIV  IIIIIIII     IIIIIIII
   161   52 H N    >   -     0   0   47  682   84  WDWWW            .  NY NDWY AFE     H      NYNY  YYWWDDYY     DDDDDDDN
   162   53 H N  T 3  S+     0   0   65  684   88  APAGS            .  TP PPGP DPN     K      HPPH  YPSSPPPP     PPPPPPPP
   163   54 H G  T 3  S-     0   0   65  686   68  GEGDG            .  AS SNDG NGD     D      SGGD  SGDGEAGG     NNNNNNNS
   164   55 H G  S <  S+     0   0   30  687   43  GNGGG            I  TN NSGD GNG     G      GGNG  GSGGNNNN     SSSSSSSR
   165   56 H G  S    S+     0   0   74  688   63  SGSTS            S  GG GGNG NSC     G      SGGN  TGSSGGSS     GGGGGGGG
   166   57 H R        +     0   0  163  505   86  .N...            .  ED GG.D .D.     S      .FYY  .Y..DNNN     GGGGGGGY
   167   58 H T  E     -H  160   0C  62  677   52  TTTTK            .  PT TTTT TTA     T      TTII  ITTTTTTT     TTITTTTT
   168   59 H Y  E     +H  159   0C  53  686   85  NINSD            .  TN NKKS KTG     K      NNNG  TYTDEKNN     KKIKKKKN
   169   60 H Y        -     0   0   44  688    9  YYYYY            Y  YY YYYY YYY     Y      YYYY  YYYYYYYY     YYYYYYYY
   170   61 H P    >>  -     0   0   20  688   65  NDNHN            D  PN NNHT SKH     A      KNNA  NNNNADAA     NNNNNNNN
   171   62 H D  T 34 S+     0   0  148  688   64  SPSSP            K  DE EESQ QEP     D      TDED  PESAPPQQ     EEEEEEEQ
   172   63 H T  T 34 S+     0   0   90  688   57  AKAAA            S  DK KKAK KMA     S      SNKS  SKAANKKK     KKKKKKKK
   173   64 H V  T X> S+     0   0    1  688   42  LFLLL            V  FF FFLF FLL     V      LLFV  LFLFFFFF     FFFFFFFF
   174   65 H K  B 3< S+c  177   0A 142  687   31  MQMIK            K  KK KKIR QKK     K      KKKK  TKKIQQQQ     KKKKKKKK
   175   66 H G  T 34 S+     0   0   74  687   36  SGSSS            G  GS SSSG GGS     G      SGGG  SGSSGGGG     SSTSSSSD
   176   67 H R  T <4 S+     0   0   36  688   17  RKRRR            Q  RK KKRK RRR     R      RKKR  RKRRKKRR     KKKKKRKR
   177   68 H F  E  <  -cD 174 192A   2  688   60  LALLL            F  FA AALA VAL     F      VATF  TALLAAVV     AAAAAAAV
   178   69 H T  E     - D   0 191A  79  688   38  SSSTS            T  VT TTST TKS     T      TTTT  TTSSTTTT     TTTTTTTT
   179   70 H I  E     + D   0 190A   5  688   20  IIIII            N  FL LLIL ILI     I      ILLI  ILIILIMM     LLLLLLLM
   180   71 H S  E     - D   0 189A  51  684   41  STSST            S  ST TTST TTT     S      STTS  TTSSTTTT     TTTTTTTT
   181   72 H R  E     - D   0 188A  30  687   60  KAKKR            R  LV VVKA RAR     W      LAVW  RAKKSAAA     VVVVVVVT
   182   73 H D  E > > - D   0 187A  60  686    7  DDDDD            D  ED DDDD DAD     D      DDDD  DDDDDDDD     DDDDDDDD
   183   74 H N  G > 5S+     0   0   48  688   57  NTNNT            N  SK KKNK TTT     K      TTKK  TKNNTTKK     KKKKKKKK
   184   75 H A  G 3 5S+     0   0   99  688   45  SSSYS            G  SY SPSS SSS     S      SSSA  SSSSSSSS     PPPPPPPS
   185   76 H K  G < 5S-     0   0  111  688   51  KSKKK            K  TS SSKS AAK     S      KSSN  KSKKSSSS     SSSSSSSF
   186   77 H N  T < 5 +     0   0   62  688   46  SNSRS            N  SS SSSS SSS     S      NSSS  NSSSNNSS     SSTSSSSS
   187   78 H T  E   < -BD 132 182A  16  688   69  QTQQQ            T  TT TTQT TIQ     L      LTTL  QTQQTTTT     ATTTTTTT
   188   79 H L  E     -BD 131 181A   0  687   56  VAVVV            L  AA AAVA AAV     L      FAAL  FAVVAAAA     AAAAAAAA
   189   80 H Y  E     -BD 130 180A  41  687   46  FYFFY            Y  YY CYFY YYS     S      SYYS  FYFFYYYY     YYYYYYYY
   190   81 H L  E     -BD 129 179A   0  687    7  LLLLL            L  LM TMLM LLL     L      LIML  LMLFLLMM     MMMMMMMM
   191   82 H Q  E     -BD 128 178A  76  687   41  KQKKI            Q  EQ QQKQ EES     Q      KQQQ  EQKKQQEE     QQQQQQQD
   192   83 H M  E     +BD 127 177A   0  688   11  MLMLL            M  IL LLLL LFL     M      LLLM  MLMMLLLL     LLLLLLLL
   193   84 H S        +     0   0   42  688   54  NSNNS            N  NS SSNS SSS     N      SSRN  NSNNSSSS     SSSSSSSR
   194   85 H S  S    S-     0   0   68  687   24  SSSSS            I  NS SSSS SSS     S      SSSS  SRSSSSSS     SSSSSSSS
   195   86 H L        -     0   0    3  686   18  LLLLL            L  LL LLLL LLV     L      VLLL  LLLLLLLL     LLLLLLLL
   196   87 H K    >   -     0   0  102  686   68  QTQQT            R  KT TTQA TTT     K      TTTK  TTQQTTRR     TTTTTTTR
   197   88 H S  G >  S+     0   0   70  686   60  TSTSV            A  NS SSTS SNS     T      ASST  ASTASSAA     SSSSSSSS
   198   89 H E  G 3  S+     0   0  126  687   22  DEDDE            E  EE EEEE EEE     E      AEEE  EEDNEEEE     EEEEEEEA
   199   90 H D  G <   +     0   0    2  687    3  DDDDD            D  DD DDDD DDD     D      DDDD  DDDDDDDD     DDDDDDDD
   200   91 H T    <   +     0   0   32  688   28  TTTTT            T  TS SSTS TST     T      TSST  TSTTTTTT     SSSSSSSS
   201   92 H A  E    S- I   0 223C   8  686    5  VAAAA            A  DA AAAA AAA     A      AAAA  AAAAAAAA     AAAAAAAA
   202   93 H M  E     -FI 148 222C  58  687   48  MAMTT            V  TV VVTV MVM     L      VIVL  TVMIVVMM     VVVVVVVV
   203   94 H Y  E     -FI 147 221C   0  688    1  YYYYY            Y  YY YYYY YYY     Y      YYYY  YYYYYYYY     YYYYYYYY
   204   95 H Y  E     -F  146   0C   7  688    4  YYYYY            Y  FY YYYY YYY     Y      YHFY  YFYYYYYY     YYYYYYYY
   205   96 H b  E     -F  145   0C   0  688    1  CCCCC            G  CC CCCC CCC     C      CCCC  CCCCCCCC     CCCCCCCC
   206   97 H V  E     -FJ 144 217C   0  688   23  AAAAA            A  AT AAAA AAV     A      AAAA  AAAANAAA     AAAAAAAA
   207   98 H R  E     -FJ 143 216C  21  687   40  rnrrr            k  PR RKrr rRr     a      rrrt  rrrrgrss     KsRRRlrr
   208   99 H H  E     + J   0 214C   6  583   92  tsrra            h  .K .Ryv g.g     w      vsgr  ryyslgww     Rg...asd
   209  100 H E  E  >  + J   0 213C  63  625   78  GSGPT            E  .D .SAG GGG     E      DSGE  PDGSAVGG     SS.D.ESD
   210  101 H Y  T >4 S-     0   0   80  658   93  GSRLS            G  .Y NNNG VDK     D      YPSN  YWNYWRRR     NSRDFALH
   211  102 H Y  T 34 S-     0   0  140  672   23  YYLYy            F  yy WYYY fFY     F      YYYF  YYYYFYYY     YYlYyYYY
   212  103 H Y  T 34 S+     0   0   39  265   92  .WL.y            .  ys .G.. eG.     .      Y...  Y.W.....     GWg.e...
   213  104 H A  E <<  -J  209   0C   0  403   87  AYAAG            .  AG DAA. AA.     .      G.D.  A.Y.....     AYVGY.YC
   214  105 H M  E     +J  208   0C   0  497   62  MFMMM            .  GF FFMF FMW     .      MFF.  MFFF.F..     FFMRF.FL
   215  106 H D  E     +     0   0C  19  615   50  DDDDD            .  FV DDDD DDG     .      DDD.  DDDDLD..     DDDTD.DD
   216  107 H Y  E     -J  207   0C  99  624   65  YVYYY            .  YY YVYY IYY     .      VSY.  YVVYYV..     VVYFV.YY
   217  108 H W  E     -J  206   0C  23  675    2  WWWWW            W  WW WWWW WWW     W      WWWW  WWWWWWWW     WWWWWWWW
   218  109 H G        -     0   0    0  664   17  GGGGG            T  GG GGGG GGG     A      GGGA  GGGGGGGG     GGGGGGGG
   219  110 H Q        -     0   0   91  659   46  QAQQL            S  QQ QTQQ QQP     A      QQQA  QAAQQAQQ     TTQQTQQQ
   220  111 H G        -     0   0   16  650   16  GGGGG            R  GG GGGG GGG     A      GGGA  GGGGGGGG     GGGGGGGG
   221  112 H T  E     -I  203   0C  21  594   27  ATTTT            G  TT TTTT TTL     .      TTT.  TTTTTTTT     TTTTTTTT
   222  113 H T  E     -I  202   0C  72  593   76  STSSL            R  LL TTST MLL     .      TTP.  STTTLTLL     TTSTTLTT
   223  114 H V  E     -I  201   0C   0  596   20  VVVVV            T  VV LVVL VVV     .      VLL.  VVVLVVVV     VVVLVVLV
   224  115 H T  E     -e  120   0B  36  593   20  TTTTT            P  TT TTTT TTT     .      TTT.  TTTTTTTT     TTTTTTTT
   225  116 H V  E     +e  121   0B   6  572    6  VVVVV            L  VV VVVV VVV     .      VVV.  VVVVVVVV     VVVVVVVV
   226  117 H S        -     0   0   36  566   11  SSSSS            T  SS SSSS SSS     .      SSS.  SSSSSSSS     SSSSSSSS
   227  118 H S  S    S+     0   0   84  551   22  SSSSS            S  AA SSSS SSS     .      SSS.  SSSSASSS     SSSSSASS
   228  119 H A  S    S+     0   0   70  123   53                   S   A EEG          G         G               EEEEEEE 
   229  120 H W        -     0   0  123   73   63                       K SS           W         W               SSSSSSS 
   230  121 H R        +     0   0  207   60   75                       T QQ                                     QQQQQQQ 
   231  122 H H              0   0  156   54   67                       T SS                                     SSSSSSS 
   232  123 H P              0   0  155   35   53                       P                                                
## ALIGNMENTS  911 -  980
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....2....:....3....:....4....:....5....:....6....:....7....:....8
     1    1 L D              0   0  183  420   16            DDDDDDDDDQ       DQD          E  DDD       E     DDE  D     
     2    2 L I        -     0   0   32  462   11            IIIIIIIIVI       IIV          I  III       I    IVII  V     
     3    3 L E        -     0   0  117  463   68            TVVVVVVVVT       VVV          V  IVV       I    VVVV  V     
     4    4 L L  E     -K   25   0D  10  474    7            LMMMMMMMMV       MLM          M  LLM       L    MMLM  M     
     5    5 L T  E     -K   24   0D  64  475    8            TTTTTTTTTT       TTT          T  TTT       T    TTTT  T     
     6    6 L Q  E     -K   23   0D  13  475    0            QQQQQQQQQQ       QQQ          Q  QQQ       Q    QQQQ  Q     
     7    7 L T  E    S+K   22   0D  64  475   34            TTTTTTTTTS       TST          S  STT       T    TSST  S     
     8    8 L P        -     0   0   46  480    9            PPPPPPPPPP       PPP          P  PPP       P    PPPP  P     
     9    9 L V  S    S+     0   0   96  484   67            TLLLLPLLLS       LDV          G  ALL       K    SLAL  L     
    10   10 L S  E     -n  104   0E  60  485   43            FCSSSSSSSS       SYS          S  SSS       V    SFSS  S     
    11   11 L L  E     -n  105   0E  58  489   21            LLLLLLLLLK       LVL          L  LLL       Q    KLLL  L     
    12   12 L S  E     +n  106   0E  60  490   42            SAPPPPPSPS       SSS          A  ASA       S    SPAS  P     
    13   13 L A  E     -n  107   0E   0  490   58            VVVVVVVIVV       VVV          G  AVV       A    VVVV  V     
    14   14 L S    >   -     0   0   47  491   29            ATTTTTTTTL       SSS          S  SFT       V    PTST  T     
    15   15 L V  T 3  S+     0   0   76  491   66            LLPPPPPPPP       PPL          A  PPP       P    VLLP  L     
    16   16 L G  T 3  S+     0   0   42  491    4            GGGGGGGGGG       GGG          G  GGG       G    GGGG  R     
    17   17 L E    <   -     0   0   71  491   35            EEEEEEEEEE       EEG          E  EEE       Q    DEQE  Q     
    18   18 L T        -     0   0   69  491   62            KPPPPPPPPS       PTQ          S  TTP       T    TPRP  P     
    19   19 L V  E     - L   0  75D  11  491   37            VVAAAAATVI       AVV          V  VAA       V    VAAA  A     
    20   20 L T  E     - L   0  74D  67  490   30            TSSSSSSSST       STS          S  TSS       S    TSTS  S     
    21   21 L I  E     - L   0  73D   1  489   17            IIIIIIIIII       IFI          I  III       V    IIII  I     
    22   22 L T  E     -KL   7  72D  29  489   58            NSSSSSSSST       STS          N  NSS       R    NQSS  S     
    23   23 L a  E     -KL   6  71D   0  490    1            CCCCCCCCCC       CCC          C  CCC       S    CCCC  C     
    24   24 L R  E     -KL   5  70D 110  490   45            KRRRRRRRRR       RKR          K  KRR       K    QRRR  R     
    25   25 L A  E     -K    4   0D  10  490   29            ASSSSSSSAT       AAS          S  ATA       A    ASAA  S     
    26   26 L S  S    S+     0   0   66  490    4            SSSSSSSSSS       SSS          S  SSS       S    ASSS  S     
    27   27 L E  S    S-     0   0  101  490   38            QQQQQQQQQS       QSQ          Q  QQK       S    QQZQ  Q     
    28   28 L N        +     0   0   83  490   45            DSSSSSSSSS       SHS          S  SSS       S    SSSS  S     
    29   29 L I    >   -     0   0    5  491   32            VLLLLLLLLV       LVF          L  LLL       M    VLVL  P     
    30   30 L Y  T 3   -     0   0  155  491   81            NllllllllG       lSv          l  sel       S    yvnl  v     
    31   31 L S  T 3  S+     0   0   53  467   65            KttttttttS       tNt          n  dtt       N    ntst  t     
    32   32 L Y    <   +     0   0   63  490   52            EYYCYYYYYY       YLY          Y  VYY       Y    RYFY  Y     
    33   33 L L  E     -O   90   0E   0  490    7            VLLLLLLLLM       LLL          L  LLL       L    LLML  L     
    34   34 L A  E     -O   89   0E   0  490   71            SDYDYYDYHH       YAN          A  VSH       L    SBZN  N     
    35   35 L W  E     -OP  88  48E   1  491    0            WWWWWWWWWF       WWW          W  WWW       W    WWWW  W     
    36   36 L Y  E     -OP  87  46E   0  491    9            YYYYYYYYYY       FYY          Y  HHF       Y    FYYY  F     
    37   37 L Q  E     -OP  86  45E   7  491   28            QLLLLLLLLQ       RQL          Q  QLL       L    QLZR  Q     
    38   38 L Q  E     -O   85   0E  21  491    4            EQQQQQQQQQ       QQQ          Q  QQQ       Q    QQZQ  Q     
    39   39 L K    >   -     0   0   51  490    9            KKKKKKKKKK       KKK          K  KKK       K    KKKK  R     
    40   40 L Q  T 3  S+     0   0  190  491   19            PPPPPPPPPP       PSP          P  PPP       P    PPPP  P     
    41   41 L G  T 3  S+     0   0   86  491   10            GGGGGGGGGG       GGG          G  GSG       S    GGGG  G     
    42   42 L K  S <  S-     0   0  126  490   54            LQQQQQQQRQ       QQQ          E  QQR       E    QQZQ  Q     
    43   43 L S        -     0   0   21  490   55            PSPSPPSSSA       SAS          R  ASS       A    PSPS  S     
    44   44 L P        -     0   0    4  490   11            IPPPPPPPPP       PPP          P  PPP       P    PPPP  P     
    45   45 L Q  E     -P   37   0E  74  490   32            KRRQQRQQQK       QKQ          K  KQQ       K    KEKQ  R     
    46   46 L F  E     +P   36   0E  25  490   42            SLLLLLLRLL       GLL          L  RLL       L    GLLL  R     
    47   47 L L  E     +     0   0E   4  490    9            LLLLLLLLLL       LLL          L  LLL       L    LLLL  L     
    48   48 L V  E     -PQ  35  54E   0  491    5            VIIIIIIIIL       III          I  III       V    IIII  I     
    49   49 L Y  E >> S+ Q   0  53E  39  491   17            HYYYYYYYYY       YYY          Y  YYY       Y    YYYY  Y     
    50   50 L N  T 34 S-     0   0   52  491   91            AERERREKKA       LYK          L  GLL       Y    YLRL  K     
    51   51 L A  T 34 S+     0   0    3  491   45            AVVVVVVVVV       VAV          A  AVV       A    ASAV  V     
    52   52 L K  T <4 S+     0   0  148  491   25            SSSSSSSSSS       SSS          S  SSS       T    SSSS  S     
    53   53 L T  E  <  -Q   49   0E  47  491   67            TKNNNNNNNS       NTN          S  NNN       S    TYNN  N     
    54   54 L L  E     -Q   48   0E  60  491   60            LLRRRQRQRL       RRR          W  RRR       R    LRLR  R     
    55   55 L G    >   -     0   0    9  490   71            SVFVFFADEQ       FHL          A  AAA       Q    ADZF  D     
    56   56 L E  T 3  S+     0   0  192  490   35            PSSSSSSSSS       STS          S  SSS       S    SSST  S     
    57   57 L G  T 3  S+     0   0   70  491    5            GGGGGGGGGG       WGG          G  GGG       G    gGGG  G     
    58   58 L V    <   -     0   0   25  489   11            AVVVVVVVVV       VTV          V  VVV       V    dVIV  V     
    59   59 L P    >   -     0   0   47  490    7            PSPPPPPPPP       PPP          P  PPP       S    PPPP  P     
    60   60 L S  T 3  S+     0   0  115  491   57            ADDDDDDDDN       DED          A  DDD       D    SDAD  D     
    61   61 L R  T 3  S+     0   0   44  491    4            RRRRRRRRRR       RRR          R  RRR       R    RRRR  R     
    62   62 L F  E <   +M   75   0D   5  491    1            FFFFFFFFFF       FIF          F  FFF       F    FFFF  F     
    63   63 L S  E     -M   74   0D  55  490   22            SSSSSSSSSS       SSS          S  STS       S    KSSS  S     
    64   64 L G  E     +M   73   0D  13  491    2            GGGGGGGGGG       GGG          S  GGG       G    GDGG  G     
    65   65 L S  E     +M   72   0D  63  491    5            SSSSSSSSSS       SSS          S  SSS       S    SSSS  S     
    66   66 L G  E     -M   71   0D  36  491   14            GGGGGGGGGG       GGG          G  GGG       G    GGGG  G     
    67   67 L S  E >   +M   70   0D  79  491    9            SSSSSSSSSS       SSS          S  SSS       S    SSSS  S     
    68   68 L G  T 3  S-     0   0   16  491   13            GGGGGGDGGG       GGG          G  GGG       G    GGRG  G     
    69   69 L T  T 3  S+     0   0   67  488   13            STTTTTTTTT       TTT          T  TTT       T    TTTT  T     
    70   70 L Q  E <   +LM  24  67D 110  489   27            DDDDDDDNDD       DDD          D  DDD       D    QDBD  D     
    71   71 L F  E     -LM  23  66D   2  491    6            YFFFFFFFFF       FFF          F  FFF       F    FFFF  F     
    72   72 L S  E     -LM  22  65D  26  491   30            ITTTTTTTTS       TTT          T  TTT       T    TTTT  T     
    73   73 L L  E     -LM  21  64D   0  491    2            FLLLLLLLLF       LLL          L  LFL       L    LLLL  L     
    74   74 L K  E     -LM  20  63D  97  491   39            TQKKKKKKKT       RTK          T  TKK       T    TKTR  K     
    75   75 L I  E     -LM  19  62D   0  491    1            IIIIIIIIII       III          I  III       I    IIII  I     
    76   76 L N  S    S-     0   0   86  491   30            SSSSSSSSSS       SSS          N  SSS       S    STBS  S     
    77   77 L S  S    S-     0   0   58  491   62            RRRRRRRKRN       RRR          N  NRR       G    DRPR  R     
    78   78 L L        -     0   0    0  491   27            VVVVVVVVLV       VMV          L  FVV       V    VVVV  V     
    79   79 L L    >   -     0   0   67  491   31            EEEEEEEEQQ       EEE          Q  QEQ       Q    qQZE  E     
    80   80 L P  G >  S+     0   0   92  491   58            AAAAAAAAAI       AAH          A  AAA       A    bAAA  A     
    81   81 L E  G 3  S+     0   0  102  491   13            DEEEEEEEEE       DED          E  EEE       E    BEBD  E     
    82   82 L D  G <  S+     0   0    1  491    5            DDDDDDDDDD       DDD          D  DDD       D    ADDD  D     
    83   83 L F    <   +     0   0   29  490   72            IVVVVVVAVA       AAL          V  AAA       A    AVVM  V     
    84   84 L G  E    S- R   0 105E  17  491   23            AGGGGGGGGG       GAG          G  AGG       G    TGAG  G     
    85   85 L S  E     -OR  38 104E  24  491   63            NVVVVVVVVD       VDV          D  VVV       V    VVTV  V     
    86   86 L Y  E     -OR  37 103E   0  491    0            YYYYYYYYYY       YYY          Y  YYY       Y    YYYY  Y     
    87   87 L Y  E     -O   36   0E   5  490    4            YYYYYYYYYY       YYY          Y  YYY       Y    YYFY  Y     
    88   88 L a  E     -O   35   0E   0  491    0            CCCCCCCCCC       CCC          C  CCC       C    CCCC  C     
    89   89 L Q  E     -OS  34  99E   0  489   48            MMMMMMMALQ       GQG          Q  QQM       H    QMZG  M     
    90   90 L H  E     -O   33   0E  22  483   26            HQQQQQQQQQ       QQQ          Q  QQH       Q    GQZQ  Q     
    91   91 L H        +     0   0    0  421   89            DGASAAAAGY       NGA          H  GSD       S    YASN  G     
    92   92 L Y  S    S+     0   0  104  454   88            YSLILLLTTS       LYS          Y  KIL       Y    KTBL  T     
    93   93 L G  S    S-     0   0   34  422   71            GQQEQQEQHS       QSK          S  EQE       S    SZZQ  H     
    94   94 L T  S    S-     0   0  104  446   88            WRTFNTFWRF       FGI          S  LAA       F    SSAS  W     
    95   95 L P  S    S+     0   0    7  443   51            PPPPPPPPPP       PSP          P  PPP       P    DPPP  P     
    96   96 L P  S    S-     0   0   55  421   75            PPP PP PPL       SHP          P  PPH       f    TYWP  P     
    97   97 L L        -     0   0   21  160   88            . . .. Q.T        .T          .  ...       h    R..T  W     
    98   98 L T        -     0   0   40  288   41            T T TT W.V        .V          .  .TT       Q    ATTV  T     
    99   99 L F  B     -S   89   0E  18  290   29            D L LL Y.I        .M          .  .VV       F    FFFV  F     
   100  100 L G        -     0   0    3  294   39            G      N.Q        .Q          .  .GG       G    GGGQ  G     
   101  101 L G        -     0   0   52  307   63            S      P.T        ST          .  .QQ       Q    GQSA  Q     
   102  102 L G        -     0   0   11  306   43            G      E.N        DL          .  .GP            GGGG  G     
   103  103 L T  E     - R   0  86E   0  366   18            T      HTT        TT          T  TSS            TTTT  T     
   104  104 L K  E     -nR  10  85E  98  363   58            S      KVK        EK          M  VRQ            EKKQ  K     
   105  105 L L  E     -nR  11  84E   4  343   37            V      LV         LM          F  LMM            VLL   V     
   106  106 L E  E     -n   12   0E 108  326   51            Q       Q         N           Q  QKE            VZE   E     
   107  107 L I  E      n   13   0E 113  301   50                                          S  PLT            VII   I     
   108  108 L K              0   0  145  268   18                                          R  RRQ            KKK   K     
   109      ! !              0   0    0   0     0  
   110    1 H E              0   0  194  408   30  Q  EQQQQQQ                    QQQQQQEQQQ QQ     EQQQQ    E    DQ E  QQ
   111    2 H V        +     0   0   19  465   12  V  VVVVVVV                    VIVVVVVLVV VV     VVVVV    V    VV VV VI
   112    3 H K  E     -A  134   0A 111  467   31  Q  QQQQQRQ                    QHQQQQQKQK QQ     QQQQQ    Q    QQ QT QQ
   113    4 H L  E     -A  133   0A   3  489    1  L  LLLLLLL                    LLLLLLLLLL LL   LLLLLLL    L    LL LL LL
   114    5 H Q  E     -A  132   0A  83  493   70  QV QKQQQQQ                    QVQQQQVKQL QK   TTQQKQL    V    QV VLLQV
   115    6 H E  E     +A  131   0A   5  498   21  EQ QEEEGEE                    QQQQQQEEEE EE   EQQQEQQ    Q    EQ EEEQQ
   116    7 H S  E     +A  130   0A  69  501   13  SS SSSSSSS                    PSPPPPSSSS SS   SSSSSPP    S    SS SCSSS
   117    8 H G        +     0   0   36  505    4  GG GGGGGGG                    GGGGGGGGGG GG   EEGGGGG    G    GG GGGDG
   118    9 H G        +     0   0   29  672   48  PA PPPPPPP          PP DAPP   APAAAAAPPP PP   SPAPPAT PPPA    PA AGGAP
   119   10 H D        -     0   0   96  677   40  GE EGCSSSS          GGGDEGG   EEEEEEENSG GG   VVEEGEE GGGE    GE EDDEE
   120   11 H L  E     +e  224   0B  79  675   16  LV LLLLLLL          LLLLLLL   LLLLLLVLLL LV   VVLVLLL LLLV    LV VLLLL
   121   12 H V  E     -e  225   0B  16  677   33  VK VVVVVVV          VVVVMVV   VKVVVVKVVV VV   KKVVVVV VVVR    VK KQQVK
   122   13 H Q    >   -     0   0  114  679   51  KKKKAKKKKK          AQAKKAA   KKRKKKKKKK KK   RRKRAKK AAAK    KK KPPKT
   123   14 H P  T 3  S+     0   0   66  678    9  PPPPPPPPPP          PPPPPPP   PPPPPPPPPP PP   PPAPPPP PPPP    PP PPPPP
   124   15 H G  T 3  S+     0   0   58  682   32  SGGGSSSSSS          SSSGGSS   GGGGGGGGSS SS   GGGGSGG SSSG    SG GGGGG
   125   16 H G    <   -     0   0   25  684   63  ESADQQQQQQ          QQQAAQQ   AETAAAAAQQ QQ   EESVQAA QQQA    QA AGTAE
   126   17 H S        +     0   0   78  683   31  TSSSSTTTTT          SSSSSSS   STSSSSSSTS TT   SSSSSSS SSSS    SS SSSST
   127   18 H L  E     - B   0 192A  25  685   25  LVVVLLLLLL          LLLVVLL   VVVVVVVVLL LL   HHVVLVV LLLV    LV VLIVV
   128   19 H K  E     - B   0 191A  93  683   56  SKKKSSSFSS          SSSKKSS   KKKKKKKKSS TS   RTKKSQN SSSK    SK KTAKK
   129   20 H L  E     - B   0 190A   0  688   14  LVLMILLLLL          IIILIII   MILMLLVILL LL   LLMIILL IIII    LV VLLII
