Complet list of 1dl2 hssp fileClick here to see the 3D structure Complete list of 1dl2.hssp file
PDBID      1DL2
THRESHOLD  according to: t(L)=(290.15 * L ** -0.562) + 5
REFERENCE  Sander C., Schneider R. : Database of homology-derived protein structures. Proteins, 9:56-68 (1991).
CONTACT    Maintained at by Maarten L. Hekkelman 
DATE       file generated on 2014-04-12
HEADER     HYDROLASE                               08-DEC-99   1DL2
DBREF      1DL2 A   34   366  UNP    P32906   MNS1_YEAST      34    366
DBREF      1DL2 A  372   549  UNP    P32906   MNS1_YEAST     372    549
NCHAIN        1 chain(s) in 1DL2 data set
NALIGN      160
NOTATION : ID: EMBL/SWISSPROT identifier of the aligned (homologous) protein
NOTATION : STRID: if the 3-D structure of the aligned protein is known, then STRID is the Protein Data Bank identifier as taken
NOTATION : from the database reference or DR-line of the EMBL/SWISSPROT entry
NOTATION : %IDE: percentage of residue identity of the alignment
NOTATION : %SIM (%WSIM):  (weighted) similarity of the alignment
NOTATION : IFIR/ILAS: first and last residue of the alignment in the test sequence
NOTATION : JFIR/JLAS: first and last residue of the alignment in the alignend protein
NOTATION : LALI: length of the alignment excluding insertions and deletions
NOTATION : NGAP: number of insertions and deletions in the alignment
NOTATION : LGAP: total length of all insertions and deletions
NOTATION : LSEQ2: length of the entire sequence of the aligned protein
NOTATION : ACCNUM: SwissProt accession number
NOTATION : PROTEIN: one-line description of aligned protein
NOTATION : SeqNo,PDBNo,AA,STRUCTURE,BP1,BP2,ACC: sequential and PDB residue numbers, amino acid (lower case = Cys), secondary
NOTATION : structure, bridge partners, solvent exposure as in DSSP (Kabsch and Sander, Biopolymers 22, 2577-2637(1983)
NOTATION : VAR: sequence variability on a scale of 0-100 as derived from the NALIGN alignments
NOTATION : pair of lower case characters (AvaK) in the alignend sequence bracket a point of insertion in this sequence
NOTATION : dots (....) in the alignend sequence indicate points of deletion in this sequence
NOTATION : SEQUENCE PROFILE: relative frequency of an amino acid type at each position. Asx and Glx are in their
NOTATION : acid/amide form in proportion to their database frequencies
NOTATION : NOCC: number of aligned sequences spanning this position (including the test sequence)
NOTATION : NDEL: number of sequences with a deletion in the test protein at this position
NOTATION : NINS: number of sequences with an insertion in the test protein at this position
NOTATION : ENTROPY: entropy measure of sequence variability at this position
NOTATION : RELENT: relative entropy, i.e.  entropy normalized to the range 0-100
NOTATION : WEIGHT: conservation weight

## PROTEINS : identifier and alignment statistics
    1 : A6ZQ86_YEAS7        0.99  0.99    1  511   34  549  516    2    6  549  A6ZQ86     Alpha-mannosidase OS=Saccharomyces cerevisiae (strain YJM789) GN=MNS1 PE=4 SV=1
    2 : B3LQL3_YEAS1        0.99  0.99    1  511   34  549  516    2    6  549  B3LQL3     Lpha-mannosidase OS=Saccharomyces cerevisiae (strain RM11-1a) GN=SCRG_03781 PE=4 SV=1
    3 : B5VLS0_YEAS6        0.99  0.99    1  511   34  549  516    2    6  549  B5VLS0     YJR131Wp-like protein OS=Saccharomyces cerevisiae (strain AWRI1631) GN=AWRI1631_103120 PE=4 SV=1
    4 : C7GM82_YEAS2        0.99  0.99    1  511   34  549  516    2    6  549  C7GM82     Mns1p OS=Saccharomyces cerevisiae (strain JAY291) GN=MNS1 PE=4 SV=1
    5 : C8ZBS9_YEAS8        0.99  0.99    1  511   34  549  516    2    6  549  C8ZBS9     Mns1p OS=Saccharomyces cerevisiae (strain Lalvin EC1118 / Prise de mousse) GN=EC1118_1J19_0837g PE=4 SV=1
    6 : E7LWJ1_YEASV        0.99  0.99    1  511   34  549  516    2    6  549  E7LWJ1     Mns1p OS=Saccharomyces cerevisiae (strain VIN 13) GN=VIN13_2720 PE=4 SV=1
    7 : H0GIX3_9SACH        0.99  0.99    1  511   34  549  516    2    6  549  H0GIX3     Mns1p OS=Saccharomyces cerevisiae x Saccharomyces kudriavzevii VIN7 GN=VIN7_2780 PE=4 SV=1
    8 : MNS1_YEAST  1G6I    0.99  0.99    1  511   34  549  516    2    6  549  P32906     Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=MNS1 PE=1 SV=1
    9 : N1P1S7_YEASC        0.99  0.99    1  511   34  549  516    2    6  549  N1P1S7     Mns1p OS=Saccharomyces cerevisiae (strain CEN.PK113-7D) GN=CENPK1137D_1426 PE=4 SV=1
   10 : E7NJK0_YEASO        0.98  0.99    1  511   34  549  516    2    6  549  E7NJK0     Mns1p OS=Saccharomyces cerevisiae (strain FostersO) GN=FOSTERSO_2685 PE=4 SV=1
   11 : G2WHD3_YEASK        0.98  0.99    1  511   34  549  516    2    6  549  G2WHD3     K7_Mns1p OS=Saccharomyces cerevisiae (strain Kyokai no. 7 / NBRC 101557) GN=K7_MNS1 PE=4 SV=1