   130   21 H S  E     -AB 116 189A  28  688   37  TSSSTTTTTT          TTTSSTT   SSSSSSSSTT TT   TTSSTSS TTTS    TS SLVSS
   131   22 H b  E     -AB 115 188A   0  688    0  CCCCCCCCCC          CCCCCCC   CCCCCCCCCC CC   CCCCCCC CCCC    CC CCCCC
   132   23 H A  E     -AB 114 187A  52  688   66  TKKKTTTTTT          TTTKKNT   KKKKKKKKTT SA   SSKKTKK TTTK    SK KRRKK
   133   24 H A  E     +A  113   0A   8  688   49  VAAAIVVVVV          IVVAAVV   AAAAAAAAVV VV   AAAGVAA VVVA    VA AAGAA
   134   25 H S  E     +A  112   0A  58  688   12  SSSSSSSSSS          SSSSTSS   SSSSSSSSST SS   SSTSSSS SSSS    TS SSSSS
   135   26 H G  S    S+     0   0   56  688    4  GGGGGGGGGG          GGGGGGG   GGGGGGGGGg gG   GGGGGGG GGGG    gG GGGGG
   136   27 H F  S    S-     0   0   33  686   34  GGYYFFFFFF          FFFYYFF   FYYYYYYYFs iF   FFYYFHY LFFY    sY YFFYY
   137   28 H T    >   -     0   0   93  687   50  STTTSSSSSS          SSSTTSS   STTTTTTSSI TS   TTTTSTT SSST    IT TNDTT
   138   29 H F  G >  S+     0   0    2  688   41  IFFFLLFLLL          LLLFFLL   FFFFFFFFLT TL   FFFFLFF LPLF    TF FFFFF
   139   30 H S  G 3  S+     0   0   57  688   55  CSTTTTSTTT          TTTTSTT   TTTTTTTTTS ST   SSSTTTT TTTT    SS TGGTT
   140   31 H S  G <  S+     0   0   71  688   60  SSSSSSNSSS          SSSSDRG   SSSSSSGGSD GS   SDSDGNS SRSS    GN GDNDD
   141   32 H Y  S <  S-     0   0   44  688   41  YYYYYRNYNG          YYYYYYY   YYYYYYYYNY YY   YYYYYYY YYYY    YY YFHHY
   142   33 H T        -     0   0   30  688   91  YAWVGGAAAA          GGGWWGA   KGWWWWYYAA SD   GGEAGWW GGGN    YY YGGAS
   143   34 H M  E     -FG 207 160C   0  672   46  WIMMVVVVVV          VVVIIVV   ILMIMMMIVW WV   MMLMVIM VVVM    WM MMMII
   144   35 H S  E     -FG 206 159C   0  685   73  SSHHHNGNGG          HHHNEHN   LTHTRHHHGN SG   NHYHNHH NSSH    NN HGFHH
   145   36 H W  E     +FG 205 158C   0  688    0  WWWWWWWWWW          WWWWWWW   WWWWWWWWWW WW   WWWWWWW WWWW    WW WWWWW
   146   37 H V  E     -FG 204 156C   0  688   19  IVVVVVVVVV          VVVIVVV   VVVVVVVVVI IV   VVVVVVI VVLV    IV VYIVV
   147   38 H R  E     -FG 203 155C  10  688   17  RRKKRRRRPR          RRRKKRR   KIKKKKRKRR RR   RRRKRKR RRRR    RR RRRKK
   148   39 H Q  E     -FG 202 154C   9  688    3  QQQQQQQQQQ          QQQQQQQ   QQQQQQQQQQ QQ   QQQQQQQ QQQQ    QQ QQQQQ
   149   40 H T    >   -     0   0    9  688   68  PARKPAAAAA          PSPRRPP   TSRRRRASAF FA   AAASPRR PPPA    FA AKRNA
   150   41 H P  T 3  S+     0   0   80  687   10  PPP.PPPPPP          PPPPPPP   SPPPPPPHPP PP   PPPHPPP PPPP    PP PPPPP
   151   42 H E  T 3  S-     0   0  151  688   26  GGGLGGGGGR          GGGGGGG   GGGGGGGVGG RG   GGGAGGG GGGG    GG GGGEG
   152   43 H K    <   +     0   0  121  688   32  KQREKKKKKK          KKKQHKK   QKQQRRQKKN KK   KKQKKQQ RKKQ    NQ QKKQK
   153   44 H R        -     0   0  113  687   43  GGGGGSTAVA          GGGGGGG   GDGGGGGSAK GG   GGGSGGG GGGG    KG GTGGD
   154   45 H L  E     -G  148   0C   9  688   14  LLLLLLLLAL          LLLLLLL   LLLLLLLLLL LL   LLLLLLL LLLL    LP LLLLL
   155   46 H E  E     -G  147   0C  44  687    5  EEEEEEEEEE          EEEEEEE   EKEEEEEKEE EE   EEEEEEE EEEE    EE EEEEK
   156   47 H W  E     +G  146   0C  15  687   11  WWWWWWWWWW          WWWWWWW   WWWWWWWWWW FW   WWDWWWW WWWW    WW WYYWW
   157   48 H V  E     -     0   0C   0  687   28  IMIILVVVLV          LLLIILL   VMIIIIMIVM IV   IILILII LLLI    MM MIVIM
   158   49 H A  E     -G  145   0C   0  688   38  GGGGVGGGGS          VGGGGGG   GGGGGGGGGG GG   ASGGGGG AGGG    GG GAAGG
   159   50 H S  E     -GH 144 168C   0  688   94  YrRyVGNNGS          VVVREVM   TWVDRRWRFY EA   YAYVTEG VVVQ    YV WRQYW
   160   51 H I  E     -GH 143 167C   4  675   18  IiIlIIIIMI          IIIIIII   IIIIIIIIII II   IIIIIII IIII    II IIIFI
   161   52 H N    >   -     0   0   47  682   84  YPDYWWWLNG          WWWALWW   YNDYDDNNYT YD   CNSSWNN WWWY    SN NNTSN
   162   53 H N  T 3  S+     0   0   65  684   88  YIPNSSSNNT          SSAPPTG   PTPPPPPPTY NN   TTSTGPP GGGP    YP PNNPT
   163   54 H G  T 3  S-     0   0   65  686   68  SLNDDDDDGS          DGGGGGD   GFSGNNNYRS DG   SDSYNNS DDDG    DS NNTGE
   164   55 H G  S <  S+     0   0   30  687   43  GGSGGGGGGG          GGGSSGG   NSDSSSSNGG GG   SGSNGDN GGGN    GG SGGNT
   165   56 H G  S    S+     0   0   74  688   63  SIGTSSSNTG          SSSGDIS   GGSGGGGGSR SS   SSAGSGG TSSS    SG WGGDG
   166   57 H R        +     0   0  163  505   86  ..G.......          ...ST..   DVYSGGGA.. ..   PIYN.RG ...D    .S TSNDE
   167   58 H T  E     -H  160   0C  62  677   52  TAT.TTTT.L          TTTTTTT   TPTTTTTTIT TT   IQPTTST TTTT    HA TTTFP
   168   59 H Y  E     +H  159   0C  53  686   85  NNKKTDYYYY          TDNYNND   STNNKKNSYT YC   YYNSDNN NNND    NR NGYKT
   169   60 H Y        -     0   0   44  688    9  YYYYYYYYYY          YYYYYYY   YYYYYYYYYY YY   YYYYYYY YYYY    YY YYYYY
   170   61 H P    >>  -     0   0   20  688   65  TANNNKNNNN          NNNNNNN   NANNNNANNN SN   SSANNNN HHHA    NS AAANA
   171   62 H D  T 34 S+     0   0  148  688   64  PQEESPPPPP          SASEESS   QDQEEEQQPP PP   QEQQSEE SSSQ    PQ QPPED
   172   63 H T  T 34 S+     0   0   90  688   57  SKKKAAAAAA          AAAMKAA   KDKKKKKNAS SA   SSKKTKK AAAE    SK KSSRD
   173   64 H V  T X> S+     0   0    1  688   42  LFFFLLLLLL          LFLFFLL   FFFFFFVFML LL   VVFFLFF LLLF    LF FVVFF
   174   65 H K  B 3< S+c  177   0A 142  687   31  KQKKKKKKKK          KIMKKMK   KKKKKKQNKK KK   QKQKKKK IIIQ    KQ QKRKT
   175   66 H G  T 34 S+     0   0   74  687   36  SGRGSSSSSS          SSSGGSS   GGGSSSGDSS SS   GGGGSNS SSSG    NG GGGGG
   176   67 H R  T <4 S+     0   0   36  688   17  RRKKRRRRRR          RRRKKRR   RRKKKKRKRR RR   RRRKRKK RRRR    RR KRRKR
   177   68 H F  E  <  -cD 174 192A   2  688   60  VVAALLLLLL          LLLAALL   AFAAAAVALI TL   FFVALAA LLLV    IL VFIAF
   178   69 H T  E     - D   0 191A  79  688   38  TTTTSSSSSS          SSSTTTS   AATTTTTSSS SS   SITTTTT TSST    ST TTSTA
   179   70 H I  E     + D   0 190A   5  688   20  IILLIIIIII          IIILFII   LFLLLLMLII II   IIIMILL IIII    IM MIILF
   180   71 H S  E     - D   0 189A  51  684   41  STTTSTTSTT          SSSTTSN   TSTTTTTTTT ST   SSTTTTT SSST    TT TSSTS
   181   72 H R  E     - D   0 188A  30  687   60  VAVSKRRRRR          KKKVARK   ALVVVVRVRR RR   RRAVKVV KKKA    RR KRRAL
   182   73 H D  E > > - D   0 187A  60  686    7  DDVDDDDDDD          DDDDDDD   DDDDDDDDDD DD   DDDDDDD DDDD    DD DDDDE
   183   74 H N  G > 5S+     0   0   48  688   57  RKKKNTTTPT          NNNTTNN   KTTKKKTKTT TT   DNEKNKK NNNK    TT TNNKT
   184   75 H A  G 3 5S+     0   0   99  688   45  SSPSSSSSSS          SSSSSSS   SSSPPPTSSS SS   SNSSSSS FSSS    SS SGGSS
   185   76 H K  G < 5S-     0   0  111  688   51  KTSSKRKKKK          KKKSSKK   STSSSSISKK KK   SRTSKSS KKKT    KT IQQSA
   186   77 H N  T < 5 +     0   0   62  688   46  NSSSSSSSSS          SSSSNSS   SSSSSSSSSN NS   SANSSSS RSSS    NS SSSSS
   187   78 H T  E   < -BD 132 182A  16  688   69  QTTTQQQQQQ          QQQTTQQ   TTTTTTTTQQ QQ   KQTTQTA QQQT    QT TSSTT
   188   79 H L  E     -BD 131 181A   0  687   56  FAAAVVVVVV          VVVAAVV   AAAAAAAAVF FV   LLAVVAT VVVA    FV AVVAA
   189   80 H Y  E     -BD 130 180A  41  687   46  SYYYFSSSSS          FFFYYFF   YYYYYYYYSF SY   YNYHFYY FFFY    FY YTTYY
   190   81 H L  E     -BD 129 179A   0  687    7  LMMMLLLLLL          LFLIMLL   MLMMMMMMLL LL   LLMMLMM LLLV    LM MLLVL
   191   82 H Q  E     -BD 128 178A  76  687   41  KEQEKSSSST          KKKQQKK   RQQQQQEESQ QQ   QQEEKQQ KKKE    KD ETTQQ
   192   83 H M  E     +BD 127 177A   0  688   11  LLLLVLLLLV          MMMLLMM   LILLLLLLLL LL   MMLLMLL LLLL    LL LMMLI
   193   84 H S        +     0   0   42  688   54  TSSSNSSSSS          NNNSSNN   SDSSSSSHSN ST   NNSANSS TNNN    NS SNNNN
   194   85 H S  S    S-     0   0   68  687   24  SSSSSSSSSG          SSSSSSS   SNSSSSRSSS SS   SSSRSST SSSS    SS RNSSN
   195   86 H L        -     0   0    3  686   18  LLLLLVVVVV          LLLLLLL   LLLLLLLLVV MV   LLLLLLP LLLL    VL LLLLL
   196   87 H K    >   -     0   0  102  686   68  TRTTQTSTTT          QQQSTQQ   TKTTTTRTTT TN   RKRTQTT QQQR    TR RKKTK
   197   88 H S  G >  S+     0   0   70  686   60  ASSSASITST          TATSSTI   SNSSSSSSTT TP   MTSSTPS TTTA    IS SDDSN
   198   89 H E  G 3  S+     0   0  126  687   22  AEEEDEDEEE          DNDEEDD   EEEEEEDEEE EE   EEEEDEE DDDE    ED DEEEE
   199   90 H D  G <   +     0   0    2  687    3  DDDDDDDDDD          DDDDDDD   DDDDDDDDDD DD   DDDDDED DDDD    DD DDDDD
   200   91 H T    <   +     0   0   32  688   28  TTSSTTTTTA          TTTSSTT   STSSSSTSTT TT   TSTSTFS TTTT    TT TSSST
   201   92 H A  E    S- I   0 223C   8  686    5  AAAAAAAAAA          AAAAAAA   AAAAAAAAAA AA   AAAAAAA AAAA    AA AAGAS
   202   93 H M  E     -FI 148 222C  58  687   48  VVVVMMVVVV          MIMVVVK   VTVVVVVVVT MV   VVVNRVV TTTV    TV VVAVT
   203   94 H Y  E     -FI 147 221C   0  688    1  YYYYYYYYYY          YYYYYYY   YYYYYYYYYY YY   YYYLYYY YYYY    YY YYYYY
   204   95 H Y  E     -F  146   0C   7  688    4  FYYYYYYYYY          YYYFYYY   YFYYYYYYYY YY   YYFYYYY YYYY    YF YFFFF
   205   96 H b  E     -F  145   0C   0  688    1  CCCCCCCCCC          CCCCCCC   CCCCCCCCCC CC   CCCCCCC CCCC    CC CCCCC
   206   97 H V  E     -FJ 144 217C   0  688   23  AAAAAAAAAA          AAAAAVA   TSAAAAAAAA AA   AAAAAAA AAAA    AA AVATA
   207   98 H R  E     -FJ 143 216C  21  687   40  rsrrrKrrrr          rrrrrrr   rTpprrrirR rk   rrvRsrr rkkr    rr rkRri
   208   99 H H  E     + J   0 214C   6  583   92  wwegd.gygg          yadtsgi   dRdnvggvgG hr   ysi.sdg rnnt    ek rg..y
   209  100 H E  E  >  + J   0 213C  63  625   78  GGIDP.WSYA          GIGGDSS   WGDHANDEYI QE   LSS.DGD PGGT    EG GG..Y
   210  101 H Y  T >4 S-     0   0   80  658   93  PPYPPSTTLP          SNSDRSF   NGWLPWADAS ER   VLRYKYR LYYL    YF LAC.A
   211  102 H Y  T 34 S-     0   0  140  672   23  YYyNFYyWyY          YYYYYYF   FfYYFYFYyY CL   FYYyYYY YYYF    Yy WYf.y
   212  103 H Y  T 34 S+     0   0   39  265   92  .Wa...gTh.          W.W..VY   .t......c. ..   V..nFD. ....    Yy ..sld
   213  104 H A  E <<  -J  209   0C   0  403   87  YYWA..GGHS          YAY..GA   .A.....ASG TL   F..YTW. A...    AG ..GNP
   214  105 H M  E     +J  208   0C   0  497   62  FFFM.FIIII          FMF.FFM   .LFF.F.VIL LR   I.FFLFF L...    MM FVCML
   215  106 H D  E     +     0   0C  19  615   50  DDADAEDNDD          DDD.DAD   DDDDDDDDDA GK   KNDDDVD DDDD    DD DDYAD
   216  107 H Y  E     -J  207   0C  99  624   65  YLYYYYYYYY          VYV.VYY   VTVYYVIYYY YL   FFGYYYV YYYV    YV PQVYY
   217  108 H W  E     -J  206   0C  23  675    2  WWWWWWWWWW          WWWWWWW   WWWWWWWWWW WW   WFWWWWW WWWW    WW WSWWW
   218  109 H G        -     0   0    0  664   17  GGGGGGGGGG          GGGGGGG   GGGGGGGGGG  G   LSGGGGG GGGG    GG GGQGG
   219  110 H Q        -     0   0   91  659   46  QRQQQPPPPP          AQAQAQQ   AQTQQTQQPQ  Q   KSQQQQT QQQP    QQ QRVQQ
   220  111 H G        -     0   0   16  650   16  GGGGGGGGGG          GGGGGGG   GGGGGGGGGG      GPGGGGG GGGG    GG GGGGG
   221  112 H T  E     -I  203   0C  21  594   27  TTTTTLLLLL          TTTTTTT   TTTTTTTTLT      .PTTTTT TTTT    TT T..TT
   222  113 H T  E     -I  202   0C  72  593   76  LLLSLLLLLL          ASTTTLS   TSTTTTMTLL      ILLTSLT STTL     T L.YSS
   223  114 H V  E     -I  201   0C   0  596   20  VVVVVVVVVV          VVVLVVV   VLVLLVVVVV      IVVLVVV VLLV     V V.AVV
   224  115 H T  E     -e  120   0B  36  593   20  TTTTTTTTTT          TTTTTTT   TTTTTTTTTT       T TTTT TTTT     T T.STT
   225  116 H V  E     +e  121   0B   6  572    6  VVV VVVVVV          VVVVVVV   VVVVVVVVVV       L VVFV VVVV     V V.VVV
   226  117 H S        -     0   0   36  566   11  SSS SSSSSS          SSSSSSS   SSSSSSSSSS       G SSSS SSSS     S S.GSS
   227  118 H S  S    S+     0   0   84  551   22  SSA ASSSSS          SSSSSAS    SSSSSSSSA       G SSAS SSSS     S S.ASS
   228  119 H A  S    S+     0   0   70  123   53    A                            AEEEE                           H  .A  
   229  120 H W        -     0   0  123   73   63    K                             SSSS                           P  .   
   230  121 H R        +     0   0  207   60   75    T                             QQQQ                           R  P   
   231  122 H H              0   0  156   54   67    T                             SSSS                           P  S   
   232  123 H P              0   0  155   35   53    P                                                            A  P   
## ALIGNMENTS  981 - 1050
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....9....:....0....:....1....:....2....:....3....:....4....:....5
     1    1 L D              0   0  183  420   16        DDD   D           DDD              D       DD                   
     2    2 L I        -     0   0   32  462   11        VVI   I           IIV     I        VV      II                   
     3    3 L E        -     0   0  117  463   68        VLV   I           VVV     V        VA      VV                   
     4    4 L L  E     -K   25   0D  10  474    7        MLM   M           IIL     M        LV      MM                   
     5    5 L T  E     -K   24   0D  64  475    8        TTT   T           TTT     T        TK      TT                   
     6    6 L Q  E     -K   23   0D  13  475    0        QQQ   Q           QQQ     Q        QE      QQ                   
     7    7 L T  E    S+K   22   0D  64  475   34        TTT   S           DDT     S        TP      ST                   
     8    8 L P        -     0   0   46  480    9        PPP   P           EEP     P        PP      PP                   
     9    9 L V  S    S+     0   0   96  484   67        VLL   A           LLG     L        VE      AL                   
    10   10 L S  E     -n  104   0E  60  485   43        SFS   S           SSS     T        AF      TS                   
    11   11 L L  E     -n  105   0E  58  489   21       LLLL   L           NKL     L        MR      ML                   
    12   12 L S  E     +n  106   0E  60  490   42       APPP   T           PPS     S        PA      AA                   
    13   13 L A  E     -n  107   0E   0  490   58       VVVV   A           VVV     V        VV      VV                   
    14   14 L S    >   -     0   0   47  491   29       SSST   S           TTT     T        TS      ST                   
    15   15 L V  T 3  S+     0   0   76  491   66       LLLP   P           SSL     I        LA      PP                   
    16   16 L G  T 3  S+     0   0   42  491    4       GGGG   E           GGG     G        GG      GG                   
    17   17 L E    <   -     0   0   71  491   35       QSDE   G           EED     Q        DE      EE                   
    18   18 L T        -     0   0   69  491   62       RQQP   T           SSQ     P        QT      RP                   
    19   19 L V  E     - L   0  75D  11  491   37       AVAA   V           VVA     A        AV      VA                   
    20   20 L T  E     - L   0  74D  67  490   30       TSSS   T           SSS     S        ST      TS                   
    21   21 L I  E     - L   0  73D   1  489   17       IIII   I           III     I        II      II                   
    22   22 L T  E     -KL   7  72D  29  489   58       STSS   N           SSS     S        SN      HS                   
    23   23 L a  E     -KL   6  71D   0  490    1       CCCC   C           CCC     C        CC      CC                   
    24   24 L R  E     -KL   5  70D 110  490   45       RRSR   K           RRR     K        RK      KK                   
    25   25 L A  E     -K    4   0D  10  490   29       ASSS   A           SSS     S        SS      SA                   
    26   26 L S  S    S+     0   0   66  490    4       SSSS   S           SSS     S        SS      SS                   
    27   27 L E  S    S-     0   0  101  490   38       QHQQ   Q           KKQ     Q        QQ      QK                   
    28   28 L N        +     0   0   83  490   45       SSSS   S           SSS     S        SS      SS                   
    29   29 L I    >   -     0   0    5  491   32       VLLL   L           LLL     L        LL      LL                   
    30   30 L Y  T 3   -     0   0  155  491   81       svvl   f           lle     l        vl      fl                   
    31   31 L S  T 3  S+     0   0   53  467   65       ntst   d           ttt     t        tn      ht                   
    32   32 L Y    <   +     0   0   63  490   52       LYYY   Y           YYY     Y        YY      LY                   
    33   33 L L  E     -O   90   0E   0  490    7       MLLL   L           LLL     L        LL      LL                   
    34   34 L A  E     -O   89   0E   0  490   71       HSED   N           NNE     N        EA      SY                   
    35   35 L W  E     -OP  88  48E   1  491    0       WWWW   W           WWW     W        WW      WW                   
    36   36 L Y  E     -OP  87  46E   0  491    9       YYHY   Y           FFY     L        YY      YF                   
    37   37 L Q  E     -OP  86  45E   7  491   28       QLLL   Q           LLL     L        LQ      QL                   
    38   38 L Q  E     -O   85   0E  21  491    4       QQQQ   Q           QQQ     Q        QQ      QQ                   
    39   39 L K    >   -     0   0   51  490    9       KKKK   K           RGK     R        KK      KK                   
    40   40 L Q  T 3  S+     0   0  190  491   19       PPSP   P           PPP     P        PP      PP                   
    41   41 L G  T 3  S+     0   0   86  491   10       GGGG   G           GQG     G        GG      GG                   
    42   42 L K  S <  S-     0   0  126  490   54       QQQQ   Q           QQQ     Q        QQ      QR                   
    43   43 L S        -     0   0   21  490   55       QDSS   A           SSS     S        SS      SS                   
    44   44 L P        -     0   0    4  490   11       PPLP   P           PPP     P        PP      PP                   
    45   45 L Q  E     -P   37   0E  74  490   32       KQQQ   K           QRQ     K        QK      KQ                   
    46   46 L F  E     +P   36   0E  25  490   42       LPLL   L           LLL     R        LL      LH                   
    47   47 L L  E     +     0   0E   4  490    9       LLLL   L           LLL     L        LL      LL                   
    48   48 L V  E     -PQ  35  54E   0  491    5       IIII   I           III     I        II      II                   
    49   49 L Y  E >> S+ Q   0  53E  39  491   17       YYYY   Y           SYY     Y        YY      YY                   
    50   50 L N  T 34 S-     0   0   52  491   91       RKEE   F           LLG     L        EL      WG                   
    51   51 L A  T 34 S+     0   0    3  491   45       AVVV   A           MMV     V        VA      AG                   
    52   52 L K  T <4 S+     0   0  148  491   25       SSSS   S           SSS     S        SS      SS                   
    53   53 L T  E  <  -Q   49   0E  47  491   67       NNKN   N           TTN     K        NT      TN                   
    54   54 L L  E     -Q   48   0E  60  491   60       LRRR   R           RRR     L        QR      RL                   
    55   55 L G    >   -     0   0    9  490   71       AFHA   D           AAF     D        FE      AD                   
    56   56 L E  T 3  S+     0   0  192  490   35       SSSS   S           SSS     S        SS      SS                   
    57   57 L G  T 3  S+     0   0   70  491    5       GGGG   G           GGG     G        GG      GG                   
    58   58 L V    <   -     0   0   25  489   11       IVVV   V           VVV     V        VV      VV                   
    59   59 L P    >   -     0   0   47  490    7       PPPP   P           SSP     P        PP      PP                   
    60   60 L S  T 3  S+     0   0  115  491   57       ADDD   D           DDD     D        DD      DD                   
    61   61 L R  T 3  S+     0   0   44  491    4       RRRR   R           RRR     R        RR      RR                   
    62   62 L F  E <   +M   75   0D   5  491    1       FFFF   F           FFF     F        FF      FF                   
    63   63 L S  E     -M   74   0D  55  490   22       SSSS   S           SSI     T        II      SS                   
    64   64 L G  E     +M   73   0D  13  491    2       GGGG   G           GGG     G        GG      GG                   
    65   65 L S  E     +M   72   0D  63  491    5       SSSS   S           SSS     S        SS      SS                   
    66   66 L G  E     -M   71   0D  36  491   14       GRGG   G           GGG     G        GG      GR                   
    67   67 L S  E >   +M   70   0D  79  491    9       SSSS   S           SSS     S        SS      SS                   
    68   68 L G  T 3  S-     0   0   16  491   13       GGGD   G           RGG     G        GG      GG                   
    69   69 L T  T 3  S+     0   0   67  488   13       TSTT   T           TTT     T        TT      TT                   
    70   70 L Q  E <   +LM  24  67D 110  489   27       DYDD   D           DDD     D        DD      DD                   
    71   71 L F  E     -LM  23  66D   2  491    6       FFFF   F           FFF     F        FF      FF                   
    72   72 L S  E     -LM  22  65D  26  491   30       TTTT   T           TTT     T        TT      TT                   
    73   73 L L  E     -LM  21  64D   0  491    2       LLLL   L           LLL     L        LL      LL                   
    74   74 L K  E     -LM  20  63D  97  491   39       TKKK   T           EEK     K        KT      TK                   
    75   75 L I  E     -LM  19  62D   0  491    1       IIII   I           III     I        II      II                   
    76   76 L N  S    S-     0   0   86  491   30       DSSS   S           SSS     S        SS      SS                   
    77   77 L S  S    S-     0   0   58  491   62       PRRR   N           RRR     R        RS      SR                   
    78   78 L L        -     0   0    0  491   27       VGVV   F           VVV     V        VV      LV                   
    79   79 L L    >   -     0   0   67  491   31       QEEE   Q           KKE     E        EQ      QQ                   
    80   80 L P  G >  S+     0   0   92  491   58       APPA   A           AAP     A        PA      AP                   
    81   81 L E  G 3  S+     0   0  102  491   13       DEEE   E           EEE     E        EE      EE                   
    82   82 L D  G <  S+     0   0    1  491    5       DDDD   D           DDD     D        DD      DD                   
    83   83 L F    <   +     0   0   29  490   72       ILLV   A           VVL     L        LL      VA                   
    84   84 L G  E    S- R   0 105E  17  491   23       AGGG   A           GGG     G        GA      AG                   
    85   85 L S  E     -OR  38 104E  24  491   63       AVVV   V           VVV     V        VD      DV                   
    86   86 L Y  E     -OR  37 103E   0  491    0       YYYY   Y           YYY     Y        YY      YY                   
    87   87 L Y  E     -O   36   0E   5  490    4       YYYY   Y           YYY     Y        YY      FY                   
    88   88 L a  E     -O   35   0E   0  491    0       CCCC   C           CCC     C        CC      CC                   
    89   89 L Q  E     -OS  34  99E   0  489   48       QGFM   M           QQF     V        FQ      QM                   
    90   90 L H  E     -O   33   0E  22  483   26       QQQQ   Q           QQQ     Q        QQ      QQ                   
    91   91 L H        +     0   0    0  421   89       SRGE   N           LLA     G        AH      FA                   
    92   92 L Y  S    S+     0   0  104  454   88       RTTF   Y           VVT     T        TY      IL                   
    93   93 L G  S    S-     0   0   34  422   71       EHHE   D           EEH     H        HS      SE                   
    94   94 L T  S    S-     0   0  104  446   88       SYLI   D           YYD     F        FY      AF                   
    95   95 L P  S    S+     0   0    7  443   51       PPPG   P           PPP     P        PP      PP                   
    96   96 L P  S    S-     0   0   55  421   75       PPPQ   P           LLP     L        PP      PH                   
    97   97 L L        -     0   0   21  160   88       .TT.   M           ..T     .        TT      ..                   