   12 : H0GX64_9SACH        0.84  0.94    1  511   36  551  516    2    6  551  H0GX64     Mns1p OS=Saccharomyces cerevisiae x Saccharomyces kudriavzevii VIN7 GN=VIN7_8146 PE=4 SV=1
   13 : W0TBX8_KLUMA        0.64  0.79    4  509   33  546  514    6    9  548  W0TBX8     Endoplasmic reticulum mannosyl-oligosaccharide 1 OS=Kluyveromyces marxianus DMKU3-1042 GN=KLMA_40509 PE=4 SV=1
   14 : W0VN44_ZYGBA        0.64  0.80    1  510   31  539  513    3    8  540  W0VN44     Probable Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Zygosaccharomyces bailii ISA1307 GN=ZbMNS1 PE=4 SV=1
   15 : G8ZSQ0_TORDC        0.63  0.82    1  510   33  544  513    3    5  545  G8ZSQ0     Uncharacterized protein OS=Torulaspora delbrueckii (strain ATCC 10662 / CBS 1146 / NBRC 0425 / NCYC 2629 / NRRL Y-866) GN=TDEL0D00600 PE=4 SV=1
   16 : H2AW30_KAZAF        0.63  0.81    9  511   36  548  514    7   13  548  H2AW30     Uncharacterized protein OS=Kazachstania africana (strain ATCC 22294 / BCRC 22015 / CBS 2517 / CECT 1963 / NBRC 1671 / NRRL Y-8276) GN=KAFR0E04290 PE=4 SV=1
   17 : S6EVW5_ZYGBA        0.63  0.79    1  510   31  539  513    3    8  540  S6EVW5     ZYBA0S10-04500g1_1 OS=Zygosaccharomyces bailii CLIB 213 GN=BN860_04500g PE=4 SV=1
   18 : W0W2K8_ZYGBA        0.63  0.80    1  510   31  539  513    3    8  540  W0W2K8     Probable Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Zygosaccharomyces bailii ISA1307 GN=ZbMNS1 PE=4 SV=1
   19 : A7TG46_VANPO        0.62  0.80    1  511   36  556  521    4   11  556  A7TG46     Putative uncharacterized protein OS=Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294) GN=Kpol_1028p79 PE=4 SV=1
   20 : C5DRG9_ZYGRC        0.62  0.79    1  510   31  542  514    4    7  543  C5DRG9     ZYRO0B08360p OS=Zygosaccharomyces rouxii (strain ATCC 2623 / CBS 732 / NBRC 1130 / NCYC 568 / NRRL Y-229) GN=ZYRO0B08360g PE=4 SV=1
   21 : G0WHA1_NAUDC        0.61  0.76    6  511   78  606  531   11   28  606  G0WHA1     Uncharacterized protein OS=Naumovozyma dairenensis (strain ATCC 10597 / BCRC 20456 / CBS 421 / NBRC 0211 / NRRL Y-12639) GN=NDAI0J02870 PE=4 SV=1
   22 : G8BZR0_TETPH        0.61  0.77    1  511   47  567  521    4   11  567  G8BZR0     Uncharacterized protein OS=Tetrapisispora phaffii (strain ATCC 24235 / CBS 4417 / NBRC 1672 / NRRL Y-8282 / UCD 70-5) GN=TPHA0L00320 PE=4 SV=1
   23 : A7WPD8_KLUDE        0.60  0.79    6  511   38  546  513    7   12  553  A7WPD8     Alpha-1,2-mannosidase OS=Kluyveromyces delphensis GN=mns1 PE=4 SV=1
   24 : C5DFU0_LACTC        0.60  0.78    6  511   31  543  516    8   14  543  C5DFU0     KLTH0D17908p OS=Lachancea thermotolerans (strain ATCC 56472 / CBS 6340 / NRRL Y-8284) GN=KLTH0D17908g PE=4 SV=1
   25 : G0VL06_NAUCC        0.60  0.77    9  511   46  565  526   13   30  565  G0VL06     Uncharacterized protein OS=Naumovozyma castellii (strain ATCC 76901 / CBS 4309 / NBRC 1992 / NRRL Y-12630) GN=NCAS0J02160 PE=4 SV=1
   26 : J7RHS8_KAZNA        0.59  0.78    4  511   78  596  520   10   14  596  J7RHS8     Uncharacterized protein OS=Kazachstania naganishii (strain ATCC MYA-139 / BCRC 22969 / CBS 8797 / CCRC 22969 / KCTC 17520 / NBRC 10181 / NCYC 3082) GN=KNAG0B06730 PE=4 SV=1
   27 : Q6CWG3_KLULA        0.59  0.77    9  511   38  551  516    8   16  551  Q6CWG3     KLLA0B04356p OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) GN=KLLA0B04356g PE=4 SV=1
   28 : I2GZ88_TETBL        0.56  0.74    7  511   39  578  541    9   38  580  I2GZ88     Uncharacterized protein OS=Tetrapisispora blattae (strain ATCC 34711 / CBS 6284 / DSM 70876 / NBRC 10599 / NRRL Y-10934 / UCD 77-7) GN=TBLA0B06140 PE=4 SV=1
   29 : Q6FK76_CANGA        0.55  0.77    1  509   29  542  515    5    8  547  Q6FK76     Similar to uniprot|P32906 Saccharomyces cerevisiae YJR131w MNS1 alpha1 2-mannosidase OS=Candida glabrata (strain ATCC 2001 / CBS 138 / JCM 3761 / NBRC 0622 / NRRL Y-65) GN=CAGL0M00528g PE=4 SV=1
   30 : I6ND02_ERECY        0.54  0.73    1  511   60  576  518    6    9  579  I6ND02     Uncharacterized protein OS=Eremothecium cymbalariae (strain CBS 270.75 / DBVPG 7215 / KCTC 17166 / NRRL Y-17582) GN=Ecym_5170 PE=4 SV=1
   31 : C4Y8F7_CLAL4        0.52  0.70    4  500  114  586  504   13   39  671  C4Y8F7     Putative uncharacterized protein OS=Clavispora lusitaniae (strain ATCC 42720) GN=CLUG_04485 PE=4 SV=1
   32 : Q756T8_ASHGO        0.52  0.71    1  511   39  552  518    7   12  552  Q756T8     AER165Wp OS=Ashbya gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056) GN=AER165W PE=4 SV=1
   33 : A5DN65_PICGU        0.51  0.72    7  502   70  539  501   12   37  603  A5DN65     Putative uncharacterized protein OS=Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324) GN=PGUG_04716 PE=4 SV=2
   34 : F2QS32_PICP7        0.51  0.71    7  495   46  513  498   12   40  534  F2QS32     Mannosyl-oligosaccharide alpha-1,2-mannosidase OS=Komagataella pastoris (strain ATCC 76273 / CBS 7435 / CECT 11047 / NRRL Y-11430 / Wegner 21-1) GN=MNS1 PE=4 SV=1
   35 : G8B670_CANPC        0.51  0.70    9  498  101  572  500   12   39  646  G8B670     Putative uncharacterized protein OS=Candida parapsilosis (strain CDC 317 / ATCC MYA-4646) GN=CPAR2_110370 PE=4 SV=1
   36 : G8Y9W6_PICSO        0.51  0.69    9  504   84  554  504   15   42  628  G8Y9W6     Piso0_003924 protein OS=Pichia sorbitophila (strain ATCC MYA-4447 / BCRC 22081 / CBS 7064 / NBRC 10061 / NRRL Y-12695) GN=Piso0_003924 PE=4 SV=1
   37 : H8X2C5_CANO9        0.51  0.70   11  498  103  572  498   12   39  648  H8X2C5     Mns1 alpha-1,2-mannosidase OS=Candida orthopsilosis (strain 90-125) GN=CORT_0B11480 PE=4 SV=1
   38 : K0KSR8_WICCF        0.51  0.69    4  500  111  579  503   13   41  688  K0KSR8     Mannosyl-oligosaccharide alpha-1,2-mannosidase OS=Wickerhamomyces ciferrii (strain F-60-10 / ATCC 14091 / CBS 111 / JCM 3599 / NBRC 0793 / NRRL Y-1031) GN=MNS1 PE=4 SV=1
   39 : M9N1A6_ASHG1        0.51  0.71    1  511   39  552  518    7   12  552  M9N1A6     FAER165Wp OS=Ashbya gossypii (strain FDAG1) GN=FAGOS_FAER165W PE=4 SV=1
   40 : Q6BSF5_DEBHA        0.51  0.70    4  502   37  511  506   12   39  590  Q6BSF5     DEHA2D09218p OS=Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / JCM 1990 / NBRC 0083 / IGC 2968) GN=DEHA2D09218g PE=4 SV=1
   41 : A3LX59_PICST        0.50  0.70    8  496   87  551  497   14   41  636  A3LX59     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545) GN=MNS1 PE=4 SV=2
   42 : C4R1N0_PICPG        0.50  0.71    7  495   46  513  498   12   40  534  C4R1N0     Alpha-1,2-mannosidase involved in ER quality control OS=Komagataella pastoris (strain GS115 / ATCC 20864) GN=PAS_chr2-1_0753 PE=4 SV=1
   43 : C4YER0_CANAW        0.50  0.69    9  498   92  562  500   13   40  615  C4YER0     Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Candida albicans (strain WO-1) GN=CAWG_01018 PE=4 SV=1
   44 : C5ME59_CANTT        0.50  0.69    9  498   98  568  500   13   40  644  C5ME59     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Candida tropicalis (strain ATCC MYA-3404 / T1) GN=CTRG_04351 PE=4 SV=1
   45 : G3BEN0_CANTC        0.50  0.71    9  500   40  507  498   11   37  563  G3BEN0     Putative uncharacterized protein MNS1 OS=Candida tenuis (strain ATCC 10573 / BCRC 21748 / CBS 615 / JCM 9827 / NBRC 10315 / NRRL Y-1498 / VKM Y-70) GN=MNS1 PE=4 SV=1
   46 : Q59VQ7_CANAL        0.50  0.69    9  498   92  562  500   13   40  615  Q59VQ7     Putative uncharacterized protein MNS1 OS=Candida albicans (strain SC5314 / ATCC MYA-2876) GN=MNS1 PE=4 SV=1
   47 : R9XG06_ASHAC        0.50  0.72    1  511   39  552  518    7   12  552  R9XG06     AaceriAER165Wp OS=Ashbya aceri GN=AACERI_AaceriAER165W PE=4 SV=1
   48 : W1QB22_OGAPD        0.50  0.68   40  500    1  440  471   13   42  528  W1QB22     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Ogataea parapolymorpha (strain DL-1 / ATCC 26012 / NRRL Y-7560) GN=HPODL_01630 PE=4 SV=1
   49 : A5DVE8_LODEL        0.49  0.69    8  498   85  559  504   14   43  569  A5DVE8     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239) GN=LELG_01334 PE=4 SV=1
   50 : B9W7E8_CANDC        0.49  0.69    9  498   42  512  500   13   40  565  B9W7E8     Mannosyl-oligosaccharide 1,2-alpha-mannosidase, putative OS=Candida dubliniensis (strain CD36 / ATCC MYA-646 / CBS 7987 / NCPF 3949 / NRRL Y-17841) GN=CD36_03470 PE=4 SV=1
   51 : M3JUZ1_CANMX        0.49  0.69    9  498   37  508  500   13   39  585  M3JUZ1     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Candida maltosa (strain Xu316) GN=G210_3016 PE=4 SV=1
   52 : MNS1_CANAX          0.49  0.68    9  498   42  512  500   13   40  565  Q8J0Q0     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Candida albicans GN=MNS1 PE=3 SV=2
   53 : B6K350_SCHJY        0.46  0.65    4  495   72  546  503   15   40  558  B6K350     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Schizosaccharomyces japonicus (strain yFS275 / FY16936) GN=SJAG_03032 PE=4 SV=2
   54 : D5GG24_TUBMM        0.46  0.66    4  500   98  583  520   17   58  619  D5GG24     Whole genome shotgun sequence assembly, scaffold_320, strain Mel28 OS=Tuber melanosporum (strain Mel28) GN=GSTUM_00001932001 PE=4 SV=1
   55 : E9DZM5_METAQ        0.46  0.64    5  500  164  670  530   15   58  695  E9DZM5     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Metarhizium acridum (strain CQMa 102) GN=MAC_03073 PE=4 SV=1