    98   98 L T        -     0   0   40  288   41       TVVT   V           TTV     T        VV      ..                   
    99   99 L F  B     -S   89   0E  18  290   29       VMMA   L           FFM     F        ML      ..                   
   100  100 L G        -     0   0    3  294   39       GQQG   Q           GGQ     G        QQ      ..                   
   101  101 L G        -     0   0   52  307   63       TTTM   S           AAT     A        TP      ..                   
   102  102 L G        -     0   0   11  306   43       GLLG   R           GGL     G        LP      ..                   
   103  103 L T  E     - R   0  86E   0  366   18       NTTT   T           TTT     T        TT      TT                   
   104  104 L K  E     -nR  10  85E  98  363   58       KKKS   K           KKK     K        KQ      VV                   
   105  105 L L  E     -nR  11  84E   4  343   37       LMLK   T           LLM     L        MT      II                   
   106  106 L E  E     -n   12   0E 108  326   51        SSE   S           EES     E        SS      QQ                   
   107  107 L I  E      n   13   0E 113  301   50        VLH   S           LLL     L        LL      P                    
   108  108 L K              0   0  145  268   18          R   R           KK      K         R      R                    
   109      ! !              0   0    0   0     0  
   110    1 H E              0   0  194  408   30  QQQQQ    QQQ  DE           DDEQ    QQQQQQ  QQEQQE  E  QD QE Q QQQQQQQE
   111    2 H V        +     0   0   19  465   12  LLVVV    VVV  VV           VVVV    VVVVVV  IVVVVV  I  LVVVV V VVVVVVLV
   112    3 H K  E     -A  134   0A 111  467   31  KRKQR    QQQ  QQ           QQQR    HRRRRR  RQRQQK  R  QQQQQ Q KRRRKKQQ
   113    4 H L  E     -A  133   0A   3  489    1  LLLLL    LLL LLL           LLLL    LLLLLL  LLLLLL  LVLLLLLLML LLLLLLLL
   114    5 H Q  E     -A  132   0A  83  493   70  QQLEQ    QQV QQQ           QQEV    QQQQQQ  EVLQQQ  EEQQQQQQLQ LQQQLLQV
   115    6 H E  E     +A  131   0A   5  498   21  EEEEE    EEQ EEE           EEQE    QEEEEE  EQEEEE  EEEEEEQQEQ EEEEEEEQ
   116    7 H S  E     +A  130   0A  69  501   13  SSSSS    SSS SSS           SSSS    WSSSSS  SSSSSS  SSSSSSWSSS SSSSSSSS
   117    8 H G        +     0   0   36  505    4  GGAGG    GGG GGG           GGGG  G GGGGGG  GGGGGG  GGGGGGGGGG GGGGGGGG
   118    9 H G        +     0   0   29  672   48  PPPPP    PPA PPPPPPPAAAA   PPPGP PPTPPPPP  GAGPPP  GGPPPPAPPAPPPPPPPPA
   119   10 H D        -     0   0   96  677   40  EGGSN    GGE GGSDGGGEEEE   GGQNQ GGGSSSSS  GEGGGG  GRGGGGGEGEGGSSSGSGE
   120   11 H L  E     +e  224   0B  79  675   16  LLLLL    LLV TLLLLLLLLLL   LLLVL LLLLLLLL  VVMLLL  LLLLLLLLLLLLLLLLLLV
   121   12 H V  E     -e  225   0B  16  677   33  VVVVV    VVR VVVVVVVVVMV   VVKVV VVLVVVVV  KKKVVV  KVVVVVLEVVVVVVVVVVK
   122   13 H Q    >   -     0   0  114  679   51  KKKKK    KKK KKKKAAARRKR   KKTQR KKKKKKKK  KKYKKK  KTKKKKKKKRQKKKKQQKR
   123   14 H P  T 3  S+     0   0   66  678    9  PPPPP    PPP PPPPPPPSSPP   PPPSP PPPPPPPP  VPSPPP  PPPPPPPPPPPPPPSPPPP
   124   15 H G  T 3  S+     0   0   58  682   32  GSSSS    SSG SSSGSSSGGGG   SSGGG SSSSSSSY  GGGSTS  GTSSSSSGSGSSSSSSSSG
   125   16 H G    <   -     0   0   25  684   63  AEEQQ    QQA EQQAQQQAAAV   QQEMA EQEQQQQQ  EAEQQQ  GPQEQQEAQTQEQQQQQEE
   126   17 H S        +     0   0   78  683   31  STTTT    TTS SSTSSSSSSSS   SSTSS TTTTTTTT  SSSTTT  SGTTSSTSTSTTTTTSSTS
   127   18 H L  E     - B   0 192A  25  685   25  VLLLL    LLV LLLVLLLVVVV   LLVLV LLLLLLLL  LVLLLL  ALLLLLLVVVLLLLLLLLL
   128   19 H K  E     - B   0 191A  93  683   56  ESSSS    SSK RSSKSSSKKKK   SSERK SSSSSSSS  SKHTSS  HTSSSSSKSKSSSSSSSPR
   129   20 H L  E     - B   0 190A   0  688   14  ILLLL    LLV LLLMIIVLLII   LLILI LLLLLVLL  LVLVLL  LLLLLLLILVLLLLLIILI
   130   21 H S  E     -AB 116 189A  28  688   37  STTTT    TTS TTTSTTTSSSS   TTSSS TTTTITTT  SSSTTT  STTSTTSSSSTTTTTTTTS
   131   22 H b  E     -AB 115 188A   0  688    0  ICCCC    CCC CCCCCCCCCCC   CCCCC CCCCCCCC  CCCCCC  CCCCCCCCCCCCCCCCCCC
   132   23 H A  E     -AB 114 187A  52  688   66  KSTTT    TSK TSSKTTTTTKK   SSKTK TAATTTTA  KKQTST  RTATSSAKTKATTTTTTAK
   133   24 H A  E     +A  113   0A   8  688   49  AVVVV    VVA VVVAVVVATGG   VVAGA VIVVVVVV  TAAVVV  TVVVVVVAVAIVVVVVVVT
   134   25 H S  E     +A  112   0A  58  688   12  SSSSS    SSS STTSSSSSSTS   TTSSS SSYSSSSS  SSSSST  TSSSTTYSSSSSSSSSSSS
   135   26 H G  S    S+     0   0   56  688    4  GggGG    gGG GgGGGGGGGGG   ggVGG ggGGGGGG  GGWGgG  GGgggdGGgGgGEGGGGgG
   136   27 H F  S    S-     0   0   33  686   34  YsvFF    iFY FsDDFFFFVYY   ssYFY ivGFLFFF  FYFFiY  FFiisiGYiYvGFFFFFsY
   137   28 H T    >   -     0   0   93  687   50  SSRSS    TPT EISTSSSNNTT   IITSS SSSSSSSP  STDSTS  PSTSITSSNGSSSSSSSIS
   138   29 H F  G >  S+     0   0    2  688   41  FGSLL    TIF LTIFLLLIIFF   ATLFF STFLLLLL  FFFLTI  FLTSISFFTLSILLLLLSF
   139   30 H S  G 3  S+     0   0   57  688   55  TGGTT    STT TSTTTATKKST   SSTET SNSTSTTS  DTGTGT  SSSTSGSTATNSTTTTTST
   140   31 H S  G <  S+     0   0   71  688   60  YLSSS    STS SGSDSSSDDND   GGDTS SSDSSNSN  SSGSYS  GSSNGYGGNNSSTSSTTNS
   141   32 H Y  S <  S-     0   0   44  688   41  YYYNK    YSY YYDSYYYYYYY   YYYYY YAYNYYYY  YNYYYG  YYYYYYYYYEAFYNNYYYS
   142   33 H T        -     0   0   30  688   91  YWYNA    DgW YFYVGGGYYWA   YYSAW YTYDGAGG  WFTHWy  WDRYYWYNYLSYGAAGGWW
   143   34 H M  E     -FG 207 160C   0  672   46  M.WVV    WwM VWWIVVVMMIM   WWLMM WWWVVAVV  MMMM.w  MMWWW.WMWIWWVVVII.I
   144   35 H S  E     -FG 206 159C   0  685   73  HGSGD    TNH YNNTHSSHNEH   SSHHH GNSVTGAE  YHSHSS  SGSGNHNNSENSGDGHHSS
   145   36 H W  E     +FG 205 158C   0  688    0  WWWWW    WWW WWWWWWWWWWW   WWWWW WWWWWWWW  WWWWWW  WWWWWWWWWWWWWWWWWWW
   146   37 H V  E     -FG 204 156C   0  688   19  MVIVV    IIV IIIMVVVVVVV   FIVVV IIIVVVVV  YVYIIV  VVIIIIIVIIIIVVVVVIV
   147   38 H R  E     -FG 203 155C  10  688   17  KRRRR    RRR RRRKRRRKKKK   RRKRK PRRRRRRR  RRRRRR  RRRRRRRKRKRRRRRRRRR
   148   39 H Q  E     -FG 202 154C   9  688    3  QQQQQ    QQQ QQKQQQQQQQQ   QQQQQ QQQQQQQQ  QQQQQQ  QQQQQQQQQKQHQQQQQQQ
   149   40 H T    >   -     0   0    9  688   68  SPPAA    TPT PFFRPPPRRRS   FFGAR PSPAAAAA  PAAPPP  GAPPFFPSHRSPAAAPPAM
   150   41 H P  T 3  S+     0   0   80  687   10  HPPPP    PPP PPPTPPPPPPH   PPPSP PPPPPPPP  PPPLPP  PPPPPPPNPPPPPPPPPPP
   151   42 H E  T 3  S-     0   0  151  688   26  VGGGG    GGG RGGGGGGEEGA   GGGGG GSGGGGGG  GGGWGG  GGGEGGGGGGSGGGGGGGG
   152   43 H K    <   +     0   0  121  688   32  KKKKK    KKQ KNNQKKKQQHK   DNKKQ KRKKEKKK  KQKKKK  KKKKDNKKRQRKKKKKKKK
   153   44 H R        -     0   0  113  687   43  SGGAV    GGG TKKGGGGGGGS   KKGGG GGGVAAAA  EGSGGG  GGRGKKGSGGXGAVAGGGG
   154   45 H L  E     -G  148   0C   9  688   14  LLLLP    LLL LLLLLLLLLLL   LLLLL LLLPPLLL  PLRLLL  LLLLLLLLLLLLLPPLLLL
   155   46 H E  E     -G  147   0C  44  687    5  EEEEE    EEE EEEEEEEEEEE   EEREE EEEEEEEE  QEEEEE  EEEEEEEEEEEEEEEEEEE
   156   47 H W  E     +G  146   0C  15  687   11  WWYWW    WWW WWHWWWWWWWW   WWWWW WWWWWWWW  LWFWWW  WWWWWWWWWWWWWWWWWWW
   157   48 H V  E     -     0   0C   0  687   28  IIIVL    MMV ILMILLLIVII   MMMLI ILILLLLV  VMVMIM  VIIIMMIIIILILLVLLIM
   158   49 H A  E     -G  145   0C   0  688   38  GGGGG    GGG GGGGGGGGGGG   GGGAG GGGAGGGG  AGAGGG  AGGGGGGGGGGGSGAGGGG
   159   50 H S  E     -GH 144 168C   0  688   94  RSYDG    CCW VFYEVVVWWEv   YYWTM SREQAGGE  YGSRYC  RIGSFYEnFVRFYGGVVRS
   160   51 H I  E     -GH 143 167C   4  675   18  IIIII    IIV VIIIIIIIIIt   IIIII ITIITIII  IIIIIV  MIILIIIdI.TIIVIIIII
   161   52 H N    >   -     0   0   47  682   84  NFSYS    NWD RKSYWWWDDLY   SKNSD YYNSRHWK  DYSNSN  HYRHRSNPSNYSYSHWWYY
   162   53 H N  T 3  S+     0   0   65  684   88  PYYAG    NYP TYYPAGGPPPY   FYTFP YYDPKTRD  TLSNSN  PANNYYHYNNYHNSNSSGP
   163   54 H G  T 3  S-     0   0   65  686   68  YSRGR    NDS DDSGGDDEEGG   DDEDS SRSRNNDI  VGGNSD  TSDSDDSYNPRLNDSNNSG
   164   55 H G  S <  S+     0   0   30  687   43  NGGGG    GGD GGGSGGGNNSD   GGTGD GSGGGGGG  PNDGGG  DGGGGGGGGGSGGGGGGGD
   165   56 H G  S    S+     0   0   74  688   63  GSSSS    NNG SSSDSSSGGGA   NNGGS NqINDGKT  TGGDSN  sSDSSSSGDskTDSSRRGS
   166   57 H R        +     0   0  163  505   86  V....    ..E ...S...DDN.   ..ESE .f......  .N....  h........gy......SD
   167   58 H T  E     -H  160   0C  62  677   52  ITTKT    TTA TNTTTTTTTT.   INPKT NTTTTGTA  PT.TTL  ITTDNNTTPTNTTTIIITT
   168   59 H Y  E     +H  159   0C  53  686   85  SYNEY    YYN AGYYNNNEEHS   NSAIR YDNYNNNE  YN.YYY  YYKYNGNSFDSKDYGDDDK
   169   60 H Y        -     0   0   44  688    9  YYYYY    YYY IYYNNYYYYHY   YYYYL YYYYYLYY  YYTYYY  YYYYYYYYYYYYYYYYYYY
   170   61 H P    >>  -     0   0   20  688   65  NNNSN    SSA ANNNNHHAANN   NNAAN NANNSNDN  AADSST  SANNNNNNNNANNNNNNNN
   171   62 H D  T 34 S+     0   0  148  688   64  QPPPS    PPQ DPPESSSPPEQ   PPDRQ PVPQPPPP  DQKPPP  NSPPPPPQPEVPAPPAAPP
   172   63 H T  T 34 S+     0   0   90  688   57  NSSAA    SSK SSSKAAAKNKK   SSDSK SSSATAAA  SKSSSS  AWSSSSSKSKSSAAAAASS
   173   64 H V  T X> S+     0   0    1  688   42  FLLLL    LLF LLLFLLLFFFF   LLFVF LVLLLLFL  VFYLLL  VALLLLLFLFVLLLLFFLF
   174   65 H K  B 3< S+c  177   0A 142  687   31  KKKKK    KKQ KKKKMIIQQKK   KKKKK KRKKKKQK  QQAKKK  RKKKKKKKKKKQKKKIIKQ
   175   66 H G  T 34 S+     0   0   74  687   36  DSSPS    SSG NNSGSSSGGGG   NNGGD SSSSSSSS  GGDSSS  GGSSTNSGSGSSSSSSSSG
   176   67 H R  T <4 S+     0   0   36  688   17  KRRRR    RRR RRRKRRRKKKK   RRRRK RRRRRRRR  RRARRR  RRRRRRRKRKRRRRRRRRH
   177   68 H F  E  <  -cD 174 192A   2  688   60  AVVLL    TTV VVIALLLAAAA   IIFFA VIVLLLLL  AVVTTT  FFVVIIVAFAIVLRLLLVV
   178   69 H T  E     - D   0 191A  79  688   38  STTSS    SSS TSSTSSSTSTT   SSAVT TATSSSST  TTKSSS  ITSTSSTTTTTSSSSSSTT
   179   70 H I  E     + D   0 190A   5  688   20  LIMII    III IIILIIIMMFM   IIFVL IIIIIIII  IMIIII  IIIIIIILILIIIIIIIII
   180   71 H S  E     - D   0 189A  51  684   41  TSSTT    SST TTTTSSSTTTT   TTSST SNSTTTTS  STSSSS  SSSSTTSTSTNSTTTTTSS
   181   72 H R  E     - D   0 188A  30  687   60  VVVRR    RRR KRRAKKKASAV   RRLRV VPVRRRRR  RARRRR  RKRVRRVVIAPQRRRKKIA
   182   73 H D  E > > - D   0 187A  60  686    7  DDDDD    DDD DDDDDDDDDDD   DDEDD DDDDDDDE  NDDDDD  DTDDDDDDDDDDDDDDDDD
   183   74 H N  G > 5S+     0   0   48  688   57  KTKTT    TTM NTTKNNNTTTK   TTTNK TTTTTTTT  NTNTTT  NSTTTTTKTKTTTATNNTK
   184   75 H A  G 3 5S+     0   0   99  688   45  SLSSS    SSS GSSSSSSSSSS   SSSTS SSSSSSSS  ASTSSS  TTSSSSSSSSSSSSSSSSS
   185   76 H K  G < 5S-     0   0  111  688   51  SKKKE    KKR KEKSKKKSSSS   KKANS KKKKKKKK  QTNKKK  NTKKKKKSKSKKKKKKKKI
   186   77 H N  T < 5 +     0   0   62  688   46  SNNSS    NNS KNNNSSSNNNS   NNTSS NNNSSSSS  SSSNNN  SVNNNNNSNSNRSSSSSNS
   187   78 H T  E   < -BD 132 182A  16  688   69  TNQQQ    QQT QQQTQQQTTTT   QQTTT QQQQQQQQ  STRQQQ  LDQQQQQTQTQQQQQQQQT
   188   79 H L  E     -BD 131 181A   0  687   56  AFFVL    FFA VFYAVVVAAAA   FFALA FLFVVVVV  LALVFF  LLFFFFLAFAFFVVVVVFT
   189   80 H Y  E     -BD 130 180A  41  687   46  YSSSS    TSY YFYYFFFYYYY   FFYFY SSSSSSSS  HYYSSS  YKSSFFSYTYSSSSSFFSF
   190   81 H L  E     -BD 129 179A   0  687    7  MLLLL    LLM LLLMLLLLLMM   LLLLM LLLLLLLL  LMLMLL  LTLLLLLMLMLLLLLFFLL
   191   82 H Q  E     -BD 128 178A  76  687   41  EKNSS    QQE QKQQKKKRQQE   RKQQQ KQKSSSSS  QEQQQQ  QSQRRKKQRRHKSSSKKKH
   192   83 H M  E     +BD 127 177A   0  688   11  LLLLL    LLL MLLLMLLLLLL   LLIML LLLLLLLL  MLMLLL  MLLLLLLLLLLLLLLMMLW
   193   84 H S        +     0   0   42  688   54  HSTSS    SSS NNNSNNNSSSA   NNNNS SSSNSSSS  QSDSSS  NPSSNNSKYSNTSSSNNSS
   194   85 H S  S    S-     0   0   68  687   24  SSSSS    SSS GSSSSSSSSSR   SSNSS SSSSSSSS  NSSSSS  GTSSSSSSSSSSSSSSSSS
   195   86 H L        -     0   0    3  686   18  LVVVV    VLL MVVLLLLLLLL   VVLLP VVVVVVVV  LLLVVV  LEMVVVVLVLVVVVVLLVL
   196   87 H K    >   -     0   0  102  686   68  TTTTT    TTR ETTTQQQTTTT   TTKRT TTTTTATT  KRRITT  KDTTTTTTTTTTTTTQQTK
   197   88 H S  G >  S+     0   0   70  686   60  SAATA    TSA VTSSTTTSSSS   PTNTS PPATTSTI  LPVTTT  P.TATTASSVPATTADDAA
   198   89 H E  G 3  S+     0   0  126  687   22  EAAED    EEE KEEEDDDKEEE   EEENE AEAEEEDD  EEEEEE  E.EAEEAEADEAEEEDDAS
   199   90 H D  G <   +     0   0    2  687    3  DDDDD    DDD DDDDDDDDDDD   DDDDD DDDDDDDD  DDDDDD  D.DDDDDDDDDDDDDDDDD
   200   91 H T    <   +     0   0   32  688   28  STTTT    TTT TTTSTTTTTSS   TTTTS TTTTTTTA  STITTT  TTTTTTTSTSTTTATTTTT
   201   92 H A  E    S- I   0 223C   8  686    5  AAAAA    AAA AAAAAAAAAAA   AAAAA AAAAAAAA  AAAAAA  AAAAAAAAATAAAAPAAAA
   202   93 H M  E     -FI 148 222C  58  687   48  VVVVV    VVV MTTVMTTVVVI   TTTTV VVLVVVVV  VVWVMM  VTTVTTVVKVVMVVMIIVT
   203   94 H Y  E     -FI 147 221C   0  688    1  YYYYY    YYY YYYYYYYYYYY   YYYYY YYYYYYYY  YYYYYY  YYYYYYYYYYYYYYYYYYY
   204   95 H Y  E     -F  146   0C   7  688    4  YYYYY    FYY YYYFYYYYYYY   FYFYY YYYFYTYY  YYIYYY  YFYYYYYYYCYYYYYYYYY
   205   96 H b  E     -F  145   0C   0  688    1  CCCCC    CCC CCCCCCCCCCC   CCCCC CCCCCCCC  CCCCCC  CCCCCCCCCCCCCCCCCCC
   206   97 H V  E     -FJ 144 217C   0  688   23  ATAAV    AAA TATAAAANNAA   VAAAA AVAVVVTA  CVSAAT  AAAAATAAAVAATAAAAAA
   207   98 H R  E     -FJ 143 216C  21  687   40  rrrrr    rrr sgSsrkkagpr   rrGkr rrrrgrEk  irtrrr  rrRrvRrvrrsrrrrrrrk
   208   99 H H  E     + J   0 214C   6  583   92  tkyfi    gge th.glyytlky   ee.ks dgseasIg  nvhlhw  rh.mmGapkhpdayallyg
   209  100 H E  E  >  + J   0 213C  63  625   78  VRTGG    NKA ALLSSYYSAGN   EE.TS HNGSLGAR  GESTTG  SL.GDDSAADGNNSVTTPY
   210  101 H Y  T >4 S-     0   0   80  658   93  DVRDY    FSS GYRSSDDWWAY   YY.VL TSACVWYY  KNTSHI  CA.AYGYWAYTWGGAWWAY
   211  102 H Y  T 34 S-     0   0  140  672   23  FWYYy    YYY YYFyYyyFFYY   YYyFY FWYwYayy  WWYWFY  FF.FYYyFYYyFLcCFFfy
   212  103 H Y  T 34 S+     0   0   39  265   92  ..G.g    F.. ...g.aa....   YDy.. ...t.dfg  ......  ..A..Hy...y.Gg...ha
   213  104 H A  E <<  -J  209   0C   0  403   87  .NR.W    S.. ...Y.PP...A   AVD.Y ..YGEGEF  A.L..S  S.T.AFY..TS.GS...GS
   214  105 H M  E     +J  208   0C   0  497   62  .MF.I    F.. FF.F.LL..FM   TMG.F .LPIVIII  K.A.FL  VVV.MFM.FVM.VII..LF
   215  106 H D  E     +     0   0C  19  615   50  DDDDD    SP. EDAD.CCAIDD   DDAAD DDYDEDYE  LGP.PM  GDSDDTDADDDGDDDTTDD
   216  107 H Y  E     -J  207   0C  99  624   65  YLYYY    AF. HYYV.YYYYYY   YYYFY YYYYYYSY  FPE.VI  MVLFYYVYSYVPFYYYYSN
   217  108 H W  E     -J  206   0C  23  675    2  WWWWW    RWW WWWWWWWWWWW   WWWWW WWWWWWWW  FWWWWW  YWWWWWWWWWWWWWWWWWW
   218  109 H G        -     0   0    0  664   17  GGGGG    RTG GGGGGGGGGGG   GGGGG GGGGGGGG  GSGG S  GGEGGG GGGGGGGGGGGG
   219  110 H Q        -     0   0   91  659   46  QQQPP    P K QQQAQQQQQQQ   QQQQQ QQQPPPPP  KREQ E  TPGHQQ QQQQQRPPQQQQ
   220  111 H G        -     0   0   16  650   16  GGGGG    S G GGGGGGGGGGG   GGGGG GGGGGGGG  GGS     GGSGGG GGGGGGGGGGGG
   221  112 H T  E     -I  203   0C  21  594   27  TTTLL    S Q TTTTTTTTTTT   ATTTT TTNLLVLL  TTY     .T.TTT TTTTTLLLTTVV
   222  113 H T  E     -I  202   0C  72  593   76  TTLLL    L E MTLTLTTLLSS     LDT LLLLLLLL  QSS     .L.M L LLTTLLLLLLVL
   223  114 H V  E     -I  201   0C   0  596   20  VVVVI    L V VLVVVLLVVLV     VVL VV IVVVV  ICL     .V.V V VVVVVVVVVVVV
   224  115 H T  E     -e  120   0B  36  593   20  TTTTT    S A TTTTTTTTTTT     TST TT TTTTT  TVM     .T.T T TTTTTTTTTTTT
   225  116 H V  E     +e  121   0B   6  572    6  VVVVV    V V VVVVVVVVVVV     VVV VV VVVVV  VII     .V.V V VVVVVVVVVVVV
   226  117 H S        -     0   0   36  566   11  SSSSS    S   TSSSSSSSSSS     SYS SS SSSSS  SSP     .S.S S SSSSSSSSSSSS
   227  118 H S  S    S+     0   0   84  551   22  SSSSS        SSASASSAASS     ASS SS SSSSS  P       . .S A  SSSSSSSAASS
   228  119 H A  S    S+     0   0   70  123   53                                A  GG                . .G      G      AA
   229  120 H W        -     0   0  123   73   63                                S  S                 W WS              S
   230  121 H R        +     0   0  207   60   75                                T  R                   QA              T
   231  122 H H              0   0  156   54   67                                K  S                   SS              K
   232  123 H P              0   0  155   35   53                                G  A                   SA              G
## ALIGNMENTS 1051 - 1120
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....6....:....7....:....8....:....9....:....0....:....1....:....2
     1    1 L D              0   0  183  420   16    DE                           D       D           D  D DD            
     2    2 L I        -     0   0   32  462   11    IK                           I       I           I  V VV            
     3    3 L E        -     0   0  117  463   68  V VL                           V       V           V  L VV            
     4    4 L L  E     -K   25   0D  10  474    7  L ML                           M       M           M  M MM            
     5    5 L T  E     -K   24   0D  64  475    8  T TT                           T       T           T  T TT            
     6    6 L Q  E     -K   23   0D  13  475    0  Q QQ                           Q       Q           Q  Q QQ            
     7    7 L T  E    S+K   22   0D  64  475   34  S TT                           T       A           T  T TT            
     8    8 L P        -     0   0   46  480    9  P PP  P                        P       P           P  P PP            
     9    9 L V  S    S+     0   0   96  484   67  T LG  G                        L       L           L  H LL            
    10   10 L S  E     -n  104   0E  60  485   43  S SA  A                        S       S           S  S SS            
    11   11 L L  E     -n  105   0E  58  489   21  V LQ  V                        L       V           L  L LL            
    12   12 L S  E     +n  106   0E  60  490   42  S PS  S                        P       S           P  S PP            
    13   13 L A  E     -n  107   0E   0  490   58  V VV  S                        V       V           V  V VV            
    14   14 L S    >   -     0   0   47  491   29  S NV  A                        T       T           T  S TT            
    15   15 L V  T 3  S+     0   0   76  491   66  P PQ  V                        L       P           P  P PP            
    16   16 L G  T 3  S+     0   0   42  491    4  G GG  G                        G       G           G  G GG            
    17   17 L E    <   -     0   0   71  491   35  E QQ  D                        E       E           Q  E EE            
    18   18 L T        -     0   0   69  491   62  R LT  T                        P       S           P  P PP            
    19   19 L V  E     - L   0  75D  11  491   37  V AV  V                        A       A           A  A AA            
    20   20 L T  E     - L   0  74D  67  490   30  T SS  T                        T       S           S  T SS            
    21   21 L I  E     - L   0  73D   1  489   17  I II  I                        I       I           I  I II            
    22   22 L T  E     -KL   7  72D  29  489   58  S SR  K                        S       S           S  S SS            
    23   23 L a  E     -KL   6  71D   0  490    1  C CC  C                        C       C           C  C CC            
    24   24 L R  E     -KL   5  70D 110  490   45  Q RK  R                        K       R           K  R RR            
    25   25 L A  E     -K    4   0D  10  490   29  A SA  T                        S       S           S  S AA            
    26   26 L S  S    S+     0   0   66  490    4  S SS  S                        S       S           S  S SS            
    27   27 L E  S    S-     0   0  101  490   38  Q QS  Q                        E       K           Q  Q QQ            
    28   28 L N        +     0   0   83  490   45  S SS  N                        S       S           S  S SS            
    29   29 L I    >   -     0   0    5  491   32  V LV  V                        L       L           L  L LL            
    30   30 L Y  T 3   -     0   0  155  491   81  k lG  y                        v       l           l  l ll            
    31   31 L S  T 3  S+     0   0   53  467   65  d tT  n                        t       t           t  t tt            
    32   32 L Y    <   +     0   0   63  490   52  P YC  Y                        Y       S           Y  Y YY            
    33   33 L L  E     -O   90   0E   0  490    7  L LL  L                        L       L           L  F LL            
    34   34 L A  E     -O   89   0E   0  490   71  S HN  H                        S       Y           Y  N NN            
    35   35 L W  E     -OP  88  48E   1  491    0  W WW  W                        W       W           W  W WW            
    36   36 L Y  E     -OP  87  46E   0  491    9  Y YY  Y                        Y       Y           Y  L YY            
    37   37 L Q  E     -OP  86  45E   7  491   28  Q LL  Q                        Q       L           L  V LL            
    38   38 L Q  E     -O   85   0E  21  491    4  H QQ  Q                        Q       Q           Q  Q QQ            
    39   39 L K    >   -     0   0   51  490    9  K KK  K                        K       R           K  K KK            
    40   40 L Q  T 3  S+     0   0  190  491   19  P PN  D                        P       P           P  P PP            
    41   41 L G  T 3  S+     0   0   86  491   10  G GG  G                        G       G           G  G GG            
    42   42 L K  S <  S-     0   0  126  490   54  Q KE  G                        Q       K           Q  Q QQ            
    43   43 L S        -     0   0   21  490   55  A SS  V                        P       S           S  V SS            
    44   44 L P        -     0   0    4  490   11  P PP  P                        P       P           P  P PP            
    45   45 L Q  E     -P   37   0E  74  490   32  R QK  K                        R       Q           Q  S RR            
    46   46 L F  E     +P   36   0E  25  490   42  L LL  L                        L       L           L  L RR            
    47   47 L L  E     +     0   0E   4  490    9  L LL  L                        L       L           L  I LL            
    48   48 L V  E     -PQ  35  54E   0  491    5  I II  I                        I       I           I  I II            
    49   49 L Y  E >> S+ Q   0  53E  39  491   17  S YY  Y                        Y       Y           Y  Y YY            
    50   50 L N  T 34 S-     0   0   52  491   91  W RS  L                        E       R           E  E KK            
    51   51 L A  T 34 S+     0   0    3  491   45  A VA  A                        V       M           V  V VV            
    52   52 L K  T <4 S+     0   0  148  491   25  T ST  S                        S       S           S  S SS            
    53   53 L T  E  <  -Q   49   0E  47  491   67  N SN  N                        N       N           N  K NN            
    54   54 L L  E     -Q   48   0E  60  491   60  L HR  R                        R       L           R  R RR            
    55   55 L G    >   -     0   0    9  490   71  A FQ  A                        L       A           A  D DD            
    56   56 L E  T 3  S+     0   0  192  490   35  S SS  S                        S       S           S  S SS            
    57   57 L G  T 3  S+     0   0   70  491    5  G GG  G                        G       G           G  W GG            
    58   58 L V    <   -     0   0   25  489   11  V VV  I                        V       V           V  V VV            
    59   59 L P    >   -     0   0   47  490    7  P PS  P                        P       P           P  S PP            
    60   60 L S  T 3  S+     0   0  115  491   57  A DS  A                        D       D           D  D DD            
    61   61 L R  T 3  S+     0   0   44  491    4  R RH  R                        R       R           R  R RR            
    62   62 L F  E <   +M   75   0D   5  491    1  F FF  F                        F       F           F  F FF            
    63   63 L S  E     -M   74   0D  55  490   22  S SS  T                        V       S           S  S SS            
    64   64 L G  E     +M   73   0D  13  491    2  G GG  G                        G       G           G  G GG            
    65   65 L S  E     +M   72   0D  63  491    5  S SS  S                        S       S           S  S SS            
    66   66 L G  E     -M   71   0D  36  491   14  R GG  G                        G       G           G  G GG            
    67   67 L S  E >   +M   70   0D  79  491    9  S SS  S                        S       S           S  S SS            
    68   68 L G  T 3  S-     0   0   16  491   13  G GG  N                        G       E           G  W GG            
    69   69 L T  T 3  S+     0   0   67  488   13  T ST  S                        T       T           T  T TT            
    70   70 L Q  E <   +LM  24  67D 110  489   27  D DD  D                        D       D           D  D DD            
    71   71 L F  E     -LM  23  66D   2  491    6  F FF  F                        F       F           F  F FF            
    72   72 L S  E     -LM  22  65D  26  491   30  T TT  T                        T       T           T  T TT            
    73   73 L L  E     -LM  21  64D   0  491    2  L LL  L                        L       L           L  L LL            
    74   74 L K  E     -LM  20  63D  97  491   39  S KT  T                        K       K           K  K RR            
    75   75 L I  E     -LM  19  62D   0  491    1  I IL  I                        I       I           I  I II            
    76   76 L N  S    S-     0   0   86  491   30  S SS  S                        S       S           S  S SS            
    77   77 L S  S    S-     0   0   58  491   62  S WG  G                        R       K           R  R RR            
    78   78 L L        -     0   0    0  491   27  M VI  V                        V       V           V  V VV            
    79   79 L L    >   -     0   0   67  491   31  K EE  Q                        E       E           E  E EE            
    80   80 L P  G >  S+     0   0   92  491   58  P AP  A                        A       T           A  A AA            
    81   81 L E  G 3  S+     0   0  102  491   13  E EE  E                        D       E           E  E DD            
    82   82 L D  G <  S+     0   0    1  491    5  D DH  D                        D       D           D  D DD            
    83   83 L F    <   +     0   0   29  490   72  A VA  A                        V       V           V  A VV            
    84   84 L G  E    S- R   0 105E  17  491   23  A GG  A                        A       G           R  G GG            
    85   85 L S  E     -OR  38 104E  24  491   63  V VV  V                        V       V           V  V VV            
    86   86 L Y  E     -OR  37 103E   0  491    0  Y YY  Y                        Y       Y           Y  Y YY            
    87   87 L Y  E     -O   36   0E   5  490    4  Y YY  Y                        Y       Y           Y  Y YY            
    88   88 L a  E     -O   35   0E   0  491    0  C CC  C                        C       C           C  C CC            
    89   89 L Q  E     -OS  34  99E   0  489   48  Q MQ  Q                        M       G           M  Q LQ            
    90   90 L H  E     -O   33   0E  22  483   26  Q QQ  S                        Q       H           Q  Q QQ            
    91   91 L H        +     0   0    0  421   89  G AC  Y                        D       R           G  G GG            
    92   92 L Y  S    S+     0   0  104  454   88  Y TN  H                        T       S           I  T TT            
    93   93 L G  S    S-     0   0   34  422   71  K QS  Y                        K       R           Q  H KH            
    94   94 L T  S    S-     0   0  104  446   88  E FL  P                        V       I           L  V YA            
    95   95 L P  S    S+     0   0    7  443   51  P PP  K                        P       S           P  P PP            
    96   96 L P  S    S-     0   0   55  421   75  P NF  N                        P       s           P  P TR            
    97   97 L L        -     0   0   21  160   88    ..  Q                        .       t           .  . ..            