   56 : G4MYZ1_MAGO7        0.46  0.63    6  500  135  642  530   15   58  664  G4MYZ1     Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Magnaporthe oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958) GN=MGG_11408 PE=4 SV=1
   57 : M1VZZ1_CLAP2        0.46  0.64    5  500  165  672  529   12   55  699  M1VZZ1     Related to alpha-mannosidase MNS1 OS=Claviceps purpurea (strain 20.1) GN=CPUR_06848 PE=4 SV=1
   58 : A2RBC3_ASPNC        0.45  0.63    6  498   86  579  521   15   56  603  A2RBC3     Catalytic activity: hydrolysis of the terminal 1 OS=Aspergillus niger (strain CBS 513.88 / FGSC A1513) GN=An18g06220 PE=4 SV=1
   59 : C7YGZ3_NECH7        0.45  0.63    6  500   75  580  528   16   56  618  C7YGZ3     Putative uncharacterized protein OS=Nectria haematococca (strain 77-13-4 / ATCC MYA-4622 / FGSC 9596 / MPVI) GN=NECHADRAFT_105814 PE=4 SV=1
   60 : E3QEH7_COLGM        0.45  0.63    6  500  177  682  529   15   58  703  E3QEH7     Glycosyl hydrolase family 47 OS=Colletotrichum graminicola (strain M1.001 / M2 / FGSC 10212) GN=GLRG_04427 PE=4 SV=1
   61 : E3QPA5_COLGM        0.45  0.64    4  497   72  565  517   14   47  578  E3QPA5     Glycosyl hydrolase family 47 OS=Colletotrichum graminicola (strain M1.001 / M2 / FGSC 10212) GN=GLRG_07837 PE=4 SV=1
   62 : G3JNU2_CORMM        0.45  0.65    5  500  164  671  530   14   57  699  G3JNU2     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Cordyceps militaris (strain CM01) GN=CCM_08185 PE=4 SV=1
   63 : G9NH29_HYPAI        0.45  0.63    4  500  156  663  532   17   60  682  G9NH29     Putative uncharacterized protein OS=Hypocrea atroviridis (strain ATCC 20476 / IMI 206040) GN=TRIATDRAFT_234256 PE=4 SV=1
   64 : H1UYC3_COLHI        0.45  0.63    6  500  178  683  529   15   58  704  H1UYC3     Glycosyl hydrolase family 47 OS=Colletotrichum higginsianum (strain IMI 349063) GN=CH063_05250 PE=4 SV=1
   65 : J3P9X8_GAGT3        0.45  0.63    6  500  142  648  529   14   57  673  J3P9X8     Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Gaeumannomyces graminis var. tritici (strain R3-111a-1) GN=GGTG_10302 PE=4 SV=1
   66 : K3VNA8_FUSPC        0.45  0.63    5  500  143  649  531   16   60  687  K3VNA8     Uncharacterized protein OS=Fusarium pseudograminearum (strain CS3096) GN=FPSE_04589 PE=4 SV=1
   67 : L2FDP5_COLGN        0.45  0.61   40  498    1  459  480   11   43  471  L2FDP5     Mannosyl-oligosaccharide-alpha-mannosidase OS=Colletotrichum gloeosporioides (strain Nara gc5) GN=CGGC5_14117 PE=4 SV=1
   68 : Q0CZR4_ASPTN        0.45  0.65    6  502   78  576  523   13   51  584  Q0CZR4     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Aspergillus terreus (strain NIH 2624 / FGSC A1156) GN=ATEG_00820 PE=4 SV=1
   69 : S7ZUA7_PENOX        0.45  0.62    6  502   73  571  525   15   55  579  S7ZUA7     Putative alpha-mannosidase OS=Penicillium oxalicum 114-2 GN=PDE_09249 PE=4 SV=1
   70 : U9V3E9_RHIID        0.45  0.65    6  495   70  526  495   13   44  540  U9V3E9     Uncharacterized protein OS=Rhizophagus irregularis (strain DAOM 181602 / DAOM 197198 / MUCL 43194) GN=GLOINDRAFT_342669 PE=4 SV=1
   71 : V6QU20_GIBZE        0.45  0.63    5  500  143  649  531   16   60  687  V6QU20     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Gibberella zeae (strain PH-1 / ATCC MYA-4620 / FGSC 9075 / NRRL 31084) GN=FG00612.1 PE=4 SV=1
   72 : G0RCD4_HYPJQ        0.44  0.63    4  500  142  649  531   15   58  676  G0RCD4     Glycoside hydrolase family 47 OS=Hypocrea jecorina (strain QM6a) GN=TRIREDRAFT_2662 PE=4 SV=1
   73 : G1X7N0_ARTOA        0.44  0.66    6  500   76  551  507   16   44  588  G1X7N0     Uncharacterized protein OS=Arthrobotrys oligospora (strain ATCC 24927 / CBS 115.81 / DSM 1491) GN=AOL_s00054g947 PE=4 SV=1
   74 : G2WYU2_VERDV        0.44  0.63    6  500  135  640  529   15   58  658  G2WYU2     Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Verticillium dahliae (strain VdLs.17 / ATCC MYA-4575 / FGSC 10137) GN=VDAG_03184 PE=4 SV=1
   75 : G3Y070_ASPNA        0.44  0.64    6  502   76  572  521   14   49  580  G3Y070     Uncharacterized protein OS=Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7) GN=ASPNIDRAFT_180862 PE=4 SV=1
   76 : G9N6W0_HYPVG        0.44  0.63    4  500  137  644  531   15   58  671  G9N6W0     Glycoside hydrolase family 47 protein OS=Hypocrea virens (strain Gv29-8 / FGSC 10586) GN=TRIVIDRAFT_82921 PE=4 SV=1
   77 : H1VB77_COLHI        0.44  0.64    4  497   86  579  517   14   47  592  H1VB77     Glycosyl hydrolase family 47 OS=Colletotrichum higginsianum (strain IMI 349063) GN=CH063_01708 PE=4 SV=1
   78 : J9MC39_FUSO4        0.44  0.63    5  500  144  650  531   16   60  689  J9MC39     Uncharacterized protein OS=Fusarium oxysporum f. sp. lycopersici (strain 4287 / CBS 123668 / FGSC 9935 / NRRL 34936) GN=FOXG_00435 PE=4 SV=1
   79 : K2RP95_MACPH        0.44  0.64   47  500    1  469  487   12   52  485  K2RP95     Glycoside hydrolase family 47 OS=Macrophomina phaseolina (strain MS6) GN=MPH_08253 PE=4 SV=1
   80 : L2G2S7_COLGN        0.44  0.64    5  500  178  684  531   17   60  705  L2G2S7     Mannosyl-oligosaccharide-alpha-mannosidase OS=Colletotrichum gloeosporioides (strain Nara gc5) GN=CGGC5_7124 PE=4 SV=1
   81 : N1RIL6_FUSC4        0.44  0.63    5  500  144  650  531   16   60  689  N1RIL6     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Fusarium oxysporum f. sp. cubense (strain race 4) GN=FOC4_g10015103 PE=4 SV=1
   82 : N4TEN4_FUSC1        0.44  0.63    5  500  144  650  531   16   60  689  N4TEN4     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Fusarium oxysporum f. sp. cubense (strain race 1) GN=FOC1_g10015730 PE=4 SV=1
   83 : N4VRS4_COLOR        0.44  0.64    6  500  179  684  530   17   60  705  N4VRS4     Mannosyl-oligosaccharide-alpha-mannosidase OS=Colletotrichum orbiculare (strain 104-T / ATCC 96160 / CBS 514.97 / LARS 414 / MAFF 240422) GN=Cob_08055 PE=4 SV=1
   84 : S0DIL9_GIBF5        0.44  0.63    5  500  109  615  529   16   56  654  S0DIL9     Related to alpha-mannosidase MNS1 OS=Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831) GN=FFUJ_01136 PE=4 SV=1
   85 : T0JXZ2_COLGC        0.44  0.64    5  500  178  684  531   17   60  705  T0JXZ2     Glycosyl hydrolase family 47 OS=Colletotrichum gloeosporioides (strain Cg-14) GN=CGLO_15778 PE=4 SV=1
   86 : T5AE05_9HYPO        0.44  0.62    4  498  162  667  529   15   58  697  T5AE05     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Ophiocordyceps sinensis CO18 GN=OCS_03664 PE=4 SV=1
   87 : B2VZK4_PYRTR        0.43  0.63    6  498  120  622  527   13   59  653  B2VZK4     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Pyrenophora tritici-repentis (strain Pt-1C-BFP) GN=PTRG_02844 PE=4 SV=1
   88 : G3YEJ3_ASPNA        0.43  0.61    5  498  145  675  548   13   72  699  G3YEJ3     Putative uncharacterized protein OS=Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7) GN=ASPNIDRAFT_56841 PE=4 SV=1
   89 : M2ZTZ9_MYCFI        0.43  0.64    6  502   83  577  523   14   55  584  M2ZTZ9     Glycoside hydrolase family 47 protein OS=Mycosphaerella fijiensis (strain CIRAD86) GN=MYCFIDRAFT_88410 PE=4 SV=1
   90 : C5GCC5_AJEDR        0.42  0.63    6  502   74  572  524   15   53  579  C5GCC5     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Ajellomyces dermatitidis (strain ER-3 / ATCC MYA-2586) GN=BDCG_02096 PE=4 SV=1
   91 : C5JMT8_AJEDS        0.42  0.63    6  502   74  572  524   15   53  579  C5JMT8     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Ajellomyces dermatitidis (strain SLH14081) GN=BDBG_03796 PE=4 SV=1
   92 : F2T953_AJEDA        0.42  0.63    6  502   74  572  524   15   53  579  F2T953     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Ajellomyces dermatitidis (strain ATCC 18188 / CBS 674.68) GN=BDDG_02707 PE=4 SV=1
   93 : F9FQ39_FUSOF        0.42  0.59    5  500  144  620  531   18   90  659  F9FQ39     Uncharacterized protein OS=Fusarium oxysporum (strain Fo5176) GN=FOXB_08519 PE=4 SV=1
   94 : G2QTX5_THITE        0.42  0.61    6  498   69  565  522   16   55  574  G2QTX5     Glycoside hydrolase family 47 protein OS=Thielavia terrestris (strain ATCC 38088 / NRRL 8126) GN=THITE_2085147 PE=4 SV=1
   95 : N1JJ92_BLUG1        0.42  0.62    6  500   75  581  529   14   57  602  N1JJ92     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Blumeria graminis f. sp. hordei (strain DH14) GN=BGHDH14_bgh00764 PE=4 SV=1
   96 : Q2GYK8_CHAGB        0.42  0.60   26  498    2  486  509   17   61  504  Q2GYK8     Putative uncharacterized protein OS=Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970) GN=CHGG_06946 PE=4 SV=1
   97 : R7Z518_CONA1        0.42  0.62    7  500   92  597  530   15   61  647  R7Z518     Uncharacterized protein OS=Coniosporium apollinis (strain CBS 100218) GN=W97_08552 PE=4 SV=1
   98 : S7ZAH1_PENOX        0.42  0.60    4  498   77  615  556   16   79  639  S7ZAH1     Putative alpha-mannosidase OS=Penicillium oxalicum 114-2 GN=PDE_02548 PE=4 SV=1
   99 : T5BWS6_AJEDE        0.42  0.63    6  502   74  572  524   15   53  581  T5BWS6     Mannosyl-oligosaccharide alpha-1,2-mannosidase OS=Ajellomyces dermatitidis ATCC 26199 GN=BDFG_04742 PE=4 SV=1
  100 : A1DM78_NEOFI        0.41  0.59    5  498  141  695  572   17   96  707  A1DM78     Mannosyl-oligosaccharide alpha-1,2-mannosidase OS=Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / FGSC A1164 / NRRL 181) GN=NFIA_052440 PE=4 SV=1