    98   98 L T        -     0   0   40  288   41    ..  D                        .       A           .  . ..            
    99   99 L F  B     -S   89   0E  18  290   29    ..  V                        .       L           .  . ..            
   100  100 L G        -     0   0    3  294   39    .T  F                        .       N           .  . ..            
   101  101 L G        -     0   0   52  307   63    .H  T                        .       K           .  . ..            
   102  102 L G        -     0   0   11  306   43    .Q  Q                        .       N           .  . ..            
   103  103 L T  E     - R   0  86E   0  366   18    TT  T                        T       T           T  T TT            
   104  104 L K  E     -nR  10  85E  98  363   58    VK  K                        V       M           V  V VV            
   105  105 L L  E     -nR  11  84E   4  343   37    VL  I                        V       L           V  L VV            
   106  106 L E  E     -n   12   0E 108  326   51    QK  S                        Q       E           Q  Q QQ            
   107  107 L I  E      n   13   0E 113  301   50     L  I                                V           T  P PP            
   108  108 L K              0   0  145  268   18     N  R                                            N  R RR            
   109      ! !              0   0    0   0     0  
   110    1 H E              0   0  194  408   30   Q        QEQQ     QQQQQQEQQQQD QQ      DQQE Q  QQQ QQ Q           QQQ
   111    2 H V        +     0   0   19  465   12   V        VIIV     VVVVVVVVVVVV VV      VVVV V  VVV VV V           VVI
   112    3 H K  E     -A  134   0A 111  467   31   Q        QQTQ     KKQRQRQQQQQQ QT      HQHQ K  QQQ QQ Q           QRT
   113    4 H L  E     -A  133   0A   3  489    1   L        LLLL MM  LLLLLLLLLLLL LL L    LLLL LLLLLL LL L           LLL
   114    5 H Q  E     -A  132   0A  83  493   70   R        QQKQ LL  LLQQQQVQQVQQ VT V    QQQQ LVQQQR KK M           QQE
   115    6 H E  E     +A  131   0A   5  498   21   E  EE    QQEQ EE  EEEEEEQEEQEE QEEE    EQQE EEEEEE EE Q           EGE
   116    7 H S  E     +A  130   0A  69  501   13   S  SS    SSSS SS  SSSSSSSSSSSS SSSF    SSSS SSSSSS SS S           SSS
   117    8 H G        +     0   0   36  505    4   G  EE    GGGG GG  GGGGGGGGGGGG GGEG    GGGG GGGGGG GG G           GGG
   118    9 H G        +     0   0   29  672   48   P  GG PPATTPP PPPPPPPPPPAPPAPP APGGPPP PPPPPPGPPPP PP A  P PPPPPPPPPP
   119   10 H D        -     0   0   96  677   40   S  GG EEEVETQ GGGGGGSSSSEGGEGG EAGASGG GGEGGGAGGGS GG E  GGGGGGGGGSSG
   120   11 H L  E     +e  224   0B  79  675   16   L  LL LLLLLLL LLLLLLLLLLVLLVLL VLLELLL LLLILLVTLLL VV V  LLLLLLLLLLLI
   121   12 H V  E     -e  225   0B  16  677   33   V  FF EVVAVVV VVVVVVVVVVKVVRVV KVFKVVV VVVLVVKVVVV VV K  VVVVVVVVVVVL
   122   13 H Q    >   -     0   0  114  679   51   K  KK KKKRKKRRKKEKKKKKKKRKKKKK KKKKKKK KKKKEKLRKKK KK K  KKKKKKKKKKKQ
   123   14 H P  T 3  S+     0   0   66  678    9   P  PP PPPPPPPPPPXPPPPPPPPPPPPP PPPAPPP PPPPPPAPPPP PP P  PPPPPPPPPPPP
   124   15 H G  T 3  S+     0   0   58  682   32   S  TT GGGGGTGGSSSSSSSSSSGSSGSS GKMGSSS SSGSSSGSSSS SS G  SSSSSSSSSSSS
   125   16 H G    <   -     0   0   25  684   63   Q  DD AAATAQTAEQQQEEQQQQEEQAQK SQDDQQQ QQPQQEEEQQQ QQ S  QQQQQQQQQQQQ
   126   17 H S        +     0   0   78  683   31   T  TT SSSSSTSSTTTTTTTTTTSTTSTT SPTSTST STSTTTSSTTT TT S  TTTTTTTTTTTT
   127   18 H L  E     - B   0 192A  25  685   25   L  LL VVVVVLVVLVLLLLLLLLLLLVLL VLLLLLV LLVLLLLLLLL LL V  LLLLLLLLLLLL
   128   19 H K  E     - B   0 191A  93  683   56   S  TT KKKKKTKKSSSSSSSSSSKSSKSS KTTRSSS SSKSSSFRSSS SS R  SSSSXSSXSSSS
   129   20 H L  E     - B   0 190A   0  688   14   L  LL IILMILILLLLLLLLLLLILLVLL VLLLLLL LLMLLLLLLLL LL V  LLLLLLLLLLLL
   130   21 H S  E     -AB 116 189A  28  688   37   T  TT SSSSSTSSTSTTNNTTTTSTTSTT STTFTTT TTSTTTSTTTT TT S  TTTTTTTTTTTT
   131   22 H b  E     -AB 115 188A   0  688    0   C  CC CCCCCCCCCCCCCCCCCCCCCCCC CCCCCCC CCCCCCCCCCC CC C  CCCCCCCCCCCC
   132   23 H A  E     -AB 114 187A  52  688   66   T  TT KKKKKTKKTTAATTTTTTKSSKST KTTKSST SAKSATTTATT AA K  AAAAAAAAATSS
   133   24 H A  E     +A  113   0A   8  688   49   V  VV AAATAFAAVVIIVVVVVVTVVAVV AFVAVVV VIAFIVAVVVV VF T  IIIIIIIIIVVF
   134   25 H S  E     +A  112   0A  58  688   12   S  SS SSSSSSSSSSSSSSSSSSSSSSSS SSSSTTT TSSSSSSSSSS SS S  SSSSSSSSSSSS
   135   26 H G  S    S+     0   0   56  688    4   G  GG GGGDGgGGggggggGGGGGGgGgg GgGGGgg ggGggGGGgGG GG G  gggggggggRGg
   136   27 H F  S    S-     0   0   33  686   34   F  FF YYYYYlYYvivviiFFFFYFiYii GlFFDii svYlvAFFiFF FF G  vvvvvvvvvFLl
   137   28 H T    >   -     0   0   93  687   50   S  SS SSTTSTSTSNSSTTSSSSSSTTTT TSSNSTT ISTSSSNETSS SS T  SSSSSSSSSSSS
   138   29 H F  G >  S+     0   0    2  688   41   L  LL FFFFFTFFSTSSNNLLLLFLTFTT FTLFIMT TSFTSIFLTLL LL F  SNTSSSSSSLLS
   139   30 H S  G 3  S+     0   0   57  688   55   S  SS TTTTTSTTTANSGGATSTTTSTGS SSSGTNG RNTSSRGTSTS TT V  NNNNSNNNNTTS
   140   31 H S  G <  S+     0   0   71  688   60   S  SG GGENGGSSNNSSGGSSSVSSGSYG RRSSSYN GSDGTSDSGSS SS D  SGSSTSSSSSNG
   141   32 H Y  S <  S-     0   0   44  688   41   N  YY YYYCYMYYYYAAYYNNDNYYYYYC SMYSGYY YAYMAYYYYYN SY Y  AAAAAAGAANHM
   142   33 H T        -     0   0   30  688   91   G  TD NYIWNDWGYYAGYYDAAAWGYYWC ARGGYWR NAVGAYEHAPG AV K  ATAAAAAAAVGS
   143   34 H M  E     -FG 207 160C   0  672   46   V  VM MMIIMVMIWWWWWWIVVVIVWM.W IVVMW.W WWVVWWMMWVV VV G  WWWWWWWWWVVV
   144   35 H S  E     -FG 206 159C   0  685   73   G  AS NHHHNGHTSSSNAATHNGSNSHST ISNSNNS NNSGNTGHDHV GS L  NNNNNNNNNGGG
   145   36 H W  E     +FG 205 158C   0  688    0   W  WW WWWWWWWWWWWWWWWWWWWWWWWW WWWWWWW WWWWWWWWWWW WW W  WWWWWWWWWWWW
   146   37 H V  E     -FG 204 156C   0  688   19   V  VV VVVIVIVVIIIVFFVVVVVNIVII VIVMIII IIMIILYIIMV VV V  IIIIIIIIIVVI
   147   38 H R  E     -FG 203 155C  10  688   17   R  RR KKKKKRKKRRRRRRRRRRRRRRRR RRRRRRR RRQRRRRRRRR RR R  RRRRRRRRRRRR
   148   39 H Q  E     -FG 202 154C   9  688    3   Q  QQ QQQQQQQQQQQQQQQQQQQQQQQQ QRQQKQQ RQQQQQKQQQQ QQ Q  QQQQQQQQQQQQ
   149   40 H T    >   -     0   0    9  688   68   A  AA SSRRSPRRHHSSPPAAAAMAPAPP APAAFFF FSRPSTAPPAA AA A  SSSSSSSSSPAP
   150   41 H P  T 3  S+     0   0   80  687   10   P  PP NHSPHPPTPPPPPPPPPPPPPPPP PPPPPPP PPTSPPSPPPP PP P  PPPPPPPPPPPS
   151   42 H E  T 3  S-     0   0  151  688   26   G  GG GVGGGGGGGGSSGGGGGGGGGGGG GGGGGGG GSGGSGGGGGG GG G  SSSSSSSSSGGG
   152   43 H K    <   +     0   0  121  688   32   K  ZK KKQQKKQQRRRRKKRKKKKKKQKK QKKKNNN NRQKRKRKKKK KK K  RRRRRGRRRKKK
   153   44 H R        -     0   0  113  687   43   A  GG SSGGSADGGGGGGGAVAVGGGGGG GAGGKKK KGVGGGGGGGA GG G  GGGGGGGGDAAG
   154   45 H L  E     -G  148   0C   9  688   14   L  LL LLLLLLLLLLLLLLLPLPLLLLLL LLLLLLL LLLLLLPLLLL LL L  LLLLLLLLLLLL
   155   46 H E  E     -G  147   0C  44  687    5   E  EE EEEEEEEEEEEEEEEEEEEEEEEE EEEEEEE EEEEEEEEEEE EE E  EEEEEEEEEEEE
   156   47 H W  E     +G  146   0C  15  687   11   W  WW WWWWWWWWWWWWWWWWWWWWWWWW WWWWYWW WWWWWWWWWWW WW W  WWWWWWWWWWWW
   157   48 H V  E     -     0   0C   0  687   28   V  II IIIIVLIIIILLIIILVLMVMVIM MLIVMMI MLILLIVIMVL VV V  LLLLLLLLLLLL
   158   49 H A  E     -G  145   0C   0  688   38   G  GG GGGGGAGGGGGGGGTGGGGGGGGG GAGAGGG GGGAGGSGGGG GG G  GGGGGGGGGGGA
   159   50 H S  E     -GH 144 168C   0  688   94   G  IV NRWAdLMEFFRRSSCGQSTVRTYC gRYHYSY YREHRFHVIVG AA q  RRRRRRRRRICH
   160   51 H I  E     -GH 143 167C   4  675   18   I  LI IIFIpIIIIITTIILIIIIMIFII vI.LIII ITIITVIAIVI II l  TXTTTTTTTFLI
   161   52 H N    >   -     0   0   47  682   84   D  KY DNYSYYDYSSYYHHAADSDWSHSG PB.YNSY NYYWYYDYYWC AA R  YYYYYYYYYNYW
   162   53 H N  T 3  S+     0   0   65  684   88   N  SA PPPLYWPPNNYYHHRTNTPDSPSY MB.WYYY YYPWYDPANGS GG F  YYYYYYYYYSNW
   163   54 H G  T 3  S-     0   0   65  686   68   D  SS YYGGGDSRNNRRTTDGGDSGGLSD FBIDSDS DRGDRGTGDGG SS N  RRRRRRRRRDDN
   164   55 H G  S <  S+     0   0   30  687   43   G  GG YNSNGDDSGGSSGGGGGGDGGHGG GDGRGGG GSSDSGGGGGG GG G  SSSSSSSSSGGD
   165   56 H G  S    S+     0   0   74  688   63   D  SS GGGSTDSGDDkrPPRSISSSSESN PKTwSST SkGDkRRGSSS GG E  ktkkkkkkkNDD
   166   57 H R        +     0   0  163  505   86   .  .. GASG..EN..yy......D..I.. ..Gr... .yS.l.N.... SS .  yyyyyyyyy...
   167   58 H T  E     -H  160   0C  62  677   52   T  TT TTIA.KVTPPNNTTTTTTTTTTTI PFTATNI NNAKNTLATIT TT .  INDNNHHNNITK
   168   59 H Y  E     +H  159   0C  53  686   85   Y  YY SSKWRRKYFFDDYYWFNSRDYNYY NYYSYNT NDYYDKQDYYS YY V  DDDDDEDDDFGY
   169   60 H Y        -     0   0   44  688    9   Y  YY YYYYYYLYYYYYEEYYYYYYYYYY YWLYYYY YYYYYYYIYYF YY K  YYYYYYYYYLYY
   170   61 H P    >>  -     0   0   20  688   65   N  AA NNNNSSNNNNAANNNKNNSNSAST ASAANNN NRNNANAASNN NN N  AAAAAAAAANNN
   171   62 H D  T 34 S+     0   0  148  688   64   P  ST QQEQQPQEPPVVPPPPAPPPPQPP QTNDPPP PVEPTPEDPPP PP P  VVVVVVPVVSPP
   172   63 H T  T 34 S+     0   0   90  688   57   A  WW KNKKKSRKSSSSPPAAAASTSKSS KSWRSSS SSKSFSASSTA AA G  SSSSSSFSSAAA
   173   64 H V  T X> S+     0   0    1  688   42   L  AA FFFFFLLFLLMVLLLLLLFLLFLL FLAVLLL LVFLVLVLLLL LL S  VVVVVVVVVLLL
   174   65 H K  B 3< S+c  177   0A 142  687   31   K  KK KKKKKKKKKKKKKKKMKKQKKQKK QRKKKKT KKKKKRRKKKK KK V  KRKKKKKKKKKK
   175   66 H G  T 34 S+     0   0   74  687   36   S  SS GDDDDSDGSSSSSSSSSSGSSGSS GTSGSNS NSGSSSGNSSS SS V  SSSSSSSSSSSS
   176   67 H R  T <4 S+     0   0   36  688   17   R  RR KKKKKRKKRRRRRRRRRRQRRRRR RRRRRRR RRKQRRRRRRR RR R  RRRRRRRRRRRR
   177   68 H F  E  <  -cD 174 192A   2  688   60   L  SS AAAAALAAFFIIVVLLLLVLTVTT VLSFIIT IIALIVFVTLL LL V  IIIIIIVIILLL
   178   69 H T  E     - D   0 191A  79  688   38   S  TT TSTKTTIRTTTTTTSSSSTSSSSS TSTTSST STITTSTTSSS SS S  TTTTITTTTSST
   179   70 H I  E     + D   0 190A   5  688   20   I  II LLLLLILLIIIIMMIIIIIIIIII IIITIII VILIIIIIIII II V  IIIIIIIIIVIV
   180   71 H S  E     - D   0 189A  51  684   41   T  T. TTTTTTTTSSNNSSTTTTSTSTSS TSTSTTT TNTSNSSTSTT TT S  NNNNXYNXNITS
   181   72 H R  E     - D   0 188A  30  687   60   K  R. VVAAVKVAIIPPVIRRRRARRERR AKSRRRR RPAKPLRKRRK RK L  SPPPPPPPPRRK
   182   73 H D  E > > - D   0 187A  60  686    7   D  T. DDDVDDDDDDDDDDDDDDDDDDDD DNNEDDD DDDDDDDDDDD DD K  DDDDDDDDDDDD
   183   74 H N  G > 5S+     0   0   48  688   57   N  QT KKKTKTKKTTTTTTTSTTKTTTTT EDTPTTT TTKTTTNNTTN TT P  TTTTTITTTITS
   184   75 H A  G 3 5S+     0   0   99  688   45   S  NR SSSSSSSSSSSSSSSSSSSSSYSS SSNSSSS SSSSSVTGSSS SS S  SSSSSPSSSASS
   185   76 H K  G < 5S-     0   0  111  688   51   K  TT SSSTSKSSKKKKKKKKKKIKKAKK TKEEKKK KKSRKKKKKKK KK F  KKKKKKKKKEKD
   186   77 H N  T < 5 +     0   0   62  688   46   S  VS SSSNRNNSNNNNNNSSSSNSNSNN NNNSNNN NNSNNKDKNSS SS N  NNNNNNNNNSSN
   187   78 H T  E   < -BD 132 182A  16  688   69   Q  NB TTTTTQTTQQQQQQQQQQTQQTQQ TQTLQQQ QQTQQQQQQQQ QQ Q  QQQQQQQQQQQQ
   188   79 H L  E     -BD 131 181A   0  687   56   V  LT AAVAAVAAFFFFVVVVVVAVFAFF AVVLYFF FFAVFVLVFVV VV A  FFFFFFFFFLVV
   189   80 H Y  E     -BD 130 180A  41  687   46   S  MV YYYYYDYYTTSSSSSSSSYYSYSS YVTYYFF FSYFSSYYSYS YY H  SSSSSSTSSSSF
   190   81 H L  E     -BD 129 179A   0  687    7   L  BB MMMMMLMMLLLLLLLLLLLLLMLL MLLLLLL LLMLLLLLLLL LL M  LLLLLLMLLLLL
   191   82 H Q  E     -BD 128 178A  76  687   41   S  SL QEEEQTQERRQHRRSSSSQTQEQQ EIKPQKE KQEKQNVQQTS QQ E  QQQQQQQQQSSK
   192   83 H M  E     +BD 127 177A   0  688   11   V  LM LLLVLMFLLLLLLLLLLLWLLLLL LMMMLLM MLFILLLMLLV LL L  LLLLLLLLLLLI
   193   84 H S        +     0   0   42  688   54   S  TD KHSSNTSRYYNNRRRSSSSNSSSS SITTNNN NNSTSGDNSNS TT S  NNNNNNQNNSSA
   194   85 H S  S    S-     0   0   68  687   24   S  AS SSRSSFGSSSSSSSSSSSSSSSSS SNSGSSS SSSSSSNGSSS SS S  SSSSSSSSSSSS
   195   86 H L        -     0   0    3  686   18   V  .L LLLLLMPLVVVVVVVVVVLLMLVV LVLLVVL VVLVVVLMVLV VV L  VVVVVVVVVVVV
   196   87 H K    >   -     0   0  102  686   68   T  .T TTTTTDTTTTTTTTTTTTKRTRTT RNTETTT TTTDTTQETRT NN F  TITTTTTTTSTV
   197   88 H S  G >  S+     0   0   70  686   60   P  .A SSSNSPSSSSPPAATSTTATTATT SPGPTTA TPSTPSAVTAP PP S  PPPPPPPPPATT
   198   89 H E  G 3  S+     0   0  126  687   22   E  ZQ EEGEEWEEAAEEKAEDEESEEEEE EVAEEEE EEEAEAGKQEE EE E  EEDEEEEEEEEA
   199   90 H D  G <   +     0   0    2  687    3   D  DD DDDDDDDDDDDDDDDDDDDDDDDD DDDDDDD DDDDDDDDDDD DD D  DDDDDDDDDDDD
   200   91 H T    <   +     0   0   32  688   28   T  TT SSSSSTSSTTTTAATTTTSTTTTT TTTTTTT TTSTTASTTTT TT T  TTTTTTATTTTT
   201   92 H A  E    S- I   0 223C   8  686    5   A  AA AAAAAAAAAAAAAAAAAAAAAAAA AAAGAAA AAAAAGGAAAA AA A  AAAAAAAAAAAA
   202   93 H M  E     -FI 148 222C  58  687   48   T  TT VVVVVTVVKKVLVVVVVVTMVVML FTTRTTT TVVTVVRMVVT VV V  VVVVVVVVVVLT
   203   94 H Y  E     -FI 147 221C   0  688    1   Y  YY YYYYYYYYYYYYYYYYYYYYYYYY YYYYYYY YYFYYYYYYYY YY Y  YYYYYYYYYYYY
   204   95 H Y  E     -F  146   0C   7  688    4   Y  FF YYFYYYYFYYYYYYYYWYYFYYYY FYFHYYY YYFYYYYYYYY YY Y  FYYYYYFFYYYY
   205   96 H b  E     -F  145   0C   0  688    1   C  CC CCCCCCCCCCCCCCCCSCCYCCCC CCCCCCC CCCCCCCCCCC CC C  CCCCCCCCCCCY
   206   97 H V  E     -FJ 144 217C   0  688   23   A  AA AAATAATAAAAVAAGAAAAAAAAV AAGAAAA AAAAAAVAAAA AA A  AAAAAAAAAAAA
   207   98 H R  E     -FJ 143 216C  21  687   40   k  rr rtrRrhrrrrsrrrrrtrkrrrrr grsrrrr rrrrRrRrrrr kk r  rrrkRTrSrstR
   208   99 H H  E     + J   0 214C   6  583   92   t  tg iywEedvskkrlvvgvgggvg.r. yanetli elsk.sLyggt if s  mgv.D...livI
   209  100 H E  E  >  + J   0 213C  63  625   78   G  HL PDDDGGSHAAGGSSRNHDYAG.T. GGEADRL DGLG.PTISPG TR D  GGR.LG.GSYLP
   210  101 H Y  T >4 S-     0   0   80  658   93   K  GS WLYYCYWWAAYACCSVANHLA.P. IYFGAHR YQGADYKFLSK TN Y  GSL.SN.NADGG
   211  102 H Y  T 34 S-     0   0  140  672   23   Y  yy FFFyFYFYYYYYyywWYIyLV.L. YyFCMYY YFFMlYlYyCY Yy Y  FYF.FY.YFYYF
   212  103 H Y  T 34 S+     0   0   39  265   92   .  gs ...q......Y.nns...gL.s.v .y.G... ....l.p.h.. .g .  ...v..r..W..
   213  104 H A  E <<  -J  209   0C   0  403   87   .  LS ...G......GCWWDD..GA.E.R SY.G... A...V.CSR.. .L .  .S.ERYGF.S.G
   214  105 H M  E     +J  208   0C   0  497   62   .  MV .F.F.F.FFFMFLLII..LD.D.G PMNP.FF M...VFLWF.. .V Y  .F.MFFMF.IIF
   215  106 H D  E     +     0   0C  19  615   50   .  DD ADDPADADDDDHDDDE.DED.DTT EDAADDD DDADEHSTH.. .P Y  DHDADDDDDHDD
   216  107 H Y  E     -J  207   0C  99  624   65   .  VV YYYYYYYVSSVYPPYT.YSM.MIL EVIVYYV YYHYYHHFK.. .L Y  YYYVFSVSIYYY
   217  108 H W  E     -J  206   0C  23  675    2   R  WW WWWWWWWWWWWWWWWWWWWWWWWW YWWWWWW WWWWWWWWWWR WW W  WWWWWWWWWWWW
   218  109 H G        -     0   0    0  664   17   G  GG GGGGGGGGGGGGGGGGSGGANAQA NGGGGGG GGGGGGGSDAG  G G  GGGGGGGGGGGG
   219  110 H Q        -     0   0   91  659   46   P  PP QQQQQQQTQQQQQQPPPPQVPVVL GKPPQQA QQQQQQQFPQP  P Q  QQQQQRQQQPPQ
   220  111 H G        -     0   0   16  650   16   Q  GG GGGGGGGGGGGGGGGGGGGmKmPN GGGNGGG GGGGGGEENGQ  A G  GGGGGGGGGGGG
   221  112 H T  E     -I  203   0C  21  594   27   V  TT TTTTTTTTAATTTTLLLLVtDt.A .TTRTTT TTTTTT...FV  . T  TTATTTTTTLLT
   222  113 H T  E     -I  202   0C  72  593   76   D  LL LTTTLLLTLLTLLLLLLLVLML.P LTLVSPT  LLSLP...PD  C L  LLLLMLTLMLLT
   223  114 H V  E     -I  201   0C   0  596   20   L  VV VLLVVVVVVVVVVVVVVVVLVLLV VVVVVLV  VVVVV.F.LL  I V  AVVVVVVVVVVL
   224  115 H T  E     -e  120   0B  36  593   20   S  TT TTTTTTTTTTTTLITTTTTT TLS TTTITTT  TSTTS.TDKS  V T  TTTTTTTTTTTT
   225  116 H V  E     +e  121   0B   6  572    6   V  VV VVVVVVVVVVVVVVIVVVV   VV VVVVVVV  VVVVV.VLLV  I V  VVVVVVVVVIAV
   226  117 H S        -     0   0   36  566   11   G  SS SSSSSSSSSSSSSSSSSSS   EA SSSESSS  SASSS. CSG  Q S  SSSSSSSSSSSS
   227  118 H S  S    S+     0   0   84  551   22   S     ASSSASASSSSSSSSSSSS   SS SSSNSSS  SASSS. NAS  G S  SSSSSSSSSSSS
   228  119 H A  S    S+     0   0   70  123   53                A  GG      A   AA             G G      N G  GGGGGGGGG   
   229  120 H W        -     0   0  123   73   63                K          S    S               K                       
   230  121 H R        +     0   0  207   60   75                T          T    P               E                       
   231  122 H H              0   0  156   54   67                T          K                    T                       
   232  123 H P              0   0  155   35   53                P          G                                            
## ALIGNMENTS 1121 - 1177
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....3....:....4....:....5....:....6....:....7....:....8....:....9
     1    1 L D              0   0  183  420   16                     D                                     
     2    2 L I        -     0   0   32  462   11                     V                                     
     3    3 L E        -     0   0  117  463   68                     V                                     
     4    4 L L  E     -K   25   0D  10  474    7                     M                                    L
     5    5 L T  E     -K   24   0D  64  475    8                     T                                    N
     6    6 L Q  E     -K   23   0D  13  475    0                     Q                                    Q
     7    7 L T  E    S+K   22   0D  64  475   34                     T                                    T
     8    8 L P        -     0   0   46  480    9              P      P         P      P     P             P
     9    9 L V  S    S+     0   0   96  484   67              G      P         H      S     H             I
    10   10 L S  E     -n  104   0E  60  485   43              A      S         S      S     S             S
    11   11 L L  E     -n  105   0E  58  489   21              V      L         V      V     V     V       D
    12   12 L S  E     +n  106   0E  60  490   42              S      S         S   S  S     S     S       P
    13   13 L A  E     -n  107   0E   0  490   58              S      V         E   A  G     E     G       V
    14   14 L S    >   -     0   0   47  491   29              A      A         S   S  S     S     S       S
    15   15 L V  T 3  S+     0   0   76  491   66              V      I         P   L  P     P     P       A
    16   16 L G  T 3  S+     0   0   42  491    4              G      G         G   G  G     G     G       G
    17   17 L E    <   -     0   0   71  491   35              G      Q         K   A  E     K     Q       E
    18   18 L T        -     0   0   69  491   62              S      S         T   S  R     T     K       T
    19   19 L V  E     - L   0  75D  11  491   37              V      V         I   V  V     V     V       S
    20   20 L T  E     - L   0  74D  67  490   30              N      S         T   K  T     T     T       E
    21   21 L I  E     - L   0  73D   1  489   17              I      I         I   L  I     I     I       L
    22   22 L T  E     -KL   7  72D  29  489   58              K      S         S   T  S     S     S       K
    23   23 L a  E     -KL   6  71D   0  490    1              C      C         C   C  C     C     C       C
    24   24 L R  E     -KL   5  70D 110  490   45              R      K         T   T  T     T     T       A
    25   25 L A  E     -K    4   0D  10  490   29              T      S         R   L  G     R     R       M
    26   26 L S  S    S+     0   0   66  490    4              S      S         S   S  S     S     S       Q
    27   27 L E  S    S-     0   0  101  490   38              Q      Q         S   S  S     S     S       N
    28   28 L N        +     0   0   83  490   45              D      S         G   G  S     D     G       G
    29   29 L I    >   -     0   0    5  491   32              V      L         S   H  N     S     N       K
    30   30 L Y  T 3   -     0   0  155  491   81              y      v         i   s  i     i     i       m
    31   31 L S  T 3  S+     0   0   53  467   65              n      t         n   y  y     n     y       y
    32   32 L Y    <   +     0   0   63  490   52              C      Y         Y   A  H     Y     Y       Y
    33   33 L L  E     -O   90   0E   0  490    7              L      L         V   I  V     V     V       M
    34   34 L A  E     -O   89   0E   0  490   71              A      H         Q   A  S     Q     H       S
    35   35 L W  E     -OP  88  48E   1  491    0              W      W         W   W  W     W     W       W
    36   36 L Y  E     -OP  87  46E   0  491    9              Y      L         Y   H  H     Y     Y       Y
    37   37 L Q  E     -OP  86  45E   7  491   28              Q      L         Q   Q  Q     Q     Q       R
    38   38 L Q  E     -O   85   0E  21  491    4              Q      Q         Q   Q  Q     R     Q       Q
    39   39 L K    >   -     0   0   51  490    9              K      S         R   Q  L     R     Q       R
    40   40 L Q  T 3  S+     0   0  190  491   19              D      P         P   P  P     P     P       P
    41   41 L G  T 3  S+     0   0   86  491   10              G      G         G   E  G     G     G       G
    42   42 L K  S <  S-     0   0  126  490   54              G      R         S   K  K     S     R       E
    43   43 L S        -     0   0   21  490   55              V      S         A   G  A     A     A       A
    44   44 L P        -     0   0    4  490   11              P      P         P   p  P     P     P       P
    45   45 L Q  E     -P   37   0E  74  490   32              K      K         T   l  K     T     T       .
    46   46 L F  E     +P   36   0E  25  490   42              R      R         T   M  P     T     T       .
    47   47 L L  E     +     0   0E   4  490    9              L      L         V   K  L     V     V       .
    48   48 L V  E     -PQ  35  54E   0  491    5              I      I         I   L  I     I     I       V
    49   49 L Y  E >> S+ Q   0  53E  39  491   17              Y      Y         Y   N  Y     F     Y       W
    50   50 L N  T 34 S-     0   0   52  491   91              W      Q         E   S  E     A     N       V
    51   51 L A  T 34 S+     0   0    3  491   45              S      V         D   D  S     D     D       L
    52   52 L K  T <4 S+     0   0  148  491   25              S      S         N   G  S     D     N       A
    53   53 L T  E  <  -Q   49   0E  47  491   67              T      N         Q   S  K     R     Q       H
    54   54 L L  E     -Q   48   0E  60  491   60              R      L         R   H  R     R     R       S
    55   55 L G    >   -     0   0    9  490   71              D      G         P   S  P     P     P       T
    56   56 L E  T 3  S+     0   0  192  490   35              S      S         S   K  S     S     S       S
    57   57 L G  T 3  S+     0   0   70  491    5              G      G         G   g  G     G     G       G
    58   58 L V    <   -     0   0   25  489   11              T      V         V   i  I     V     V       .
    59   59 L P    >   -     0   0   47  490    7              S      P         P   P  P     P     P       .
    60   60 L S  T 3  S+     0   0  115  491   57              A      D         D   D  D     D     D       S
    61   61 L R  T 3  S+     0   0   44  491    4              R      R         R   R  R     R     R       I
    62   62 L F  E <   +M   75   0D   5  491    1              F      F         F   F  F     F     F       Y
    63   63 L S  E     -M   74   0D  55  490   22              T      S         S   S  S     S     S       R
    64   64 L G  E     +M   73   0D  13  491    2              G      G         g   G  g     a     g       g
    65   65 L S  E     +M   72   0D  63  491    5              S      T         d   S  s     i     d       s
    66   66 L G  E     -M   71   0D  36  491   14              G      G         S   S  G     D     S       S
    67   67 L S  E >   +M   70   0D  79  491    9              S      S         S   S  S     Y     S       N
    68   68 L G  T 3  S-     0   0   16  491   13              N      Q         S   G  S     s     S       S
    69   69 L T  T 3  S+     0   0   67  488   13              S      K         N   A  .     n     N       .
    70   70 L Q  E <   +LM  24  67D 110  489   27              D      D         S   E  .     S     S       .
    71   71 L F  E     -LM  23  66D   2  491    6              F      F         A   R  A     A     A       H
    72   72 L S  E     -LM  22  65D  26  491   30              T      T         S   Y  S     S     S       I
    73   73 L L  E     -LM  21  64D   0  491    2              L      L         L   L  L     L     L       L
    74   74 L K  E     -LM  20  63D  97  491   39              T      K         T   T  T     T     T       T
    75   75 L I  E     -LM  19  62D   0  491    1              I      I         I   I  I     I     I       I
    76   76 L N  S    S-     0   0   86  491   30              S      S         S   S  T     S     S       G
    77   77 L S  S    S-     0   0   58  491   62              G      R         G   S  G     G     A       S
    78   78 L L        -     0   0    0  491   27              V      V         L   L  L     L     L       L
    79   79 L L    >   -     0   0   67  491   31              Q      E         K   Q  Q     R     Q       E
    80   80 L P  G >  S+     0   0   92  491   58              A      A         T   S  A     T     A       P
    81   81 L E  G 3  S+     0   0  102  491   13              E      E         E   E  E     E     E       G
    82   82 L D  G <  S+     0   0    1  491    5              D      D         D   D  D     D     D       D
    83   83 L F    <   +     0   0   29  490   72              A      L         E   E  E     E     E       S
    84   84 L G  E    S- R   0 105E  17  491   23              A      G         A   A  A     A     A       A
    85   85 L S  E     -OR  38 104E  24  491   63              V      V         D   D  D     D     D       V
    86   86 L Y  E     -OR  37 103E   0  491    0              Y      Y         Y   Y  Y     Y     Y       Y
    87   87 L Y  E     -O   36   0E   5  490    4              Y      Y         Y   Y  Y     Y     Y       Y
    88   88 L a  E     -O   35   0E   0  491    0              C      C         C   C  C     C     C       C
    89   89 L Q  E     -OS  34  99E   0  489   48              Q      A         Q   Q  E     Q     Q       A
    90   90 L H  E     -O   33   0E  22  483   26              G      Q         S   T  S     S     S       A
    91   91 L H        +     0   0    0  421   89              Q      T         Y   L  Y     Y     Y       W
    92   92 L Y  S    S+     0   0  104  454   88              H      T         D   G  D     D     D       D
    93   93 L G  S    S-     0   0   34  422   71              Y      H         S   H  S     S     N       S
    94   94 L T  S    S-     0   0  104  446   88              P      F         N   W  S     N     S       S
    95   95 L P  S    S+     0   0    7  443   51              N      P         N   H  I     N     D       A
    96   96 L P  S    S-     0   0   55  421   75              T      P         Y   V  N     L     I       a
    97   97 L L        -     0   0   21  160   88              .      .         A   .  .     W     .       f
    98   98 L T        -     0   0   40  288   41              .      .         L   V  .     V     .       T
    99   99 L F  B     -S   89   0E  18  290   29              .      .         F   F  .     F     .       F
   100  100 L G        -     0   0    3  294   39              S      .         G   G  .     G     .       G
   101  101 L G        -     0   0   52  307   63              G      .         G   G  G     G     .       P
   102  102 L G        -     0   0   11  306   43              G      .         G   G  P     G     H       G
   103  103 L T  E     - R   0  86E   0  366   18              P      T         T   T  T     T     T       T
   104  104 L K  E     -nR  10  85E  98  363   58              H      M         Q   H  V     K     V       A
   105  105 L L  E     -nR  11  84E   4  343   37              L      I         L   L  L     L     L       L
   106  106 L E  E     -n   12   0E 108  326   51              V      Q         T      Q     T     Q       S
   107  107 L I  E      n   13   0E 113  301   50              V                V            V     T       L
   108  108 L K              0   0  145  268   18              K                                   K       R
   109      ! !              0   0    0   0     0  
   110    1 H E              0   0  194  408   30  Q  KQQQQ QQQ  QQ    Q QQQQ    D    Q QQQQQ QQQ Q  QNQQQQ 
   111    2 H V        +     0   0   19  465   12  L  VVVVVVVVV MVV  V V VVVVL   V    V VVVVV VVV V  LIIVVL 
   112    3 H K  E     -A  134   0A 111  467   31  Q  QQQQQQTTQ EQQ  Q Q QQQQQ   Q    Q QQQTQ QQT Q  QVTNQQ 
   113    4 H L  E     -A  133   0A   3  489    1  LLLLLLLLLLLL SLL  L L LLLLL   L    L LLLLL LLL L  LLLLLL 
   114    5 H Q  E     -A  132   0A  83  493   70  QVQQKKQQVRRE IQQ  Q Q VQRKQ   Q    Q KVVKV QVK V  LTKRQQ 
   115    6 H E  E     +A  131   0A   5  498   21  EEEEEEEEQEEQ PEE  E Q QEEEE   E    E EQQEQ EQE Q  EQEEEE 
   116    7 H S  E     +A  130   0A  69  501   13  SSSSSSSSSSSS SSS  S S SSSSS   S   SS SSSSS SSN S  SPSSSS 
   117    8 H G        +     0   0   36  505    4  GGGGGGGGGGGG TGG  G G GGGGG   G   GG GGGGG GGG G  GEGGGG 
   118    9 H G        +     0   0   29  672   48  PGPPPPPPVPPP PPPPPS P APPPPPP PPA PP PAAPA PAPPA  PSPPSP 
   119   10 H D        -     0   0   96  677   40  GAGSGGGGEAAG VGGEGK G EGSGGEG GGG GG GEEGE GETGE GGATASG 
   120   11 H L  E     +e  224   0B  79  675   16  LVTLVVLLRLLL LLLLLV L VLLVLLL LLL LL VVVIV LVLXV LVVLLVA 
   121   12 H V  E     -e  225   0B  16  677   33  VKVVVVVVKVVV KVVVVV V RVVVVVV VVV VV VKKLK VRVVR VVKVVVV 
   122   13 H Q    >   -     0   0  114  679   51  KPRKKKKKVKRR NKKKKQ KEKKKKKKA KEK KK KKKQK KKKRK KKKKKQK 
   123   14 H P  T 3  S+     0   0   66  678    9  PAPPPPPPPPPP PPPPPP PPPPPPPPP APP HP PPPPP PPPXP PPPPADP 
   124   15 H G  T 3  S+     0   0   58  682   32  SGSSSSSSGTTS QSSGSS SSGSSSSGS SSS SS SGGSG SGTSG SSGTTSG 
   125   16 H G    <   -     0   0   25  684   63  EEEQQQEEAQQQ EEEAQQ EQAQQQEAQ SQQ QQ QSSQS QAEQA QEEEHQE 
   126   17 H S        +     0   0   78  683   31  TSSTTTTTSTTT TTTSST TTSTTTTSS ATT TT TSSTS TSTTS TTSTTTT 
   127   18 H L  E     - B   0 192A  25  685   25  LLLLLLLLVLLL LLLVLL LLVLLLLVL LLL LL LVALV LVLLV LLHLLLL 
   128   19 H K  E     - B   0 191A  93  683   56  SHRSSPSSRTTS SSSKSS SSKSSSSKS SSS SS SRRSR SKTSK SRKTTST 
   129   20 H L  E     - B   0 190A   0  688   14  LLLLLLLLILLL LLLILL LLVLLLLVI LLL LL LVLLV LVLLV LLLLLLL 
   130   21 H S  E     -AB 116 189A  28  688   37  TSTTTITTSTTT STTSTT TTSTTTTST TTT TT TTSTS TSTTS TSSTTTT 
   131   22 H b  E     -AB 115 188A   0  688    0  CCCCCCCCCCCC CCCCCC CCCCCCCCC CCC CC CCCCC CCCCC CCCCCCC 
   132   23 H A  E     -AB 114 187A  52  688   66  ATTTSAAAKTTT RAAKTA TAKTTAIKT SVA TT SKKSR AKTAK AATTTAS 
   133   24 H A  E     +A  113   0A   8  688   49  VAVTVVVVAFFV GVVAVI VIAVVFVAV VIV VV VTVFA IALIA IVVFFIV 
   134   25 H S  E     +A  112   0A  58  688   12  SSSSSSSSSSSS TSSSTS SSSSSSSSS TSS SS SSSSS SSSSS SSSSSST 
   135   26 H G  S    S+     0   0   56  688    4  gSGGgGGgGggG GGGGGg ggGGGGgGG ggg Ge gGGgG gGggG ggGgggg 
   136   27 H F  S    S-     0   0   33  686   34  iFFFiFGiYllS FGGYYv isYFFFiY. isv Fi iGDlG vYlsY vvFlvvv 
   137   28 H T    >   -     0   0   93  687   50  SIESTSSSASST SSSSSS STTSSSRS. TTS ST TTDRA STTST SSDSNST 
   138   29 H F  G >  S+     0   0    2  688   41  NFLLTLISFSGF FIIFIS SNFLLLRFF SNS LT TFFTL SFTNF SSVTTSG 
   139   30 H S  G 3  S+     0   0   57  688   55  NGTTSTSGETES GSSTTN STTTSTTTS GSN TT SSNSA NIDST NSNSRNS 
   140   31 H S  G <  S+     0   0   71  688   60  HNSSYSGYNGTN SSSDST SGSSSSGDI YGS SY YGTGN SSGAS SYGGGSY 
   141   32 H Y  S <  S-     0   0   44  688   41  WSFYYYYYYMMD YYYYDA YAYYNYYYN YAL YY YYYMY AYVVY AYHVMAY 
   142   33 H T        -     0   0   30  688   91  SESGYDWWYCCY AYYKyT YWYPGVYKQ WWT GY YTDGA TYAWA AWHGSAW 
   143   34 H M  E     -FG 207 160C   0  672   46  .MVVWVW.IVVY MWWIwW W.MVVVWI. ..W VW WIIVI WMV.V ..MVVW. 
   144   35 H S  E     -FG 206 159C   0  685   73  .AHSSGSGHGAT HGSYND GNHNGSGYL NSN HS SSHGS NHGNH .SNGSHH 
   145   36 H W  E     +FG 205 158C   0  688    0  WWWWWWWWWWWW WWWWWW WWWWWWWWW WWW WW WWWWW WWWWW WWWWWWW 
   146   37 H V  E     -FG 204 156C   0  688   19  IYIVIVIIVIIV IIIVIv IFVIVVIVc III IF IVVIV IVIIV nIVIIVI 
   147   38 H R  E     -FG 203 155C  10  688   17  RRRRRCRRRRRR RRQKRq RRRRRRRKl RRR RR RRRRR RRRRR rRKRRRR 
   148   39 H Q  E     -FG 202 154C   9  688    3  QQQQQQQQQQQQ QQQQQL QQQQQQQQG QQQ QQ QQQQQ QQQQQ PQQQQQQ 
   149   40 H T    >   -     0   0    9  688   68  PAPASSPPAPPP PPPSFR SSAAAAPSS FSS AP SAAPA SAGSA VQVRPPA 
   150   41 H P  T 3  S+     0   0   80  687   10  PPPPTPPPPPPP APPHPS PPPPPPPHP PPP PP TPPSP PPPPP PPPPPPP 
   151   42 H E  T 3  S-     0   0  151  688   26  GGGGEGGGGGGG GGGGGF GSGGGGGGA GSS GG EGGGG SGGSG SGGGGGG 
   152   43 H K    <   +     0   0  121  688   32  KRKKKKKKLKER KKKKNS KRQKKKKKS NRR KK KRRKQ RQRRQ RKEKKKQ 
   153   44 H R        -     0   0  113  687   43  GEGAGGGGGGAG TGGSKG GGGGAGGSR KGG GG GGGGG GGAGG GGGAAGG 
   154   45 H L  E     -G  148   0C   9  688   14  LPLLLLLLLLLL LLLLLV LLLLLLLLK LLL LL LLLLL LLLLL LLLLLLL 
   155   46 H E  E     -G  147   0C  44  687    5  EEEEQEEEEEEE EEEEEG EEEEEEEEG EEE EE QEEEE EEEEE EEEEEQE 
   156   47 H W  E     +G  146   0C  15  687   11  WWWWWWWYWWWW WWWWWI WWWWWWWWS WWW WW WWWWW WWWWW WWWWWWW 
   157   48 H V  E     -     0   0C   0  687   28  IVILIVIIMLLI LIIIMI ILMVVVIIG MLL VI IVMLM LVLXM LMLLLLM 
   158   49 H A  E     -G  145   0C   0  688   38  GSGGGGGGGAAG GGGGGG GGGGGGGGV GGG GG GGAAG GGAGG GGLAAGG 
   159   50 H S  E     -GH 144 168C   0  688   94  LHFGYARYIRwY IYYYYE sRRVGAGYa YrR VY YsVHA RTwRW RYSFRRL 
   160   51 H I  E     -GH 143 167C   4  675   18  IIAIIIIIFIiV IIIIII yTVMIIVIi IlT MI IaVII TIlTV T..III. 
   161   52 H N    >   -     0   0   47  682   84  SDWDNCDSNDLF WYYDSN SYDFDAYDW SYY FR NKHWI YHYYN T..NDY. 
   162   53 H N  T 3  S+     0   0   65  684   88  GPYSYSSGPWNY YSSPYP GYPGNGYPA YRY GY YWPWP YPWYP YW.WWF. 