  101 : B0Y765_ASPFC        0.41  0.59    5  498  141  692  569   16   93  704  B0Y765     Mannosyl-oligosaccharide alpha-1,2-mannosidase OS=Neosartorya fumigata (strain CEA10 / CBS 144.89 / FGSC A1163) GN=AFUB_072720 PE=4 SV=1
  102 : C1G9X5_PARBD        0.41  0.60    4  500  130  682  572   19   95  695  C1G9X5     Mannosyl-oligosaccharide 1,2-alpha-mannosidase IB OS=Paracoccidioides brasiliensis (strain Pb18) GN=PADG_04061 PE=4 SV=1
  103 : C5GFX5_AJEDR        0.41  0.58    4  500  133  687  574   20   97  703  C5GFX5     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Ajellomyces dermatitidis (strain ER-3 / ATCC MYA-2586) GN=BDCG_03758 PE=4 SV=1
  104 : C5JH23_AJEDS        0.41  0.58    4  500  133  687  574   20   97  703  C5JH23     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Ajellomyces dermatitidis (strain SLH14081) GN=BDBG_01802 PE=4 SV=1
  105 : C5PEE6_COCP7        0.41  0.58    4  499  150  699  567   18   89  715  C5PEE6     Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase, putative OS=Coccidioides posadasii (strain C735) GN=CPC735_001190 PE=4 SV=1
  106 : E9DG91_COCPS        0.41  0.58    4  499  143  692  567   18   89  708  E9DG91     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Coccidioides posadasii (strain RMSCC 757 / Silveira) GN=CPSG_08840 PE=4 SV=1
  107 : F2T2T2_AJEDA        0.41  0.58    4  500  133  687  574   20   97  703  F2T2T2     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Ajellomyces dermatitidis (strain ATCC 18188 / CBS 674.68) GN=BDDG_00129 PE=4 SV=1
  108 : J3K3W2_COCIM        0.41  0.58    4  499  150  699  567   18   89  715  J3K3W2     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Coccidioides immitis (strain RS) GN=CIMG_07325 PE=4 SV=1
  109 : L0P9Y8_PNEJ8        0.41  0.63    9  500   29  489  498   16   44  498  L0P9Y8     I WGS project CAKM00000000 data, strain SE8, contig 150 OS=Pneumocystis jiroveci (strain SE8) GN=PNEJI1_002036 PE=4 SV=1
  110 : Q4WND0_ASPFU        0.41  0.59    5  498  141  692  569   16   93  704  Q4WND0     Mannosyl-oligosaccharide alpha-1,2-mannosidase OS=Neosartorya fumigata (strain ATCC MYA-4609 / Af293 / CBS 101355 / FGSC A1100) GN=AFUA_6G06790 PE=4 SV=1
  111 : Q5I5K2_ASPFM        0.41  0.59    6  498   29  579  568   16   93  591  Q5I5K2     Mannosidase I OS=Neosartorya fumigata PE=2 SV=1
  112 : R4XGV0_TAPDE        0.41  0.63    1  509   91  579  519   13   41  606  R4XGV0     Uncharacterized protein (Fragment) OS=Taphrina deformans (strain PYCC 5710 / ATCC 11124 / CBS 356.35 / IMI 108563 / JCM 9778 / NBRC 8474) GN=TAPDE_005711 PE=4 SV=1
  113 : S9PVZ1_SCHOY        0.41  0.62    2  497   42  521  512   16   49  526  S9PVZ1     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Schizosaccharomyces octosporus (strain yFS286) GN=SOCG_04845 PE=4 SV=1
  114 : A1CE69_ASPCL        0.40  0.57    5  498  148  710  581   18  106  722  A1CE69     Mannosyl-oligosaccharide alpha-1,2-mannosidase OS=Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1) GN=ACLA_088570 PE=4 SV=1
  115 : A6R3H4_AJECN        0.40  0.57    5  500  138  691  577   21  105  707  A6R3H4     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Ajellomyces capsulatus (strain NAm1 / WU24) GN=HCAG_04182 PE=4 SV=1
  116 : C0NAB2_AJECG        0.40  0.57    5  500  137  690  577   21  105  706  C0NAB2     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Ajellomyces capsulatus (strain G186AR / H82 / ATCC MYA-2454 / RMSCC 2432) GN=HCBG_00058 PE=4 SV=1
  117 : C0S1J5_PARBP        0.40  0.58   40  500    1  517  534   16   91  530  C0S1J5     Mannosyl-oligosaccharide alpha-1,2-mannosidase OS=Paracoccidioides brasiliensis (strain Pb03) GN=PABG_01460 PE=4 SV=1
  118 : C1GQH4_PARBA        0.40  0.58    4  500  130  702  592   20  115  718  C1GQH4     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Paracoccidioides lutzii (strain ATCC MYA-826 / Pb01) GN=PAAG_00769 PE=4 SV=1
  119 : C5FXY8_ARTOC        0.40  0.59    4  500  141  703  580   18  101  717  C5FXY8     Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Arthroderma otae (strain ATCC MYA-4605 / CBS 113480) GN=MCYG_07205 PE=4 SV=1
  120 : C6H8U0_AJECH        0.40  0.58   71  500    2  500  506   16   84  516  C6H8U0     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Ajellomyces capsulatus (strain H143) GN=HCDG_02621 PE=4 SV=1
  121 : E4UW92_ARTGP        0.40  0.58    4  500  141  704  583   19  106  719  E4UW92     Putative uncharacterized protein OS=Arthroderma gypseum (strain ATCC MYA-4604 / CBS 118893) GN=MGYG_04703 PE=4 SV=1
  122 : F0UA45_AJEC8        0.40  0.57    5  500  136  689  577   21  105  705  F0UA45     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Ajellomyces capsulatus (strain H88) GN=HCEG_02032 PE=4 SV=1
  123 : F4R587_MELLP        0.40  0.61   16  501    1  476  510   19   59  480  F4R587     Family 47 glycoside hydrolase (Fragment) OS=Melampsora larici-populina (strain 98AG31 / pathotype 3-4-7) GN=MELLADRAFT_32725 PE=4 SV=1
  124 : F9XEY7_MYCGM        0.40  0.59    4  500   95  610  548   16   84  661  F9XEY7     Putative 1,2-alpha-mannosidase OS=Mycosphaerella graminicola (strain CBS 115943 / IPO323) GN=MgAMN9 PE=4 SV=1
  125 : G7XT03_ASPKW        0.40  0.57    5  498  145  706  579   17  103  731  G7XT03     Mannosyl-oligosaccharide alpha-1,2-mannosidase OS=Aspergillus kawachii (strain NBRC 4308) GN=AKAW_08187 PE=4 SV=1
  126 : I1CW61_RHIO9        0.40  0.59    2  498   35  480  503   16   64  483  I1CW61     Uncharacterized protein OS=Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880) GN=RO3G_17402 PE=4 SV=1
  127 : MNS1_SCHPO          0.40  0.61    1  499   42  516  510   16   47  521  Q9P7C3     Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=SPAC2E1P5.01c PE=1 SV=2
  128 : Q0CTT0_ASPTN        0.40  0.58    5  498  146  692  571   16  102  706  Q0CTT0     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Aspergillus terreus (strain NIH 2624 / FGSC A1156) GN=ATEG_02904 PE=4 SV=1
  129 : S9XE41_SCHCR        0.40  0.62    1  495   41  511  505   18   45  523  S9XE41     Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Schizosaccharomyces cryophilus (strain OY26 / ATCC MYA-4695 / CBS 11777 / NBRC 106824 / NRRL Y48691) GN=SPOG_00466 PE=4 SV=1
  130 : E3KXK5_PUCGT        0.39  0.61    3  498   87  570  515   20   51  576  E3KXK5     Putative uncharacterized protein OS=Puccinia graminis f. sp. tritici (strain CRL 75-36-700-3 / race SCCL) GN=PGTG_14908 PE=4 SV=2
  131 : J6FA17_TRIAS        0.39  0.59    1  500   72  564  524   20   56  571  J6FA17     Uncharacterized protein OS=Trichosporon asahii var. asahii (strain ATCC 90039 / CBS 2479 / JCM 2466 / KCTC 7840 / NCYC 2677 / UAMH 7654) GN=A1Q1_06697 PE=4 SV=1
  132 : K1W097_TRIAC        0.39  0.59    1  500   72  564  524   20   56  571  K1W097     Uncharacterized protein OS=Trichosporon asahii var. asahii (strain CBS 8904) GN=A1Q2_03248 PE=4 SV=1
  133 : V3ZMZ6_LOTGI        0.39  0.59    3  497   16  465  502   17   60  465  V3ZMZ6     Uncharacterized protein OS=Lottia gigantea GN=LOTGIDRAFT_120396 PE=4 SV=1
  134 : D4AXX1_ARTBC        0.38  0.56    4  500  141  716  595   20  118  731  D4AXX1     Putative uncharacterized protein OS=Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371) GN=ARB_01040 PE=4 SV=1
  135 : D4D6R3_TRIVH        0.38  0.56    4  500  141  716  595   20  118  731  D4D6R3     Putative uncharacterized protein OS=Trichophyton verrucosum (strain HKI 0517) GN=TRV_02790 PE=4 SV=1
  136 : D8R549_SELML        0.38  0.58    9  494   68  567  524   17   63  577  D8R549     Putative uncharacterized protein OS=Selaginella moellendorffii GN=SELMODRAFT_168485 PE=4 SV=1
  137 : E6R639_CRYGW        0.38  0.58    4  506  105  603  537   23   73  603  E6R639     Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase (ER alpha-1,2-mannosidase), putative OS=Cryptococcus gattii serotype B (strain WM276 / ATCC MYA-4071) GN=CGB_E6120W PE=4 SV=1
  138 : F5HAB5_CRYNB        0.38  0.58    4  506  105  603  537   23   73  603  F5HAB5     Putative uncharacterized protein OS=Cryptococcus neoformans var. neoformans serotype D (strain B-3501A) GN=CNBE4550 PE=4 SV=1
  139 : J9VN97_CRYNH        0.38  0.58    4  506  105  603  537   23   73  603  J9VN97     Mannosyl-oligosaccharide alpha-1,2-mannosidase OS=Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487) GN=CNAG_02081 PE=4 SV=1
  140 : Q5KG79_CRYNJ        0.38  0.58    4  506  105  603  537   23   73  603  Q5KG79     Putative uncharacterized protein OS=Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565) GN=CNE04550 PE=4 SV=1
  141 : D8S3V6_SELML        0.37  0.57    9  494   68  567  530   16   75  577  D8S3V6     Putative uncharacterized protein OS=Selaginella moellendorffii GN=SELMODRAFT_176646 PE=4 SV=1
  142 : G1QAD3_MYOLU        0.37  0.60    1  494   39  489  505   18   66  493  G1QAD3     Uncharacterized protein (Fragment) OS=Myotis lucifugus GN=MAN1B1 PE=4 SV=1
  143 : G4T9C6_PIRID        0.37  0.57    4  497   49  533  521   20   64  540  G4T9C6     Related to alpha-mannosidase OS=Piriformospora indica (strain DSM 11827) GN=PIIN_01806 PE=4 SV=1
  144 : G9K9C3_MUSPF        0.37  0.59    1  494   51  501  504   19   64  504  G9K9C3     Mannosidase, alpha, class 1B, member 1 (Fragment) OS=Mustela putorius furo PE=2 SV=1
  145 : J3M4X0_ORYBR        0.37  0.57    5  505  102  610  539   17   69  610  J3M4X0     Uncharacterized protein OS=Oryza brachyantha GN=OB05G16440 PE=4 SV=1