   163   54 H G  T 3  S-     0   0   65  686   68  SFGGSGSSVDDH DSSYSD SRSGDSTYG DSR GE STSDM RLDRY RS.DDSW 
   164   55 H G  S <  S+     0   0   30  687   43  GQGGGGGSADDG AGGNGG TSDGGGGNG GKS GG GDDDS SLDSN SG.DDSS 
   165   56 H G  S    S+     0   0   74  688   63  GRGSGSSGGDKT SSSGSS ykGSDGSGS SWk SN GPDDR kGDkG kSyDDkD 
   166   57 H R        +     0   0  163  505   86  SN.....S.... K..G.T syN..S.V. .Ys .. ..R.T yS.yN y.k..cY 
   167   58 H T  E     -H  160   0C  62  677   52  TPATTTNTAK.S TTTTTT PNTTTTITT NYY TA TFTKT NTKNT NTTNKRT 
   168   59 H Y  E     +H  159   0C  53  686   85  DRVGGYYYVYYD VNNTSY YDNYYYYTN NEE DY GQTRD DNRDK DYYRYES 
   169   60 H Y        -     0   0   44  688    9  YYVYYYLYSYYD YYYYYY YYYYYYYYY YYY YY YGYYY YYFYY YYNYYYY 
   170   61 H P    >>  -     0   0   20  688   65  NSTNNNNNSNGT ANNNNA AAANNNNNN NAA NS NVGNA AASAA ANTSGAN 
   171   62 H D  T 34 S+     0   0  148  688   64  PEDPLPPPETAT SPPQPN PVQPPPPQS PEV PP LYPPQ QQPIQ VPYPTPP 
   172   63 H T  T 34 S+     0   0   90  688   57  SASGSASSKSSP SSSKSA SSKTAASKA SSS TS SIRAK SKSSK SAYSSSS 
   173   64 H V  T X> S+     0   0    1  688   42  LVLLLLLLFLLL VLLFLV LVFLLLLFL LVV LL LKSLF VFLVF VFALLLL 
   174   65 H K  B 3< S+c  177   0A 142  687   31  KRKKKKKKREER EKKEKK RRQKKKREM KKK KK KWQKR QQKKQ KQSREQQ 
   175   66 H G  T 34 S+     0   0   74  687   36  SGNSSSSSDTTS GSSDSG SSGSSSGDS NSS SS SEASG NSSSG SNgSTSG 
   176   67 H R  T <4 S+     0   0   36  688   17  RRRRRRRRRRRR RRRKRR RRRRRRRKR RRR RR RRRRR RRRRR RRqRRRR 
   177   68 H F  E  <  -cD 174 192A   2  688   60  VFVLSLVVLLLV IVVAIF VIVLLLVAL III LT SVFLV IVLIV IIGLLLI 
   178   69 H T  E     - D   0 191A  79  688   38  TSTSSSTTVTAT ETTSST ITSSSSTSS STL SS STTTT SSTNS TTRTTVA 
   179   70 H I  E     + D   0 190A   5  688   20  IIIIIILIMIVM IMMLII IIIIIIILI IFI II IVVII IIVIM IIIGIII 
   180   71 H S  E     - D   0 189A  51  684   41  SSTTSTSSSSSL TSSTTS SNTTTTSTS TNN TS SSTSS NTTXT NTTTSDT 
   181   72 H R  E     - D   0 188A  30  687   60  TRKRRRRKSKKV RVVARR VPGRKKVAK RPP RR RLRKA PERPS PAFKKPV 
   182   73 H D  E > > - D   0 187A  60  686    7  DDDDDDDDDDDD DDDDDD DDDDDDDDD DDD DD DKDDD DDDDD DDSDDDD 
   183   74 H N  G > 5S+     0   0   48  688   57  TNNNTTTTTTTT NTTKTN TTTTNTTKN TTT TT TPSTE TTTTT TTTTTTS 
   184   75 H A  G 3 5S+     0   0   99  688   45  SAGSSSSSSSSS SSSSSA SSSSSSSSS SSS SS SSSSS SYSSS SSESSSS 
   185   76 H K  G < 5S-     0   0  111  688   51  KKKKKKKKARKK NKKSKK KKTKKKRSK KKK KK KFTSR KAKKM KKSRKKS 
   186   77 H N  T < 5 +     0   0   62  688   46  NGKSNSNNNNNN SNNSNN NNSSSSNSS NNN SN NNTNS NSNNS NNSNNNT 
   187   78 H T  E   < -BD 132 182A  16  688   69  QQQQEQQQTQQQ MQQTQT QQTQQQQTQ QQQ QQ EQTQT QTQET QQTQQKK 
   188   79 H L  E     -BD 131 181A   0  687   56  FLIVFVFFVVVF VFFAFL LFAVVVFAV FFF VF FAVVA FAVVA FFTVVFY 
   189   80 H Y  E     -BD 130 180A  41  687   46  SYYSSYSSSVVS YSSLFY SSYYSYSLF FSS YS SYYFY SYVAY SSFVVSY 
   190   81 H L  E     -BD 129 179A   0  687    7  LLLLLLLLMLLL LLLMLL LLMLLLLML LLL LL LMMLM LMLLM LLILLLL 
   191   82 H Q  E     -BD 128 178A  76  687   41  KQQSQQKKQTSR RKKHQQ RQETSQNHK KQQ TQ QEEKE QETQD QQETKER 
   192   83 H M  E     +BD 127 177A   0  688   11  LMMVLLLLLMML LLLLLM LLLLVLLLM LLL LL LLLIL LLMLL LLIIVLL 
   193   84 H S        +     0   0   42  688   54  SDNSTTSSRDNS SSSNNN SNSNSTRNN NNS NS TVTAN NSTNS NNPTTRS 
   194   85 H S  S    S-     0   0   68  687   24  SNGSSSSSN.TS SSSSSS SSSSSSSSS SSS RS SNASS SSNSS SGNNNSS 
   195   86 H L        -     0   0    3  686   18  VLMVVVVVL.VV LVVLVL VVLLVVMLL VVV LV VLLVL VLMVL VVLMMVL 
   196   87 H K    >   -     0   0  102  686   68  TQETTNTTR.GT KTTTTR TIRRTNSTQ TTT RT TFIDR TRDTS TTRDDTT 
   197   88 H S  G >  S+     0   0   70  686   60  AVVPAPAASPPA PAASTA APAAPPAST PPP AT ANSTS PAPPA PLVPPTA 
   198   89 H E  G 3  S+     0   0  126  687   22  AGKEDEAADVGA EAAEET AEEEEEAED EED EE DEAAD EEVEE EAEVAEA 
   199   90 H D  G <   +     0   0    2  687    3  DDDDDDDDDDDD DDDDDD DDDDDDDDD DDD DD DDDDD DDDDD DDDDDDD 
   200   91 H T    <   +     0   0   32  688   28  TSTTTTTTTTTT STTSTT TTTTTTTST TTT TS TGTTT MTTTT TTTSTTT 
   201   92 H A  E    S- I   0 223C   8  686    5  AGAAAAAAGAAA AAAAAA AAAAAAAAA AXA AA AAAAA AAAXA AAAGAAA 
   202   93 H M  E     -FI 148 222C  58  687   48  VRMTVVVVRTTV VVVITL VVVVTVMVM TVV VV VVITV VVTVL VLMTTMT 
   203   94 H Y  E     -FI 147 221C   0  688    1  YYYYYYYYYYYY YYYYYY YYYYYYYYY YYY YY YYYYY YYYYY YYYYYYY 
   204   95 H Y  E     -F  146   0C   7  688    4  YYYYYYYYFYYY YYYYYY YYYYYYYYY YYF FY YYYYY YYYYY YYYFYYF 
   205   96 H b  E     -F  145   0C   0  688    1  CCCCCCCCCCCC CCCCCC CCCCCCCCC CCC CC CCCCC CCCCY CCCCCCC 
   206   97 H V  E     -FJ 144 217C   0  688   23  AVAAAAAAAAAA AVAAAA AAGAAAAAA AVA AT AAAAA AAVAA AAAAADA 
   207   98 H R  E     -FJ 143 216C  21  687   40  rrrkrkrrrrrR rRRrr  srrkkkrrr rrg rr rrrqr rrhIr srRhrpr 
   208   99 H H  E     + J   0 214C   6  583   92  ttlr.tlgfpg. t..sr  ggggtsdsd gta gs kvgpn cet.w deGlsad 
   209  100 H E  E  >  + J   0 213C  63  625   78  GTGG.GADSAS. V..ST  GGSPGYDSG HPA PS GNTAN DPL.A DGTGNET 
   210  101 H Y  T >4 S-     0   0   80  658   93  EDHR.ISFQGQN T..PW  CSQSTGGPS NTE SW DPSWW ASA.L AGGGAQD 
   211  102 H Y  T 34 S-     0   0  140  672   23  YFYH.FFYYYYl yYYFF  YYCCFfIFY YFF CY FFLFF FCFyF FYFFFRT 
   212  103 H Y  T 34 S+     0   0   39  265   92  Y...t......g f....  A....c..W W.. .. ..... ...g. ..P.... 
   213  104 H A  E <<  -J  209   0C   0  403   87  G...V...G..C T....  FS...L..Y Y.. .. ..... ...W. ..Q.... 
   214  105 H M  E     +J  208   0C   0  497   62  L...KR.IMMFI G....  FFH..V..F F.. .. ..... ...F. .QW..A. 
   215  106 H D  E     +     0   0C  19  615   50  D...GN.NDDDD TTTDA  QHR..PDDD DDD .R .DGAG D.DYN DFGDDG. 
   216  107 H Y  E     -J  207   0C  99  624   65  S...RY.FVVYV YVVYY  HYT..LVFV VFY .L SYPYP F.VSF IHYXIL. 
   217  108 H W  E     -J  206   0C  23  675    2  WW.WWSWWWWWW RRRWW  WWWW.WWWW WWW WW WWWWW WWWWR WWWWWWW 
   218  109 H G        -     0   0    0  664   17  GSGAQGAAGGGG GGGGG  GGSA.GGGG GGG AP GGGGG GAGGG GSGGGDE 
   219  110 H Q        -     0   0   91  659   46  QSNVEAKKQRQQ QGGQQ  QQQQTPQQA AQQ QP GQQQR QQQQS QESQQEQ 
   220  111 H G        -     0   0   16  650   16  GigGVG  GGGG QEEGG  GGGGGAGGG GGG GP EGGGG GGGGA GVGGGAA 
   221  112 H T  E     -I  203   0C  21  594   27  Vtl...  TTIS ...TT  FT.F..TTT TTT F. GVTTT LFTTT T.TT.A. 
   222  113 H T  E     -I  202   0C  72  593   76  VAQ...  TPLL M..TL  LL.P.CTTT  LL P. FLLLL RPKLE M.FL.T. 
   223  114 H V  E     -I  201   0C   0  596   20  VTF...  VVVV I..LV  VV.L.IVLV  VV L. LVLVV VLVVL V.LV.L. 
   224  115 H T  E     -e  120   0B  36  593   20  TQT...  ITTT  ..TT  TT.K.VHTT  TT K. STITT TKATT T.TT.H. 
   225  116 H V  E     +e  121   0B   6  572    6  VVV...  VVVV  ..VV  VV.LIIVVV  VV L.  VVVV VLVVE V.VV.T. 
   226  117 H S        -     0   0   36  566   11  SP ...  SSSS  CCSS  SS.SGQSSS  SS S.  SSSS SSSSS S.TS.SS 
   227  118 H S  S    S+     0   0   84  551   22  SG ..E  SSSS  EESA  SS.AKGSSS  SS A.  SSAS SASSP S.SS.SS 
   228  119 H A  S    S+     0   0   70  123   53  AS GAG        PP     GT GN     GG  .  G  A AA G   .  T P 
   229  120 H W        -     0   0  123   73   63  S  RWS        RR      W S          W     S SS     W  W L 
   230  121 H R        +     0   0  207   60   75  T    Q        QH      S R                T TR        S H 
   231  122 H H              0   0  156   54   67  K    K        KK      H                  K KE        P S 
   232  123 H P              0   0  155   35   53  G             PP      T                  G GG        S S 
## SEQUENCE PROFILE AND ENTROPY
 SeqNo PDBNo   V   L   I   M   F   W   Y   G   A   P   S   T   C   H   R   K   Q   E   N   D  NOCC NDEL NINS ENTROPY RELENT WEIGHT
    1    1 L   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   6  14   1  78   420    0    0   0.716     23  0.84
    2    2 L   8   2  87   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   1   0   462    0    0   0.537     17  0.88
    3    3 L  45   2   2   2   0   0   0   0   1   0   0   5   0   0   0   1  41   1   0   0   463    0    0   1.255     41  0.31
    4    4 L   1  31   0  68   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   474    0    0   0.697     23  0.92
    5    5 L   0   0   1   0   0   0   0   0   0   0   3  95   0   0   0   0   0   0   1   0   475    0    0   0.268      8  0.91
    6    6 L   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  99   0   0   0   475    0    0   0.049      1  0.99
    7    7 L   0   0   0   0   0   0   0   0   1   1  76  22   0   0   0   0   0   0   0   0   475    1    0   0.655     21  0.66
    8    8 L   0   0   0   0   0   0   0   0   1  94   0   3   0   0   0   0   1   0   0   0   480    0    0   0.313     10  0.91
    9    9 L   2  10   0   0   1   0   0   5  25   2  46   2   0   1   0   0   0   2   0   4   484    0    0   1.622     54  0.32
   10   10 L   0   2   6   0   3   0   2   0   1   2  75  10   0   0   0   0   0   0   0   0   485    0    0   1.007     33  0.56
   11   11 L  10  80   0   6   0   0   0   0   0   0   0   1   0   0   0   1   1   0   1   0   489    0    0   0.813     27  0.78
   12   12 L   0   1   0   0   0   0   1   0  18  13  66   1   0   0   0   0   0   1   0   0   490    0    0   1.044     34  0.57
   13   13 L  34   6   1   0   0   0   0   2  51   0   0   1   0   0   1   2   0   2   0   0   490    0    0   1.291     43  0.41
   14   14 L   0   0   0   0   1   0   0   0   5   2  82  10   0   0   0   0   0   0   0   0   491    0    0   0.707     23  0.71
   15   15 L  34  26   2   0   0   0   0   0   2  29   1   1   0   1   1   0   3   0   0   0   491    0    0   1.515     50  0.33
   16   16 L   0   0   0   0   0   0   0  98   0   0   0   0   0   0   1   0   0   1   0   0   491    0    0   0.155      5  0.95
   17   17 L   0   0   0   0   0   0   0   7   0   0   1   0   0   0   0   1  12  36   0  42   491    0    0   1.297     43  0.65
   18   18 L   0   0   1   0   0   0   0   0   0   7   5  20   0   0  53   9   3   0   0   0   491    0    0   1.443     48  0.38
   19   19 L  73   0   1   0   0   0   0   0  25   0   0   1   0   0   0   0   0   0   0   0   491    0    0   0.664     22  0.62
   20   20 L   0   0   1   0   0   0   0   0   1   0  15  81   0   0   0   0   0   0   1   0   490    1    1   0.665     22  0.70
   21   21 L   1  10  80   7   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   489    0    0   0.705     23  0.82
   22   22 L   0   0   1   0   0   0   0   0   0   0  38  43   0   0   3   4   0   1  10   0   489    0    0   1.307     43  0.41
   23   23 L   0   0   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   490    0    0   0.082      2  0.98
   24   24 L   0   1   0   0   0   0   0   0   0   0   4   2   0   1  57  20  15   0   0   0   490    0    0   1.293     43  0.54
   25   25 L   0   0   0   0   0   0   0   0  80   0  16   2   0   0   1   0   0   0   0   0   490    0    0   0.646     21  0.71
   26   26 L   0   0   0   0   0   0   0   1   0   0  98   1   0   0   0   0   0   0   0   0   490    0    0   0.152      5  0.96
   27   27 L   0   0   0   0   0   0   0   1   0   0  10   0   0   1   0   4  73  10   0   0   490    0    0   0.979     32  0.61
   28   28 L   0   0   0   0   0   0   0  21   0   0  57   1   0   0   0   0   0   0   8  11   490    0    0   1.267     42  0.54
   29   29 L  27  19  50   0   0   0   0   0   0   0   1   1   0   0   0   0   0   0   1   0   491    0    0   1.233     41  0.67
   30   30 L   4  12   1   0   1   0   9   6   0   0  45   3   0   1   2   0   0   1  10   5   491   24  180   1.926     64  0.19
   31   31 L   0   0   2   0   0   0   1   1   0   0  33  15   0   1   0   4   1   0  33   5   467    0    0   1.665     55  0.35
   32   32 L   1   3   1   0   4  10  60   1   1   0   3   0   1   1   1   0   0   2   8   2   490    0    0   1.602     53  0.48
   33   33 L   3  84   1  11   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   490    0    0   0.575     19  0.92
   34   34 L   1   1   0   0   0   0   4   1  37   0  10   1   0  17   0   0   1   2  23   2   490    0    0   1.769     59  0.29
   35   35 L   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   491    0    0   0.029      0  0.99
   36   36 L   0   2   0   0   8   0  87   0   0   0   0   0   0   3   0   0   0   0   0   0   491    0    0   0.516     17  0.91
   37   37 L   0  12   0   0   0   0   0   0   0   0   0   0   0   0   1   0  86   0   0   0   491    0    0   0.445     14  0.71
   38   38 L   0   0   0   0   0   0   0   0   0   0   0   0   0   1   0   2  95   0   0   0   491    1    0   0.200      6  0.95
   39   39 L   0   0   0   0   0   0   0   0   0   0   0   0   0   0   3  94   1   0   0   0   490    0    0   0.340     11  0.91
   40   40 L   0   1   0   0   0   0   0   0   1  88   6   0   0   1   1   0   2   0   0   0   491    0    0   0.576     19  0.81
   41   41 L   0   0   0   0   0   0   0  92   0   0   1   0   0   0   0   0   1   1   0   4   491    0    0   0.417     13  0.89
   42   42 L   0   0   0   0   0   0   0   5   1   0   2   3   0   0   1  33  48   3   1   0   490    0    0   1.389     46  0.45
   43   43 L   3   0   0   0   0   0   0   0  42  16  30   6   0   0   1   0   0   0   0   0   490    0    0   1.462     48  0.44
   44   44 L   3   0   1   0   0   0   0   0   0  94   0   0   0   0   0   0   0   0   0   0   490    1    1   0.277      9  0.89
   45   45 L   0   0   0   0   0   0   0   0   0   0   0   2   0   0  14  71  11   1   1   0   490    0    0   0.940     31  0.67
   46   46 L   1  78   0   0   1   0   0   1   0   6   1   2   0   1   7   0   0   0   0   0   490    0    0   0.966     32  0.58
   47   47 L   1  92   1   1   0   4   0   0   0   0   0   0   0   0   0   0   0   0   0   0   490    0    0   0.369     12  0.90
   48   48 L   2   2  95   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   491    0    0   0.285      9  0.95
   49   49 L   0   0   0   0   1   0  92   0   0   0   2   0   0   1   1   1   0   0   1   0   491    0    0   0.457     15  0.83
   50   50 L   1   7   0   0   0   5  12  14  19   0   4   1   0   1   9   9   1   6   2   9   491    0    0   2.424     80  0.09
   51   51 L  10   1   2   1   0   0   0   3  68   0   1  12   0   0   0   0   0   0   0   1   491    0    0   1.128     37  0.55
   52   52 L   0   0   0   0   0   0   1   0   0   0  84   5   0   0   0   2   0   0   7   0   491    0    0   0.697     23  0.74
   53   53 L   0   0   2   0   0   0   2   1   0   0  26  20   0   1   5   7   1   0  35   1   491    0    0   1.731     57  0.32
   54   54 L   0  69   0   0   0   0   0   0   0   0   1   0   0   1  27   0   2   0   0   0   491    0    0   0.820     27  0.39
   55   55 L   2   1   1   0   4   0   1   2  31   1   0   1   0   7   0   0  23  21   0   3   490    1    0   1.905     63  0.29
   56   56 L   0   0   0   0   0   0   0   0   1   1  74  16   0   0   0   0   0   1   1   5   490    0    0   0.941     31  0.64
   57   57 L   0   0   0   0   0   1   0  98   0   0   0   0   0   0   0   0   0   1   0   0   491    1    2   0.140      4  0.95
   58   58 L  83   0  15   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   489    0    0   0.548     18  0.89
   59   59 L   0   0   0   0   0   0   0   0   0  96   4   0   0   0   0   0   0   0   0   0   490    0    0   0.192      6  0.93
   60   60 L   1   1   0   0   0   0   0   0  18   1  51   0   0   0   0   1   0   1   0  26   491    0    0   1.265     42  0.43
   61   61 L   0   0   0   0   0   0   0   0   0   0   0   0   0   0  97   0   1   0   0   0   491    0    0   0.177      5  0.95
   62   62 L   0   1   1   0  98   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   491    0    0   0.111      3  0.99
   63   63 L   0   0   1   0   0   0   0   0   0   0  87   4   0   0   2   5   0   0   0   0   490    0    0   0.558     18  0.78
   64   64 L   0   0   0   0   0   0   0  98   1   0   0   0   0   0   0   0   0   0   0   1   491    0    7   0.136      4  0.97
   65   65 L   0   0   0   0   0   0   0   1   0   0  97   0   0   0   1   0   0   0   0   0   491    0    0   0.178      5  0.95
   66   66 L   0   0   0   0   0   0   0  93   0   0   1   0   0   0   5   0   0   0   0   0   491    0    0   0.332     11  0.85
   67   67 L   0   0   0   0   1   0   2   0   1   0  96   0   0   0   0   0   0   0   0   0   491    0    0   0.254      8  0.90
   68   68 L   0   0   0   0   0   0   0  92   2   0   1   0   0   0   2   0   0   1   0   1   491    2    2   0.425     14  0.87
   69   69 L   0   0   0   0   0   0   0   0   2   0   2  93   0   0   0   1   1   0   1   0   488    0    0   0.383     12  0.87
   70   70 L   0   0   0   0   0   0   0   0   1   0   6   0   0   0   0   0   6  10   0  74   489    0    0   0.915     30  0.72
   71   71 L   0   0   0   0  76   0  23   0   1   0   0   0   0   0   0   0   0   0   0   0   491    0    0   0.610     20  0.93
   72   72 L   0   0   1   0   0   0   0   0   0   0  21  78   0   0   0   0   0   0   0   0   491    0    0   0.592     19  0.69
   73   73 L   0  95   0   0   5   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   491    0    0   0.230      7  0.97
   74   74 L   0   0   1   0   0   0   0   0   0   0   2  76   0   0   2  14   0   0   5   0   491    0    0   0.886     29  0.61
   75   75 L   0   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   491    0    0   0.079      2  0.98
   76   76 L   0   0   0   0   0   0   0   1   0   0  82   2   0   5   1   0   0   0   7   2   491    0    0   0.771     25  0.70
   77   77 L   0   0   0   0   0   0   0   9   0   7  50   1   1   0  20   0   0   0   8   3   491    0    0   1.505     50  0.38
   78   78 L  30  59   1   8   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   491    0    0   1.043     34  0.73
   79   79 L   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   2  43  51   0   1   491    0    1   0.876     29  0.69
   80   80 L   1   0   0   0   0   0   1   0  33  44   4   2   6   0   0   0   2   5   0   1   491    0    0   1.525     50  0.42
   81   81 L   0   0   0   0   0   0   0   1   3   0   0   0   0   0   0   0   0  83   0  11   491    0    0   0.574     19  0.86
   82   82 L   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   1   0  97   491    0    0   0.118      3  0.94
   83   83 L  21   6   9   2  27   0   0   0  29   0   1   2   0   0   0   0   0   1   0   1   490    0    0   1.756     58  0.27
   84   84 L   1   0   0   0   0   0   0  23  75   0   0   1   0   0   0   0   0   0   0   0   491    0    0   0.658     21  0.76
   85   85 L  26   0   7   2   0   0   0   0   1   0   2  49   0   2   0   0   0   1   3   8   491    0    0   1.525     50  0.36
   86   86 L   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   491    0    0   0.000      0  1.00
   87   87 L   0   0   0   0  10   0  88   0   0   0   0   0   0   1   0   0   0   0   0   0   490    0    0   0.458     15  0.95
   88   88 L   0   0   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   491    2    0   0.041      1  0.99
   89   89 L   1   9   0   7   2   0   1   1   2   0   1   0   0   2   0   0  72   1   0   0   489    0    0   1.162     38  0.51
   90   90 L   0   0   0   0   0   0   0   3   0   0   2   0   0   6   1   2  81   1   2   0   483   37    0   0.825     27  0.73
   91   91 L   0   2   0   0   1   4  25  16   7   0  17   4   1  10   3   0   1   1   4   3   421    0    0   2.261     75  0.11
   92   92 L   1   6   2   0   1   2  31   3   1   0  11   6   0   2   4   4   0   0  18   7   454   29    0   2.227     74  0.11
   93   93 L   1   0   0   0   0   0   4   5   0   0  42   4   0   6   1   2   5  12  10   5   422    0    0   1.993     66  0.28
   94   94 L   5   6   2   0   7   4  15   2   5   2  21  11   0   0   1   1   0   2   8   5   446    1    0   2.473     82  0.11
   95   95 L   1   8   1   0   2   1   2   2   1  71   5   2   0   0   0   0   0   0   2   1   443    0    0   1.280     42  0.48
   96   96 L   1   9   2   0   3   4   7   1   2  56   4   3   0   3   2   0   1   1   2   0   421  230   20   1.790     59  0.24
   97   97 L   2  12   3   1   4   8  11   1   1   4   2  28   0   1  14   1   5   0   2   0   160    1    0   2.343     78  0.11
   98   98 L  16   1   0   0   0   0   0   2   1   1   3  72   2   0   0   0   0   0   0   0   288    0    0   1.020     34  0.58
   99   99 L   6   7   7   2  73   0   2   0   1   0   1   1   0   0   0   0   0   0   0   0   290    0    0   1.104     36  0.71
  100  100 L   0   2   1   0   1   0   0  75   0   0   3   1   0   1   1   0  13   0   1   0   294    0    0   1.014     33  0.60
  101  101 L   1   0   0   0   0   0   0  35  17   4   7   9   0   0   0   1  24   1   1   0   307    0    0   1.771     59  0.36
  102  102 L   4   3   1   4   0   0   0  75   1   2   1   0   0   1   1   1   1   1   2   1   306    0    0   1.193     39  0.57
  103  103 L   0   1   1   1   0   0   0   1   1   0   4  89   0   0   0   1   1   0   1   0   366    0    0   0.588     19  0.82
  104  104 L  16   0   1   2   0   0   0   1   1   0   1   2   0   1   6  59   5   4   1   1   363    0    0   1.493     49  0.42
  105  105 L  23  59   7   2   0   0   1   0   2   0   0   4   0   1   0   1   0   0   0   0   343    0    0   1.314     43  0.62
  106  106 L   4   0   0   2   0   0   0   0   0   0   6   2   0   5   0   1  16  56   2   4   326    0    0   1.550     51  0.49
  107  107 L  11  17  50   1   1   0   0   0   2   4   2   8   0   0   0   0   1   0   1   0   301    0    0   1.661     55  0.49
  108  108 L   0   0   0   0   0   0   0   0   0   0   0   0   0   0  14  81   3   0   2   0   268    0    0   0.620     20  0.82
  109          0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0     0    0    0   0.000      0  1.00
  110    1 H   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  51  40   0   8   408    0    0   0.937     31  0.69
  111    2 H  89   2   4   1   0   0   0   0   0   0   0   0   0   0   0   0   0   3   0   0   465    0    0   0.487     16  0.87
  112    3 H   0   0   0   1   0   0   0   0   0   0   0   2   0   1   4  12  77   1   0   0   467    0    0   0.898     29  0.68
  113    4 H   1  98   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   489    0    0   0.119      3  0.98
  114    5 H  47   8   0   0   0   0   0   0   0   0   0   1   0   0   1   3  33   4   0   0   493    0    0   1.371     45  0.30
  115    6 H   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  22  77   0   0   498    0    0   0.591     19  0.78
  116    7 H   0   0   0   0   0   1   0   0   0   7  91   0   0   0   0   0   0   0   0   0   501    0    0   0.381     12  0.86
  117    8 H   0   0   0   0   0   0   0  97   0   0   0   0   0   0   0   0   0   2   0   0   505    0    0   0.164      5  0.96
  118    9 H   0   0   0   0   0   0   0  55  14  28   1   2   0   0   0   0   0   0   0   0   672    0    0   1.104     36  0.51
  119   10 H   1   0   0   0   0   0   0  63   1   0   5   1   0   0   0   0   0  18   0   9   677    0    0   1.221     40  0.60
  120   11 H  15  82   1   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   675    0    0   0.600     20  0.84
  121   12 H  83   1   0   1   0   0   0   0   2   0   0   0   0   0   4   5   2   0   0   0   677    1    0   0.767     25  0.67
  122   13 H   0   0   0   0   0   0   0   0   4   1   0   1   0   0   6  42  42   1   0   0   679    0    0   1.259     42  0.49
  123   14 H   0   0   0   0   0   0   0   0   3  94   1   0   0   0   0   0   0   0   0   0   678    0    0   0.312     10  0.91
  124   15 H   0   0   0   0   0   0   0  72   0   0  23   1   0   0   0   2   0   0   0   0   682    0    0   0.792     26  0.68
  125   16 H   0   0   0   0   0   0   0  44  16   0   2   1   0   0   7   1  20   8   0   1   684    1    0   1.634     54  0.37
  126   17 H   0   1   0   0   0   0   0   0   0   0  80  18   0   0   0   0   0   0   0   0   683    0    0   0.627     20  0.69
  127   18 H  20  74   0   2   0   0   0   0   0   0   0   0   0   1   2   0   0   0   0   0   685    1    0   0.792     26  0.74
  128   19 H   0   0   0   0   0   0   0   0   0   0  23   3   0   1  34  39   0   0   0   0   683    0    0   1.297     43  0.44
  129   20 H   4  83  10   3   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   688    0    0   0.633     21  0.86
  130   21 H   0   0   0   0   0   0   0   0   0   0  74  25   0   0   0   0   0   0   0   0   688    0    0   0.681     22  0.62
  131   22 H   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   688    0    0   0.033      1  0.99
  132   23 H   5   0   0   0   0   0   0   0  46   0   4  19   0   0   1  23   0   1   0   0   688    0    0   1.450     48  0.34
  133   24 H  20   0   4   0   2   0   0   3  66   0   1   4   0   0   0   0   0   0   0   0   688    0    0   1.076     35  0.50
  134   25 H   0   0   0   0   0   0   0   0   0   0  92   6   0   0   0   0   0   0   0   0   688    0    0   0.334     11  0.87
  135   26 H   0   0   0   0   0   0   0  98   0   0   0   0   0   0   0   0   0   1   0   0   688    2   84   0.146      4  0.96
  136   27 H   4   3   5   0  65   0  17   2   0   0   3   0   0   1   0   0   0   0   0   1   686    0    0   1.256     41  0.66
  137   28 H   0   0   2   0   0   0   0   1   1   1  23  62   0   0   1   0   0   1   4   3   687    0    0   1.241     41  0.49
  138   29 H   1  14   4   0  67   0   1   1   0   0   5   5   0   0   0   0   0   0   1   0   688    0    0   1.217     40  0.59
  139   30 H   0   0   0   0   0   0   0   5   1   0  53  27   0   0   2   2   0   0   6   1   688    0    0   1.370     45  0.45
  140   31 H   0   0   1   0   0   0   3   9   1   0  49   6   0   1   3   0   0   0  10  15   688    0    0   1.665     55  0.40
  141   32 H   1   0   0   1   6   0  74   1   4   0   3   1   1   2   0   0   0   0   4   1   688    0    0   1.172     39  0.58
  142   33 H   2   1   0   0   1  18  18  26  15   1   3   3   0   1   2   1   0   2   2   5   688   16    3   2.155     71  0.08
  143   34 H  13   1   8  68   0   9   0   0   0   0   0   0   0   0   0   0   0   0   0   0   672    1    0   1.061     35  0.53
  144   35 H   0   1   0   0   1   0   4   8   1   0  27   2   0  29   0   1   1   3  18   2   685    0    0   1.932     64  0.26
  145   36 H   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   688    0    0   0.011      0  0.99
  146   37 H  77   1  15   1   3   0   1   0   1   0   0   0   0   0   0   0   0   0   0   0   688    0    3   0.824     27  0.80
  147   38 H   0   0   0   0   0   0   0   0   0   0   0   0   0   0  83  15   0   0   0   0   688    0    0   0.554     18  0.83
  148   39 H   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1  98   0   0   0   688    0    0   0.148      4  0.96
  149   40 H   2   0   0   0   3   0   0   1  46  13  10  12   0   0  12   0   0   0   0   0   688    1    0   1.695     56  0.31
  150   41 H   0   0   0   0   0   0   0   0   1  94   1   1   0   2   0   0   0   0   0   0   687    0    0   0.328     10  0.89
  151   42 H   1   0   0   0   0   0   0  77   1   0   3   0   0   0   0   0   0  12   0   6   688    0    0   0.866     28  0.74
  152   43 H   0   0   0   0   0   0   0   0   0   0   0   0   0   1   9  74  10   1   2   0   688    0    0   0.953     31  0.68
  153   44 H   1   0   0   0   0   0   0  71   5   0   3   1   0   0  12   3   0   2   0   1   687    0    0   1.097     36  0.56
  154   45 H   0  94   0   0   0   0   0   0   0   3   0   0   0   0   3   0   0   0   0   0   688    0    0   0.319     10  0.85
  155   46 H   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1   2  95   0   0   687    0    0   0.223      7  0.95
  156   47 H   0   3   0   0   1  91   1   0   0   1   1   0   0   0   0   0   0   0   0   0   687    0    0   0.467     15  0.88
  157   48 H  52  15  26   7   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   687    0    0   1.178     39  0.72
  158   49 H   1   0   0   0   0   0   0  46  41   0  12   0   0   0   0   0   0   0   0   0   688    0    0   1.084     36  0.62
  159   50 H  14   3   2   1   4   4  14   5   8   0   5  10   1   1  14   0   1   7   3   2   688   12   21   2.586     86  0.06
  160   51 H   3   2  86   1   1   0   0   0   1   0   2   4   0   0   0   0   0   0   0   0   675    0    0   0.676     22  0.81
  161   52 H   0   1   0   0   1  10  12   1   1   0  29   2   0   2  10   4   0   1  14  10   682    0    0   2.199     73  0.16
  162   53 H   0   2   1   0   1   5  15   8   3  20  22   6   0   2   1   1   2   0   9   3   684    0    0   2.284     76  0.11
  163   54 H   0   1   0   0   0   0   2  26   2   1  15   2   0   0   4   7   0   2  11  25   686    0    0   2.050     68  0.32
  164   55 H   0   0   0   0   0   0   0  58   4   0  21   1   0   0   0   0   0   1   7   5   687    0    0   1.350     45  0.56
  165   56 H   1   0   2   0   1   1   1  29   1   1  37   4   0   1   3   3   0   1  10   5   688  183   99   1.865     62  0.37
  166   57 H   1   0   1   0   1   0  20  10   4   1  18  16   0   0   2   1   2   5  11   5   505    0    0   2.282     76  0.14
  167   58 H   1   1  10   0   0   0   0   0   3   2   2  63   0   0   0  10   1   0   4   0   677    0    0   1.418     47  0.48
  168   59 H   1   1   1   0   1   1  44   2   1   0   6   3   0   4   2   7   0   5  13   8   686    0    0   2.004     66  0.15
  169   60 H   0   1   0   0   1   0  94   0   0   0   0   0   0   1   0   0   0   0   0   0   688    0    0   0.346     11  0.91
  170   61 H   3   0   0   0   0   0   0   1  41  11   7   3   0   1   1   1   0   0  27   2   688    0    0   1.700     56  0.35
  171   62 H   3   0   0   0   0   0   0   1   7  19   6   1   0   0   0   0   8  11   2  41   688    0    0   1.829     61  0.35
  172   63 H   0   0   0   0   1   1   0   0  14   1  58   5   0   0   1  16   0   0   1   1   688    0    0   1.428     47  0.42
  173   64 H  55  22   0   1  20   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0   688    1    0   1.141     38  0.58
  174   65 H   0   0   2   2   0   0   0   0   0   0   0   1   0   0   4  79   8   2   1   0   687    0    0   0.904     30  0.69
  175   66 H   0   0   0   0   0   0   0  64   0   0  26   1   0   0   1   0   0   0   2   5   687    0    1   0.992     33  0.63
  176   67 H   0   0   0   0   0   0   0   0   0   0   0   0   0   0  82  16   1   0   0   0   688    0    0   0.562     18  0.83
  177   68 H   8  13   5   0  56   0   0   0  15   0   1   2   0   0   0   0   0   0   0   0   688    0    0   1.373     45  0.40
  178   69 H   1   0   5   0   0   0   0   0   1   0  18  74   0   0   0   0   0   0   0   0   688    0    0   0.866     28  0.61
  179   70 H   4  12  77   3   2   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   688    1    0   0.840     28  0.79
  180   71 H   0   0   0   0   0   0   0   0   0   0  69  27   0   0   0   0   0   0   3   0   684    0    0   0.768     25  0.58
  181   72 H  10   2   1   0   0   1   0   0   7   3   1   0   0   0  64   9   0   0   0   0   687    1    0   1.317     43  0.40
  182   73 H   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1   2  94   686    0    0   0.285      9  0.93
  183   74 H   0   0   0   0   0   0   0   0   0   1   1  25   0   0   0  13   0   0  51   7   688    0    0   1.320     44  0.42
  184   75 H   1   0   0   0   0   0   1   5  28   6  56   2   0   0   0   0   0   0   1   0   688    0    0   1.242     41  0.54
  185   76 H   0   0   1   0   0   0   0   0   1   0  16   2   0   0   2  64   7   1   4   0   688    0    0   1.288     43  0.49
  186   77 H   0   0   0   0   0   0   0   0   0   0  38   1   0   0   1   2   0   0  56   1   688    0    0   0.965     32  0.54
  187   78 H   0   3   3   5   0   0   0   0   0   0   9  51   0   0   0   1  24   1   2   0   688    1    0   1.476     49  0.30
  188   79 H  22  48   0   0  10   0   0   0  18   0   0   1   0   0   0   0   0   0   0   0   687    0    0   1.356     45  0.44
  189   80 H   1   0   0   0  13   0  67   0   0   0  13   1   0   3   0   0   0   0   1   1   687    0    0   1.126     37  0.53
  190   81 H   0  82   0  16   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   687    0    0   0.594     19  0.92
  191   82 H   0   1   0   0   0   0   0   0   0   0   4   2   0   1   2   9  70   8   1   1   687    0    0   1.150     38  0.59
  192   83 H   1  36   2  60   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   688    0    0   0.855     28  0.88
  193   84 H   0   0   1   0   0   0   1   1   1   0  39   6   0   1   2   1   0   0  46   2   688    1    0   1.334     44  0.45
  194   85 H   0   0   1   0   0   0   0   2   2   0  84   2   0   0   2   2   0   0   6   0   687    1    0   0.746     24  0.75
  195   86 H  17  80   0   2   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   686    0    0   0.627     20  0.82
  196   87 H   0   0   1   0   0   0   0   0   1   0   1  30   0   0  36  21   6   2   1   1   686    1    0   1.543     51  0.32
  197   88 H   3   0   1   0   0   0   0   0  33  10  34  16   0   0   0   0   0   0   1   1   686    0    0   1.552     51  0.40
  198   89 H   1   0   0   0   0   0   0   1   6   0   0   0   0   0   0   1   1  80   1   8   687    0    0   0.778     25  0.78
  199   90 H   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  98   687    0    0   0.072      2  0.97
  200   91 H   0   0   0   1   0   0   0   0   1   0  16  81   0   0   0   0   0   0   0   0   688    0    0   0.614     20  0.71
  201   92 H   0   0   0   0   0   0   0   4  95   0   0   0   0   0   0   0   0   0   0   0   686    1    0   0.220      7  0.95
  202   93 H  49   7   6  20   0   0   0   0   0   0   0  14   0   0   1   1   0   0   0   0   687    0    0   1.456     48  0.52
  203   94 H   0   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   688    0    0   0.079      2  0.98
  204   95 H   0   0   0   0   8   0  90   0   0   0   0   1   0   0   0   0   0   0   0   0   688    0    0   0.390     13  0.96
  205   96 H   0   0   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   0   0   0   688    0    0   0.061      2  0.99
  206   97 H   6   0   0   0   0   0   0   1  84   0   1   7   0   0   0   0   0   0   1   0   688    0    0   0.661     22  0.77
  207   98 H   1   0   1   0   0   0   0   2   2   1   3   5   0   1  72  11   0   0   0   0   687  103  537   1.175     39  0.59
  208   99 H   4   5   3   1   2   4  10  15   5   4  10   7   0   4   8   3   2   4   3   7   583    0    0   2.761     92  0.08
  209  100 H   3   4   2   0   0   0   3  22   7   7  14   7   0   3   6   1   2   5   3  11   625    0    0   2.495     83  0.21
  210  101 H   2   4   3   0   3   7  17  12   6   4   8   5   2   2   6   1   2   2   5   7   658    0    0   2.727     91  0.06
  211  102 H   1   4   1   1  27   5  55   0   0   0   0   0   2   1   0   0   0   0   1   0   672  417  139   1.370     45  0.76
  212  103 H   7   3   0   0   3   8  21  17   7   4   9   3   1   3   3   1   1   3   3   5   265    0    0   2.521     84  0.07
  213  104 H   3   2   1   0   3   5  16  16  24   2   7   3   2   1   3   1   2   1   2   3   403    0    0   2.434     81  0.13
  214  105 H   5   9   6  23  38   1   0   3   2   2   1   0   1   1   1   1   1   1   1   1   497    0    0   2.019     67  0.37
  215  106 H   1   2   0   0   1   0   1   3  12   2   2   3   1   1   1   1   0   3   1  63   615    0    0   1.544     51  0.49
  216  107 H  14   4   3   1   4   0  57   0   2   3   4   2   1   2   0   0   0   0   2   0   624    0    0   1.685     56  0.35
  217  108 H   0   0   0   0   1  96   1   0   0   0   0   0   0   0   2   0   0   0   0   0   675    0    0   0.226      7  0.97
  218  109 H   0   1   0   0   0   0   0  87   4   0   3   2   0   0   0   0   0   1   1   0   664    0    0   0.657     21  0.82
  219  110 H   1   2   0   0   0   0   0   1   7   7   1   2   0   0   5   2  68   1   0   0   659    0    0   1.322     44  0.54
  220  111 H   1   0   0   1   0   0   0  89   2   1   2   0   0   0   0   1   0   1   1   1   650   55   12   0.601     20  0.83
  221  112 H   3   4   1   0   1   0   0   1   2   0   2  85   0   0   0   0   0   0   0   0   594    0    0   0.742     24  0.72
  222  113 H   2  40   1   3   1   0   0   0   1   2  19  23   0   0   0   0   4   1   0   1   593    0    0   1.713     57  0.24
  223  114 H  77  18   2   0   0   0   0   0   0   0   0   1   1   0   0   0   1   0   0   0   596    0    0   0.755     25  0.80
  224  115 H   2   1   1   0   0   0   0   0   1   1   3  88   0   0   0   1   1   0   0   0   593    0    0   0.627     20  0.79
  225  116 H  93   2   3   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0   572    0    0   0.353     11  0.93
  226  117 H   0   0   0   0   0   0   0   1   1   0  93   2   1   0   0   0   0   1   0   0   566    0    0   0.427     14  0.88
  227  118 H   0   0   0   0   0   0   0   1  12   1  83   1   0   0   0   0   0   1   1   0   551    0    0   0.659     22  0.77
  228  119 H   2   0   0   2   0   0   0  37  33   3   6   3   0   1   1   0   0  11   2   0   123    0    0   1.646     54  0.46
  229  120 H   0   1   0   0   1  30   0   0   0   5  42   0   0   3   7  10   0   0   0   0    73    0    0   1.509     50  0.36
  230  121 H   0   0   0   0   0   0   0   0   3   5   5  25   0   3  23   5  28   2   0   0    60    0    0   1.788     59  0.25
  231  122 H   0   0   0   0   0   0   0   0   2   4  43  19   0   4   0  22   4   4   0   0    54    0    0   1.572     52  0.32
  232  123 H   0   0   0   0   0   0   0  29  26  31  11   3   0   0   0   0   0   0   0   0    35    0    0   1.420     47  0.47
## INSERTION LIST
 AliNo  IPOS  JPOS   Len Sequence
     2   194    85     1 rHy
     5   200    91     2 rQVr
     7   204    95     1 yGy
     9   204    95     1 yDy
    11   200    91     2 rHYg
    15   200    91     4 sPYYRy
    16   200    91     2 rHYg
    17   200    91     1 rAe
    18   194    85     4 rERYRy
    22   212   105     1 dGy
    24   202    93     1 rIy
    26   200    91     1 rHd
    27   200    91     2 rLYd
    28   200    91     2 rHYg
    29   200    91     1 rIy
    31   200    91     1 rHg
    33   200    91     2 rRAv
    34   200    91     2 rHRy
    35   200    91     1 rSw
    36   200    91     1 rGy
    38   212   103     1 yDv
    39   200    91     3 rWHYg
    41   200    91     1 rDr
    41   204    96     1 fGt
    43   200    91     1 rSw
    44   203    94     2 fTTv
    45   203    94     2 rGKg
    46   200    91     3 rGEYg
    47   200    91     2 rDKp
    47   204    97     2 yGNs
    48   200    91     4 rRDGKv
    50   200    91     3 rDNYg
    51   212   122     1 yEa
    52   203    94     2 fTTv
    53   202    93     2 eATd
    54   200    91     2 rGEd
    55   203    94     2 fTTv
    56   208    99     2 rHIn
    56   212   105     1 yDg
    57   208    99     4 rLGFDg
    59   200    91     1 rDs
    59   204    96     1 yQa
    60   200    91     2 rDGk
    61   200    91     2 rGYy
    62   193    84     3 rPLDt
    63   200    91     3 rDPYy
    63   204    98     1 yVp
    64   208    99     3 rQAYg
    65   200    91     3 rEACy
    65   204    98     2 yGEy
    66   200    91     1 rRg
    67   200    91     1 rRg
    68   200    91     3 rEACy
    68   204    98     2 yGEy
    69   200    91     2 rDRa
    69   204    97     2 yDKd
    70   200    91     3 rEACy
    70   204    98     2 yGEy
    71   203    95     4 rHWAYy
    73   190    81     6 rQITTVVa
    74   200    91     4 rPRSTl
    74   204    99     1 tDw
    75   208    99     3 rREDg
    76   203    94     2 yGNy
    77   208   115     3 rWGNy
    78   203    94     2 yGNy
    79   200    91     6 rPRSTLIt
    80   203    94     2 yGNy
    81   200    91     5 rRGAYGn
    82   203    94     2 yGNy
    87   200    91     1 rRg
    90   200    91     1 rQe
    90   204    96     1 yPa
    91   200    91     2 rDDy
    92   200    91     6 rHRDYGTr
    94   208    99     1 rVr
    94   212   104     2 yNSs
    95   207   100     6 rDPPYDSs
    96   207    99     6 rDPPYDSs
    97   208    99     4 kGERWl
    98   208   118     6 kAVVRGVi
    98   212   128     1 yYy
   102   200    91     2 rSTm
   103   207    99     2 tDQt
   104   207    99     6 rDPPYDSs
   112   200    91     6 rHVRRRAr
   113   200    91     2 rSGd
   114   203    94     2 yRSy
   115   207   100     3 rSYSs
   116   207   100     1 rEy
   116   211   105     1 nNe
   119   208    99     6 rDPVTGSw
   119   212   109     1 yYy
   121   211   102     1 vRg
   125   207   117     7 rDTVRGKFr
   127   200    91     3 rWGGs
   128   208   135     6 sGRSMATl
   129   207   100     4 kDVQGy
   130   207   100     7 rIPPMIVVv
   133   208    99     3 rGDSs
   137   208    99     1 rDt
   144   158    49     2 nNYa
   144   202    95     2 yGYw
   145   200    91     4 rSTVIt
   146   158    49     2 nNYa
   146   200    93     2 rGDg
   147   202    93     1 yRy
   149   207   100     4 kDVQGy
   150   207   100     3 rSYSs
   151   210   102     1 lEv
   152   210   103     1 lEv
   153   207    98     2 tDQt
   154   166    57     2 nNYa
   154   208   101     4 rRGATg
   155   166    57     2 nNYe
   155   208   101     5 rRGSMRs
   156   210   101     2 fGEf
   157   208   118     1 rVt
   161   208   116     6 rPVLLWFr
   162   207    98     6 rHTVRGSw
   162   211   108     1 fPv
   170   207    99     4 kIVASn
   171   210   102     1 vNg
   172   207   100     3 rDSVw
   172   211   107     2 yRQp
   173   207   100     5 rDRGYSp
   174   208    99     7 rAGSDYDFw
   174   212   110     1 yPy
   175   166    57     2 nNYa
   175   208   101     4 rRGGKe
   176   208    99     3 kGKVt
   178   166    57     2 fNYa
   178   208   101     5 rPAQGIy
   191   215   106     1 gGh
   192   207    98     5 tEGDIEi
   193   199    90     1 rHe
   194   200    91     3 rPEGl
   195   208   112     6 kSEGFTDi
   196   165    58     2 fGSt
   196   211   106     1 fGv
   197   207    98     6 tDTPRTSs
   198   207   100     5 fSTSTWp
   199   207    99     5 pLGTTVt
   200   166    57     2 nNYa
   200   208   101     4 rRGASg
   206   166    57     2 nNHa
   207   208    99     2 rERy
   208   208    99     8 kDLGYYGSGs
   212   208    99     6 tDKRHSEg
   213   166    57     1 gSs
   213   209   101     1 hSe
   215   208   118     8 rDTVRGTMLr
   215   212   130     1 fMf
   217   207    98     6 rHSEGKKs
   218   208    99     6 rDTVRGGm
   219   161    52     1 gYa
   219   203    95     1 rPg
   220   210   101     1 wDv
   221   200    91     3 rPEGl
   222   158    49     2 nGYt
   222   200    93     1 rYy
   223   200    91     3 rGTGm
   230   165    58     2 fGSt
   230   211   106     1 fGv
   231   207    98     6 tDTPRTSs
   232   207   100     9 kDQRGIVAVPa
   233   165    58     2 dGGt
   233   207   102     4 tRVGAi
   235   208    99     7 kDGNYFDSv
   235   212   110     1 yYa
   236   208    99     6 aQRSLNVp
   237   208    99     6 aQKSLNVp
   240   208    99     3 lTQSg
   241   208    99     3 vKPDd
   244   205    96     3 kLSRa
   245   208    99     4 kMLSRs
   249   208    99     9 kDSQLRSLLYf
   249   212   112     2 lSQg
   250   208   118     8 tDTVRGTPRv
   250   218   136     1 nPp
   251   208    99     3 rHTVr
   254   208    99     4 rDRPLy
   255   208    99     4 rDPDIl
   256   166    57     2 hNYa
   260   158    49     2 nGYt
   260   202    95     1 lIr
   261   159    50     2 nNYa
   261   201    94     1 nGd
   262   158    49     2 nGYt
   262   200    93     1 rYg
   263   158    49     2 nGYt
   263   200    93     1 rYg
   264   208   134     4 sDWVGf
   270   208    99     2 aGEg
   274   208    99     9 kDSQLRSLLYf
   274   212   112     2 lSQg
   275   208    99     9 kDSQLRSLLYf
   275   212   112     2 lSQg
   276   166    57     1 gNp
   277   166    57     1 gNp
   277   208   100     1 rYt
   279   207    98     9 rDTVRTPEEGv
   279   220   120     1 mGt
   280   208   118     6 rDTVRGSl
   292   208    99     3 rDTVr
   294   207    98     8 rSPVSLVDGw
   295   166    57     2 hNYa
   296   166    57     2 hNYe
   298   207    99     3 kSTAg
   298   211   106     1 cGg
   299   158    49     2 nGYt
   299   200    93     2 rYNa
   302   208    99     6 kDERGRLv
   303   201    92     3 kDREl
   304   201    92     6 rGLSRVTt
   305   166    57     2 nNYe
   306   208    99     8 kDLIGKSDWe
   306   212   111     2 yYHh
   307   207    99     4 rGGDDy
   307   211   107     1 fDv
   309   160    51     2 yQYi
   309   166    59     1 rNy
   309   208   102     3 rDTVr
   310   206   119     6 rDTVRALi
   311   205    96     9 rDTVRACWTLi
   312   163    57     1 sSy
   312   205   100     1 rDt
   313   208    99     3 rDTVr
   314   166    57     1 sSy
   315   208    99     4 rNTVRg
   315   216   111     1 gVa
   316   166    79     1 sSy
   316   208   122     8 rDTVSGTFSq
   320   208    99     4 rDTVRg
   322   204    95     3 kGKVs
   323   166    57     2 nDYt
   323   208   101     2 rDVy
   323   212   107     1 yDy
   324   166    57     2 hNYa
   325   166    57     2 nNYa
   326   166    57     2 hNYa
   327   206    98     6 rAVDIWKn
   328   158    49     2 nGYt
   328   200    93     2 rYNa
   334   165    57     2 dGGt
   334   207   101     2 tDSr
   335   208    99     3 kDPWw
   335   212   106     2 yRYa
   338   208    99     3 rHTVr
   339   208    99     3 rNTVr
   340   206   116     8 rDTVRGSQSl
   341   166    57     1 sSy
   341   208   100     4 rDTVSg
   341   216   112     1 mGt
   342   166    57     1 dGn
   342   208   100     1 rHt
   354   207    98     4 rDLAAa
   355   166    57     2 nDYt
   355   208   101     3 rDYYg
   356   166    57     2 nDYt
   356   208   101     3 rDYYg
   357   166    57     2 nKYt
   357   208   101     4 rNYYGs
   358   166    57     2 nDYt
   358   208   101     2 rYYg
   359   166    57     2 fDYt
   359   208   101     3 rDYYg
   360   166    57     2 yDYt
   360   208   101     3 rDAYy
   361   166    76     2 nNYv
   361   208   120     1 rGy
   361   212   125     2 ySEn
   365   158    49     2 nNYa
   365   200    93     5 rPDNGSq
   372   207   100     9 rAPQYDSSAYy
   372   211   113     1 hVp
   373    31    31     1 sSs
   377   163    54     2 dGGt
   377   205    98     3 yYFDs
   378   204    95    17 kDEFSSTRKNFLTGQSKTf
   379   208    99     6 rEFLLRRn
   380   208    99     9 kDSQLRSLLYf
   380   212   112     2 lSQg
   381   207    98     6 rHTKRVVq
   382   207    98    13 rYTVRGKAVPRGVVw
   388   166    57     1 gSn
   388   208   100     3 rDTVr
   392   207    98     6 rHSEGKKs
   393   166    57     2 nGGt
   394   208    99     3 rIRDt
   395   208    99     9 rDGGHGFCSSa
   396   208    99     5 kGYIWNg
   397   166    57     2 nDYt
   397   208   101     5 rDYYDYp
   398   166    76     2 hDYr
   398   208   120     5 rDADYGn
   399   166    57     2 hNYa
   401   206    98     9 kCAGNSGTQSt
   406   207   100     8 kKWPGTVLAg
   407    31    31     1 sSs
   408   165    56     2 dNYa
   410   205    96     8 kKGSYKGGRk
   411   208    99    14 aDDKKIDYGLGYYSRp
   412   136    27     3 gRATs
   412   208   102     6 aRPVRVDd
   412   212   112     1 lPv
   413   136    27     3 gRASs
   413   208   102     8 vRPVRVDDIs
   417   166    68     1 gSt
   417   208   111    16 rHGEVSPYYEDDYGYFYt
   419   208    99     6 kDRHKTLg
   423   165    56     1 gNd
   423   207    99     6 rDAGPYVs
   424   166    57     1 bGy
   424   208   100     1 rDi
   425   166    57     2 hNYa
   428   207    99     1 iDp
   428   211   104     2 wGGa
   429   206    98     2 kSDa
   430   206    98     5 kCAGTWd
   430   210   107     2 yAAd
   434    31    31     1 sNs
   436   208    99     8 kDTVRSVSPr
   437   208    99    14 kDTVRPRSRCRLRLSa
   437   212   117     2 lSGs
   439   207    98     2 aTDw
   439   211   104     2 lLIk
   440    24    24     1 sSs
   442   160    51     2 rIKt
   442   208   101    14 tDTLRKIVVVPAAMEe
   442   212   119     1 ySs
   444   166    68     1 gSt
   444   208   111    16 rHGEVSPYYEDDYGYFYt
   445    30    51     8 tESILVTTLq
   446   208    99    13 kDSQLRSLLYFDWLs
   447   204    95    17 rDTVRGRPTAQRAVPGAGa
   447   208   116     2 gGRe
   448   208    99    14 aDTVRGNVWAPEEVSe
   448   212   117     1 fDs
   449   160    51     2 yQYi
   449   166    59     1 rNy
   449   208   102     8 rDTVLTLQVl
   449   215   117     1 eSt
   451   166    76     2 nSYt
   451   208   120     5 rDTVRGv
   452   208    99     6 rDTVRGGl
   455   208    99     6 gHTGGHIl
   455   212   109     1 tEa
   456   164    56     1 gNd
   456   206    99     6 rDAGPYVs
   457   165    56     1 aSn
   457   207    99     1 rFr
   457   211   104     1 fVq
   459   207    99     7 kCATDWGSc
   469   166    76     2 wSGr
   469   208   120    12 rPYDSRCWGGWLYh
   471   207    99     5 rDGGSGw
   474   160    51     2 rIKs
   474   208   101    14 tGITMIIVVITTSSKr
   476   136    27     3 gRTFs
   476   208   102     5 vRPVRVd
   476   212   111     2 sTPd
   477   136    27     2 gFSf
   477   208   101     1 rDt
   478   208   118    15 rDTVRESSERADKNLLi
   479   207   117    15 rDTVRERSERADKNLLi
   480   208   118    12 rDTVRESSERADKn
   481   208   118    15 rDTVRESSERADKNLLs
   484   208    99     5 tGTVREs
   485   166    76     2 nSYt
   485   208   120     5 rDTARGv
   485   221   138     1 nAs
   490   166    76     2 nSYt
   490   208   120     5 rDTARGv
   490   221   138     1 nAs
   491   208   118     9 kDIVSGAIIGh
   492   207    98     9 eTQPPWAIGVh
   493   165    56     1 sSl
   493   207    99     6 rVTPAAAs
   494   160    51     1 gRl
   494   207    99     4 rLSVTa
   495   160    51     1 wRv
   495   210   102     1 vSt
   498   205    97     2 kAAg
   498   209   103     2 iCLn
   500    31    31     1 sNs
   501    31    31     1 sNs
   503    31    51     1 sSs
   504    31    51     1 sSs
   506   166    76     2 ySGs
   506   208   120    13 rGVSYCYSFGAYCYd
   509    31    53     1 rSs
   511   191    82    12 rDGGHIVAVPTAVl
   513   207    98     2 aSHw
   513   211   104     2 lLIk
   515    31    33     1 sSs
   516    31    33     1 sSs
   518   136    27     3 gRTSh
   518   208   102    10 aRTVRVVDISSp
   519   136    27     3 gRTSh
   519   208   102    10 aRTVRVVDISSp
   520   136    27     3 gRTSh
   520   208   102    10 vRTVRVVDISSp
   521    31    50     6 lNSSNQKn
   522    31    31     1 sSn
   523    31    31     1 sSg
   525   136    27     2 gFSf
   525   206    99     1 rDt
   526   207   117    15 gDTVRESSERADKNLLs
   527   208   118    15 rDTVRESSERADKNLLs
   528   208    99    13 kDSQLRSLLYFEWLs
   530   208   118     7 kAVPGGVVq
   533   208    99     4 iGTVRe
   534    30    51     4 tPSSYs
   537   208   118    15 rDTVRESSERADKNLLs
   538   208   118    15 rDTVRESSERADKNLLs
   540   165    56     1 sAi
   540   207    99     3 rTRPg
   543    97    97     1 sTm
   545   207    99     9 rLATTSHTYCg
   545   211   112     1 yPs
   546   207    99     7 kGSVGWANt
   547   207    99     9 rLATTSHTYCg
   547   211   112     1 yPs
   548   163    55     2 dSAk
   548   205    99     3 kCIAg
   548   209   106     2 wTAs
   549   208   118    15 rDTVRESSERADKNLLi
   550    31    31     1 sSg
   551    31    31     1 sRg
   552    31    31     4 sTSGYs
   553    31    31     4 sAFGYs
   560   165    57     2 yGGt
   560   207   101    14 rDQDCTNGVCYTFGVe
   563   205    96     2 lRRd
   564   208   118    16 rGKWVPAGPTSTSGPVRh
   567    31    31     4 sTSGYs
   569    23    23     1 sSn
   572   136    27     3 gRTSh
   572   208   102    10 aRTVRVVDISSp
   573   136    27     3 gRTSh
   573   208   102    10 aRTVRVVDISSp
   574    31    31     6 lYSSNQKn
   575    31    31     6 lYSSNQKn
   576   166    57     2 nSYt
   576   208   101     5 kHEHSKt
   577    30    51     8 tESILGITLq
   579   208    99    13 kDSQLRSLLYFEWLs
   580   207    98     6 rYTLRRNr
   581   206    97    15 rHTGDVDEDDDGDYNEd
   582   160    51     1 lIl
   582   208   100    15 rHTVRKRLLPPGAVSRk
   582   212   119     1 fEa
   586    30    51     3 sGSSs
   587    30    51     4 sGSSYs
   587    96   121     1 lPq
   590   208    99     6 kLIAVAGt
   591   206    97     3 rVSDf
   595   208   118    15 rDTVRERSERADKNLLs
   596    31    51     4 tYSGSd
   597   200    91     3 rWVYd
   600    31    35     1 sSs
   602    31    31     4 sTSGYs
   603    31    31     4 sTSGYs
   604    31    51     6 lYSSDNKn
   608    31    31     4 sTSSYn
   609   210   118     1 ySy
   611   208    99     1 rWd
   613    31    51     4 dYDGDs
   614   208    99     1 rGr
   616   208    99    10 aGLLDVQYVRQa
   617    31    50     5 vHSTGNt
   618   209   100     2 yDYg
   619    31    31     6 lYSSNQKn
   620   166    57     2 hNYa
   620   208   101     5 vAQIDNn
   621   208    99     8 tDTLERVGGa
   623   208    99     4 tDTKPw
   626    30    30     4 nAFGSs
   626    96   100     1 lPq
   627    31    49     5 tDSDDDd
   629   208    99     5 aTBBFBw
   630   210   101     1 yYy
   633    31    51     4 tSGSYq
   634    31    51     4 tYSSYq
   635   200    91     3 rEVRr
   636   200    91     3 rDGNy
   637   200    91     4 rDITTv
   638   200    91     4 rLMITh
   639    97    98     2 nVVn
   640    94    97     1 sAv
   641    31    31     4 dNYGIs
   642    31    31     4 dNYGIs
   643    31    31     4 dNSGIs
   644    31    31     4 dSYGNs
   645    31    31     4 dYTGEs
   646    31    31     6 lYSSNSKn
   647    31    51     6 lYSSNNKn
   649    96    96     1 pMl
   651   208    99     3 rSTLs
   652   208    99     3 rSLIt
   653   208    99     1 rSd
   653   212   104     1 yDy
   654   208    99     9 rDRGYYSGSRg
   655   208    99     9 rDRGYYSGSRg
   656   208    99     1 rDk
   657    97    97     1 pLf
   658    22    22     4 dYDGDs
   658    88    92     1 fMy
   659   203    98     2 rALq
   660    28    28     1 rSs
   661    31    51     6 lHSSNKQn
   662    31    31     6 lYSSNQKn
   667    31    51     5 tYSDGDd
   669    28    35     2 ySNn
   671    30    31     4 sTSSYs
   671    96   101     1 lPq
   673   166    76     1 gSt
   674   206    97    10 rDTVRVLLTSVd
   675   204   115     2 rEYa
   679   200    91     4 rFYYGs
   680   200    91     2 rWAp
   680   204    97     1 yGy
   681   200    91     6 rWGYYGSs
   682    31    31     4 dNYDIn
   683    31    51     4 dSYGNs
   684    31    31     4 dSYGNs
   685    31    31     4 dYDGDs
   686    31    31     4 dYDGDs
   687    31    51     6 lYSSNNKn
   688    31    53     1 sSs
   698    31    31     4 sTSNYn
   699   208   118    15 rDFHSKTTSIFGLIPLy
   701   208    99     3 rKDGs
   702   208    99     3 rYDGs
   704   212   105     1 yRr
   707   208    99     6 rGLYVVVp
   708    31    32     6 lYSSNQKn
   709   208   102     2 rGGy
   709   212   108     2 yDLr
   710    31    51     6 lYSGNQKn
   711   136    45     1 gYs
   711   207   117     1 rGy
   712    31    31     5 vHSNGNt
   717    31    33     1 gSs
   718    30    51     4 sDSSYs
   718    96   121     1 lPq
   720    21    23     6 tIKYTVKi
   721   208    99     9 rSGIALGSVAg
   722   212   122     2 yGSs
   723   208    99     1 rDy
   726    31    51     4 tSWGRn
   727   199    90     4 rDGGVw
   728   200    91     3 rKRTg
   729   200    91     6 rAWLRRGr
   730   199    90     4 rNYGSp
   733    31    31     4 dYDGDs
   734    31    31     4 dYDGDs
   735    31    31     4 sTSGYs
   736    31    31     6 lYSSNNKn
   741   211   102     1 yGs
   742   208    99     4 rSLYDy
   743   212   103     2 yGSs
   745    23    23     4 eYYGTs
   746    97    97     1 aGl
   747    31    31     1 sSs
   748    27    27     4 dNYGIs
   749   212   122     2 yDYd
   750    31    31     4 dSYGNs
   751    31    31     4 sTSGYs
   755   206   117     4 tDTVRe
   755   210   125     1 fWa
   762   208   115     7 hPVCLSPSa
   763    31    51     6 ySSSNKKd
   765    31    31     6 yYQSNKKn
   766   212   104     1 yHg
   767   208    99     3 rDTVr
   768    30    51     4 eIYGSn
   771    31    51     4 tSSSYq
   772   200    91     3 rSGYr
   773   199    90     3 rKGGt
   774   199    90     4 rNSGLr
   775    31    31     4 lESGNt
   776    30    30     2 ySNn
   778    31    32     6 lDSGDGNt
   779    31    31     5 vHSNGNt
   780    31    31     1 sGn
   781    31    31     4 vNYGVs
   782    31    31     4 dSYGNs
   784   166    76     1 nQe
   784   208   119    15 rGLSIAVQLSSSSRSPp
   785    31    31     5 lYSNGNt
   787    30    30     5 vHSNGNt
   788   136    27     2 gISi
   789   208    99     1 rEn
   790   208    99     2 rGDy
   791    31    31     4 dSSGHs
   792   207   100     3 rSSFg
   793    31    31     5 lDSDGKt
   794   208   118     2 rLGg
   795    31    31     5 lHSNGFn
   796    31    31     5 vHSNGNt
   798    31    31     5 vHSNGNt
   799    31    31     5 lHSGGKt
   800    31    31    10 gSFGMYFNLVIh
   803    31    33     6 fGSSNQKn
   804    31    31     5 lYCNNKn
   805    31    43     5 lHSNGNt
   806    31    31     5 lHSDGCt
   807    31    35     2 yNNn
   808    97    97     1 iLf
   809    31    31     1 dSn
   810   209   120     1 yVv
   811    31    31     6 fDSSDKKd
   812    31    31     5 lHSNGYt
   813    31    31     5 lHSNRYn
   814   207    99    13 kNDDSGCNADEIDAa
   815   207    98     4 rSVYYg
   816   208   118     2 rYRl
   817   210   101     2 yGYd
   818    31    31     1 sTs
   819    97   117     2 hLPg
   821   200    91     5 rSTYYGs
   822   200    91     3 rVSGq
   823   200    91     5 rSTYNGh
   824   200    91     3 rDDGk
   825   200    91     6 rRDYGVAd
   826   199    90     7 rDRGYYGSs
   827   199    90     6 tRQLGLRr
   828   200    91     5 rHYGSSy
   829   199    90     3 rNREt
   829   203    97     2 yGSr
   830   199    90     3 rANGy
   831   207    99     5 rGRTLLr
   832   200    91     3 rVSGq
   833   200    91     3 rGEWt
   834   199    90     3 rNREi
   834   203    97     2 yGSr
   835   199    90     3 rQGYy
   836   199    90     5 rDDSSGy
   837   199    90     5 rGRALLr
   838   200    91     3 rDGDh
   839   199    90     3 kKYGs
   840   199    90     5 rAYYRYd
   841   199    90     3 rKGGt
   842   200    91     3 nYYGs
   843   199    90     4 rDEVRr
   844   199    90     5 rGRTLLr
   845   207   117     2 rVGa
   845   211   123     1 yPy
   846    28    31     2 yBBb
   847    31    32     2 yENg
   847    97   100     3 sGDSf
   848    94   103     2 nVEn
   849    30    31     1 ySn
   850    31    31     6 ySSKHKVh
   851    31    31     4 lZSBGb
   852    31    31     5 lHSDGFd
   853    31    35     5 lHSNGYn
   854    31    31     5 lHSNGIt
   855    31    31     5 lHSNGNt
   856    31    31     4 dYDGDs
   857    31    31     5 vHSNGNt
   858   201    94     6 kDTVRGHh
   859    31    31     5 vISNGFt
   860    31    31     5 vHSNGNt
   861   209   100     1 yDy
   862   209   100     2 yGSs
   863    30    30     4 dFDGDs
   866   207    98     4 rHYYKy
   867   208    99     2 rRTv
   868    31    33     5 lHSNGNn
   869   160    51     1 wIi
   869   207    99     7 rALTINMAg
   869   211   110     2 fITe
   871   207   117     3 rSFFg
   872    31    31     6 lNSGNQKn
   873    31    31     5 vHSDGNt
   877   208   118    14 aDIMREITFSACQKPw
   878    31    31     5 lHSSGNt
   879    31    31     5 lDSDGYt
   880    31    31     2 yNNn
   880    97    99     1 tDt
   881    65    85    15 gSGSSLVDGIDSRFSSs
   883    31    31     5 lHSGGKt
   884   207   118     9 rGLLRGGWNDv
   885   208    99     5 rGIYYNs
   886   208   118     4 rSHYYg
   887   208   118    14 tDTVRETTFWTCQKLr
   889    31    51     4 tSGSYq
   890   128    19     2 gISi
   890   199    92     1 rLr
   891   200    91     3 rSYRy
   892   199    90     3 rQAYy
   893   199    90     4 rNNPHs
   894   200    91     4 gYGNSl
   895   200    91     8 rPPLLWLRRg
   896   208   118     1 sHw
   897   208   124     1 sHw
   898    96    97     2 bXBk
   899    31    31     5 qQSKGIt
   900    31    31     1 iSn
   901    62    62     2 gSQs
   901    66    68     1 gYt
   904   208    99     1 sYg
   905   210   101     2 lGDg
   907   210   101     2 yDYe
   908   208    99     1 lLa
   909   208    99     4 rSYYGs
   910   208    99     2 rYYd
   911   207    98     3 rLSNw
   912   156    47     1 rIi
   912   203    95     2 sSNw
   913   196    87     2 rSPe
   913   200    93     1 yPa
   914   159    50     2 yINl
   914   205    98     5 rWAIYYg
   915   207    98     2 rHGd
   917   207   117     4 rDENSg
   917   211   125     1 yVg
   918   207   117     4 rGGIYy
   919   206   116     3 rAYRg
   919   210   123     1 yCh
   920   207   117     4 rISSGg
   922    31    35     5 lRSDDYt
   923    31    31     5 lHSNGNt
   924    31    33     5 lDSDGYt
   925    31    31     5 lHSNGNt
   926    31    31     5 lHTDGRt
   927    31    34     6 lDSEDGNt
   928    31    31     5 lGSDGIt
   929    31    40     5 lHSNGNt
   931   199    90     3 rQGYy
   932   199    90     9 rNPITTVVAWa
   933   198    89     6 rHYRYGYd
   934   200    91     8 rKELTTVVAt
   935   200    91     5 rSYDGYs
   936   199    90     5 rDDYYYg
   937   199    90     4 rEEEYi
   938    31    31     5 lHSNGNt
   940    31    31     5 vHSDGNt
   941   208    99     6 rGSFLLWd
   942   212   122     2 fITt
   943   208    99     2 pTVd
   944   208    99     2 pDSn
   945   208    99     6 rTFITTVv
   946   208    99     4 rGLYDg
   947   208    99    10 rSQGGGRIAAAg
   948   208    99     3 iTTVv
   949   207   117     4 rDSGYg
   949   211   125     1 yGc
   950   136    27     1 gYs
   951    31    33     6 lYSFNQKn
   952   136    46     2 gFSi
   952   207   119     6 rHTVRGSh
   953   207   100     3 kGTVr
   954    31    31     8 sESTVFSSVd
   955    31    31     5 eDSYGDt
   956    31    31     5 lHSNGKt
   957   205    97     8 rRDTNSAETy
   958   205    99     7 rESQCRFKs
   959   208    99     2 vRVi
   960   210   120     1 yGn
   961   207   117     8 sVSIYYYGRs
   962   208   118     1 rSd
   963   208    99     4 rWDYEg
   964    97    97     1 fTh
   965   199    90     5 rGRTLLr
   966   199    90     3 kGTGn
   967   199    90     3 kETGn
   968   208   118     5 rAKYIIt
   969    30    30     2 ySNn
   969    57    59     3 gVQQd
   969    79    84     1 qCb
   970    31    31     5 vYRBGBt
   971    31    31     4 nWYGNs
   972    31    31     5 lHSDGNt
   973   136    27     1 gYs
   973   207    99     7 rPLYYRYDe
   974   208   118    11 rEMEITFGGAVSk
   974   212   133     1 yYy
   975    31    31     5 vYSDGNt
   976   208    99     3 rGGGr
   977   207    99     8 kSPNSGAPAg
   978   206    97     1 fTs
   979   208   118     1 rSl
   980   208   118     1 iHy
   980   212   123     1 yGd
   981   208    99     1 rPt
   982   136    46     3 gGSVs
   982   206   119     9 rPGYGDTSVRk
   983   136    27     2 gGSv
   983   207   100     3 rNPYy
   984   207   117     7 rDQPSSGVf
   985   207   117     4 rGDRSi
   985   211   125     2 yGSg
   986    21    30     4 sISSIn
   987    31    50     5 vYSDGNt
   988    31    31     5 vHSNGNs
   989    31    31     6 lDSEDGNt
   990   136    27     2 gFSi
   990   207   100     3 rHSEg
   991   143    53     1 gYw
   991   207   118     4 rGTVRg
   992   208   118     2 rHSe
   993    31    31     6 fYSSDNKd
   994   204   115     4 sTLAGt
   995   136    45     1 gYs
   995   207   117     3 gDNDh
   997   200    91     2 sYYg
   997   204    97     1 yEg
   998   199    90     3 rVEQl
   999   199    90     2 kLIy
   999   203    96     1 yDa
  1000   199    90     2 kLIy
  1000   203    96     1 yDa
  1001   200    91     5 aRGQVTt
  1002   200    91     4 gYGNSl
  1003   200    91     4 pKVRRk
  1004   152    43     2 vISt
  1004   198    91     6 rDDYGSSy
  1005    31    31     5 lYKDGKt
  1006    31    31     5 lYKDGKt
  1007    31    31     5 eYSDGYt
  1008   136    27     1 gYs
  1008   207    99     7 rPLYYRFDe
  1009   136    27     1 gNs
  1009   207    99     7 rPLYFRHDe
  1010   209   100     1 yRy
  1011   208   118    17 kENSAGLLDILSGYFRGWk
  1012   200    91     5 rSNYYGs
  1013    30    30     5 lYSNGKt
  1014   129    20     2 gGSi
  1014   200    93     5 rRVVGVd
  1015   128    19     2 gDSv
  1015   158    51     1 qWf
  1015   200    94     2 rLVg
  1016   207    98     3 rEWGs
  1017   207   117     3 rCSSe
  1017   211   124     2 wHAt
  1018   207   117     4 gGWSWa
  1019   207   117     2 rFGs
  1019   211   123     2 aAAd
  1020   211   121     2 yGKf
  1021   207   117     7 kNGYRDGAg
  1021   211   128     2 yGPg
  1022    31    31     5 vYSDGNt
  1023    30    31     6 lSSGNQKn
  1024   207   117     8 iVTVYDIVLn
  1025   208   118     2 rDTv
  1026   205   114     3 tSTPh
  1027   207   100     8 rDTHFQKAMl
  1028   136    41     2 gYSi
  1028   206   113     8 rHSEVTTYIh
  1029   143    53     1 yCw
  1029   207   118     9 rDTVRGKAGTw
  1030    31    31     6 fYSGNNKh
  1031    31    31     5 lHSNRYt
  1032   166    57     1 sAh
  1032   208   100    15 rDTVRKGDVKPIVSEEr
  1033   201    94     6 rQGTGLVh
  1034   133    24     2 gFSi
  1035   136    46     2 gGSi
  1035   207   119     2 rLGm
  1036   136    27     1 gYs
  1036   207    99     4 vFGYDm
  1037   135    45     2 dFSi
  1038   207    98     8 rGEIVVVPAa
  1038   211   110     1 yYy
  1039   160    51     1 nId
  1039   207    99     6 vIYYGNSp
  1040   133    24     2 gASi
  1040   204    97     9 rQSIDFWSGSk
  1041   165    56     1 sDg
  1041   207    99     8 rGSTMITNGh
  1042   128    19     2 gDSv
  1042   158    51     1 kWy
  1042   200    94     2 sGGp
  1042   204   100     1 yHy
  1043   207    98     2 rQAd
  1044   207   117     8 rDTSARSGYa
  1045   207   117     2 rTWy
  1045   211   123     2 cACg
  1046   207   117     8 rDYSGCGRSa
  1047   207    98     5 rNVYDSl
  1048   207    98     5 rNVYDSl
  1049   136    38     1 gAs
  1049   207   110    12 rEETYYEDDYDYYy
  1049   211   126     2 fGYh
  1050   208   110    12 kVTQHEEYYEDDDg
  1050   212   126     2 yTSa
  1051    29    29    20 kHSDGKTYLNWLLQKPGQDGDd
  1052   207   117     1 kDt
  1053    31    31     5 lHSNGYt
  1055   199    94     1 rIt
  1055   203    99     1 yLg
  1056   199    94     3 rGHTg
  1056   203   101     2 yLKs
  1057    24    30     2 yNNn
  1058   200    91     6 rGGGSTMi
  1059   200    91     5 tDIYYDy
  1060   200    91     4 rHEANw
  1061   212   105     1 yGq
  1062   160    51     2 dINp
  1062   206    99     8 rDYTYYTYDe
  1063   136    27     2 gFSl
  1063   207   100     4 hRKSGd
  1064   208    99     2 rGEv
  1065   196    87     9 rVRGGYYGSSs
  1066   133    24     2 gYSv
  1066   204    97     9 rQSIDFWSGSk
  1067   133    24     2 gASi
  1067   204    97     9 rQSIDFWSGSk
  1068   128    19     2 gDSv
  1068   158    51     1 kWy
  1068   200    94     4 sGAMVr
  1069   128    19     2 gDSv
  1069   158    51     1 rWy
  1069   200    94     5 rDGAHDl
  1070   136    27     2 gRSi
  1070   207   100     7 rHLGHCRGv
  1070   211   111     1 yRn
  1071   136    27     2 gRSi
  1071   207   100     7 rHLGHCRGv
  1071   211   111     1 yRn
  1072   207   117     1 rDg
  1072   211   122     1 wAs
  1073   207   117     5 rDIDGTv
  1074   207   117     9 tCLYRSCHTNg
  1075   207   117    10 rRTFSGGGFAVg
  1076   208   110    13 kDDVGTPKYYEDDYg
  1076   212   127     2 yDVg
  1077   207   117     7 rETTPEEGv
  1077   220   137     1 mGt
  1078   136    46     2 gFSi
  1078   207   119     9 rDTVKGRAAGg
  1079   208   118     1 rHs
  1079   217   128     1 mGt
  1080   136    46     2 gYSi
  1080   206   118     7 rGTVSYAAr
  1081   136    46     2 gFSi
  1081   207   119     2 rDTv
  1082    31    31     5 vDSDGDt
  1083   160    51     1 gIv
  1083   207    99     1 gGy
  1084   136    27     2 gFSl
  1084   207   100     6 rVVNSVMa
  1084   211   110     1 yYy
  1085   200   114     5 sGANIEn
  1086   163    57     1 wDr
  1086   205   100     8 rDRQSPQCGe
  1087   199    90     6 rITTIVVt
  1088   128    19     2 gYSi
  1088   198    91     3 rDQLl
  1089   128    19     2 gISi
  1089   199    92     3 rDRTi
  1090    31    31     5 lSSKGIt
  1090    97   102     3 sHSVt
  1091   136    27     1 gYs
  1091   207    99     9 rLIPFSDGYYe
  1092   136    27     2 gDSv
  1092   166    59     1 kWy
  1092   208   102     4 rDLELl
  1093   208   117     4 rRGDGs
  1094   136    27     2 gFSl
  1094   207   100     3 rRGGk
  1095   128    19     2 gDSv
  1095   158    51     1 kWl
  1095   202    96     2 lXGl
  1096   207    98     7 rNAGGDGFs
  1097   209   101     1 lDp
  1098   204    98    10 rYTVTEQTNFLy
  1099   136    46     2 gFSi
  1099   207   119     4 rDTVRg
  1099   211   127     2 yQNh
  1100   207    98     9 rNTAEGGGREg
  1101   207   117     1 rDt
  1102    31    31     5 lHSDGKt
  1103   208    99    12 kDTSTCIEINSMAi
  1104   208   118     4 kDTGIf
  1104   212   126     1 ySg
  1105    31    31     5 lYSNGLt
  1106   160    51     2 qIPl
  1106   206    99     6 rEYGFDTs
  1107    31    31     5 lHSDGNt
  1108    31    31     5 lHSNGNt
  1109   128    19     2 gDSv
  1109   158    51     1 kWy
  1109   200    94     1 rQm
  1110   127    19     2 gDSv
  1110   157    51     1 tWy
  1110   199    94     5 rDMGGSg
  1111   128    19     2 gDSv
  1111   158    51     1 kWy
  1111   200    94     2 rDTv
  1112   128    19     2 gDSv
  1112   158    51     1 kWy
  1112   200    94     2 kGGv
  1113   128    19     2 gGSv
  1113   158    51     1 kWy
  1114   128    19     2 gDSv
  1114   158    51     1 kWy
  1115   128    19     2 gDSv
  1115   158    51     1 kWy
  1115   200    94     2 rDEr
  1116   128    19     2 gDSv
  1116   158    51     1 kWy
  1117   128    19     2 gDSv
  1117   158    51     1 kWy
  1117   200    94     3 rKVSl
  1118   207   117     6 sFYAREYi
  1119   207   117    10 tRNGGYYSRGAv
  1120   136    27     2 gFSl
  1121   136    38     2 gGSi
  1121   206   110    16 rIDVVITSHEDDFGDYYt
  1122   205    97     7 rLTIAHSPt
  1122   213   112     1 iLt
  1123   204    98     9 rGTVTEQNEEl
  1123   211   114     1 gGl
  1124   207   117     3 kDTVr
  1125   136    27     2 gSSi
  1125   207   100     1 rGt
  1126   207   117     1 kGt
  1127   207    98     7 rHTVRGSLl
  1128   136    27     2 gYSi
  1128   207   100     4 rDTVRg
  1129   206    98     4 rVSYDf
  1130   136    27     2 gFSl
  1130   204    97     6 rITVIPAp
  1131   136    27     2 gFSl
  1131   160    53     1 wDi
  1131   206   100     2 rSCg
  1132   209   100     2 lIAg
  1133    24    30     2 yNSn
  1134   207    99     1 rHt
  1134   211   104     1 ySf
  1137   200    91     7 rEGGSYHGs
  1138   135    26     1 yAw
  1138   199    91     6 rGDGNSRr
  1139   135    47     2 gDSv
  1139   146    60    29 vSSKWYRQYAPSLQSRLVTDPDTSKNQFSLq
  1140    31    31     5 vYSDGKt
  1141   136    27     2 gGSi
  1141   160    53     2 sLYy
  1141   166    61     2 ySGs
  1141   208   105     6 sPTHCSGg
  1142   124    15     3 gDSVs
  1142   153    47     1 kWy
  1142   195    90     5 rDMGGSg
  1143   208   118     4 rDTVRg
  1144   207   117    15 kHTVRGRAGAEGGGREg
  1145   207   117     4 kDTVSt
  1146   208   118     6 kDTVRGRs
  1146   212   128     2 fPTc
  1147   135    27     2 gGPi
  1147   206   100    13 rGNPPPYYDIGTGSd
  1148   200    91     7 rEGGSYHGs
  1149   136    27     1 cTl
  1149   149    41     2 aGSi
  1149   196    90     6 rHYRYGYd
  1150    24    30     2 iASn
  1150    58    66     2 gSId
  1151   136    27     2 gYSi
  1151   206    99     8 rGPFYYYDGg
  1152   128    19     3 gDSVs
  1152   151    45     1 rTl
  1152   199    94     7 rGAMTTVVt
  1153   128    19     2 gDSv
  1153   158    51     1 kWs
  1153   200    94     6 gGPGVIPa
  1154    20    29     1 sSy
  1154    34    44     2 pWYl
  1154    47    59     2 gDGi
  1155   201    92     6 rDTVRREg
  1156   136    27     2 eFSi
  1156   207   100     7 rHSENQRHs
  1157    24    30     2 iGSy
  1157    58    66     2 gSKs
  1158   136    27     2 gSSi
  1158   207   100     8 rGTVKGRRRk
  1159   160    51     1 sPa
  1159   207    99     7 rEWKGQVNv
  1160   208    99    10 rGAHYSDTDDSg
  1161   136    27     2 gFSl
  1161   207   100     2 qINp
  1162   208   118    13 rHRAVAGGDSDHDEn
  1163    24    28     2 iASn
  1163    58    64     1 aSi
  1163    62    69     1 sSn
  1164   136    30     2 gDSv
  1164   166    62     1 kWy
  1164   208   105    12 rDTVRGSQWTVSLc
  1165   208   118    17 rHSEESSPGAGAEGGGREe
  1166   136    27     2 gLSl
  1166   160    53     1 wLl
  1166   207   101     4 hRHPRt
  1167   128    19     3 gDSVs
  1167   157    51     1 kRy
  1167   200    95     2 ySSg
  1168   208    99    12 rDTVRGNQRIGLVw
  1169    21    30     2 iGSy
  1169    55    66     2 gSId
  1170   127    18     2 gDSv
  1170   136    29     2 nCIr
  1170   155    50     1 kWy
  1170   197    93     9 sTTLNWGYEKd
  1171   136    27     2 gGSv
  1171   204    97     7 rDSVERASe
  1172   161    52     1 yRk
  1172   171    63     1 gIq
  1173   136    27     2 gFSl
  1173   207   100     9 hRPPWRFTGNl
  1174   136    46     2 gLSv
  1174   207   119    12 rMQVTMVREVMITs
  1175   136    52     2 gDRv
  1175   166    84     1 kWc
  1175   208   127    15 pAPLNQQLGEVRAGSEa
  1176   136    27     2 gGTv
  1176   204    97    14 rHTVTRSEAGTGTKRd
  1177    28    47     2 mGSy
  1177    57    78    13 gTGFTDRFKPSRDTs
  1177    87   121     1 aTf
//