  146 : M0WEB4_HORVD        0.37  0.58    5  495  103  601  525   17   61  611  M0WEB4     Uncharacterized protein OS=Hordeum vulgare var. distichum PE=4 SV=1
  147 : M3Z173_MUSPF        0.37  0.59    1  494    4  454  504   19   64  461  M3Z173     Uncharacterized protein (Fragment) OS=Mustela putorius furo GN=MAN1B1 PE=4 SV=1
  148 : Q8BTW7_MOUSE        0.37  0.60    2  494    6  455  505   19   68  459  Q8BTW7     Putative uncharacterized protein (Fragment) OS=Mus musculus GN=Man1b1 PE=2 SV=1
  149 : B7S490_PHATC        0.36  0.55    6  494   27  489  509   18   67  489  B7S490     Predicted protein (Fragment) OS=Phaeodactylum tricornutum (strain CCAP 1055/1) GN=PHATRDRAFT_bd36 PE=4 SV=1
  150 : B8P5V2_POSPM        0.36  0.57    6  498    8  492  520   23   63  498  B8P5V2     Putative uncharacterized protein OS=Postia placenta (strain ATCC 44394 / Madison 698-R) GN=POSPLDRAFT_111281 PE=4 SV=1
  151 : B8PFL7_POSPM        0.36  0.56    6  498    8  483  518   23   68  489  B8PFL7     Putative uncharacterized protein OS=Postia placenta (strain ATCC 44394 / Madison 698-R) GN=POSPLDRAFT_63716 PE=4 SV=1
  152 : D8PSM2_SCHCM        0.36  0.57    1  498    3  497  527   21   62  503  D8PSM2     Glycoside hydrolase family 47 protein (Fragment) OS=Schizophyllum commune (strain H4-8 / FGSC 9210) GN=SCHCODRAFT_50368 PE=4 SV=1
  153 : M7X6L5_RHOT1        0.36  0.57    5  501   87  581  538   25   85  581  M7X6L5     Mannosyl-oligosaccharide alpha-1,2-mannosidase, glycoside hydrolase family 47 protein OS=Rhodosporidium toruloides (strain NP11) GN=RHTO_00429 PE=4 SV=1
  154 : S8DN03_FOMPI        0.36  0.57    6  497   56  541  520   24   63  548  S8DN03     Uncharacterized protein OS=Fomitopsis pinicola (strain FP-58527) GN=FOMPIDRAFT_158032 PE=4 SV=1
  155 : W2SKN6_NECAM        0.36  0.58    2  497   23  487  510   19   60  487  W2SKN6     Glycosyl hydrolase family 47 OS=Necator americanus GN=NECAME_15419 PE=4 SV=1
  156 : B0CNN5_LACBS        0.35  0.56    6  497   10  500  520   20   58  507  B0CNN5     Glycoside hydrolase family 47 protein (Fragment) OS=Laccaria bicolor (strain S238N-H82 / ATCC MYA-4686) GN=LACBIDRAFT_228999 PE=4 SV=1
  157 : B0DXI8_LACBS        0.35  0.56    6  499    6  493  520   24   59  498  B0DXI8     Glycoside hydrolase family 47 protein (Fragment) OS=Laccaria bicolor (strain S238N-H82 / ATCC MYA-4686) GN=LACBIDRAFT_255188 PE=4 SV=1
  158 : I4YI83_WALSC        0.35  0.55    5  498   74  566  535   25   84  572  I4YI83     Glycoside hydrolase OS=Wallemia sebi (strain ATCC MYA-4683 / CBS 633.66) GN=WALSEDRAFT_35272 PE=4 SV=1
  159 : V5E3S3_9BASI        0.33  0.55    1  497   18  552  557   20   83  559  V5E3S3     1, 2-alpha-mannosidase OS=Pseudozyma sp. GHG001 GN=PSEUBRA_SCAF8g02239 PE=4 SV=1
  160 : L5K6U4_PTEAL        0.32  0.52    1  498   75  602  578   21  131  602  L5K6U4     Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Pteropus alecto GN=PAL_GLEAN10012720 PE=4 SV=1
## ALIGNMENTS    1 -   70
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....1....:....2....:....3....:....4....:....5....:....6....:....7
     1   34 A G     >        0   0   87   36   51  GGGGGGGGGGGG DS DDDD S      DG G      G       G                       
     2   35 A A  H  >  +     0   0   21   40   65  AAAAAAAAAAAV PS PPAA S      AN G      G       S                       
     3   36 A G  H  > S+     0   0   35   42   70  GGGGGGGGGGGE AS AAAS V      AR T      T       A                       
     4   37 A E  H  > S+     0   0  114   74   27  EEEEEEEEEEEEDAE EEAQ T   E  AEEE     EED      G     ED      E E       
     5   38 A M  H  X S+     0   0   26  100   59  MMMMMMMMMMMMVVV VVAV T   R  MAAA     KAK      A     RRR R   RRR  R    
     6   39 A R  H  X S+     0   0   35  131   31  RRRRRRRRRRRKKRR RRKRKRRR S  RKKQ     QQQ      R     KRRRRRRRRRRRRR RRQ
     7   40 A D  H  X S+     0   0   38  136   56  DDDDDDDDDDDGFED EEESDQTT S ENTKYED   DYQ D    Q     REQDKEDEDAKEAD EEN
     8   41 A R  H  X S+     0   0  130  138   75  RRRRRRRRRRRQEQE QQSLQAEE Q SKAEAEE   QAEEE    A K   QKSHSKRREQHRRR EEA
    43   76 A G  T 3  S-     0   0   57   35   59  GGGGGGGGGGGDSSSTSSSSSSNkDsSDEN........................................
    44   77 A N    <   +     0   0   93   54   70  NNNNNNNNNNNNGGGNGGGDNKGAGKGDEG........................................
    64   97 A S  H << S+     0   0   40   33   55  SSSSSSSSSSSSsSGnSSS.SQGtSqksSd.k......k.......t.......................
    65   98 A S     <  +     0   0    8   33   58  SSSSSSSSSSSSDSSNSSS.TTTSTSDISD.D......D.......D.......................
    66   99 A T  S    S+     0   0  110   34   71  TTTTTTTTTTTVETTSTTVSSTESSEDAAP.V......V.......K.......................
    67  100 A L  S    S+     0   0  105   34   96  LLLLLLLLLRRLDTTGTTNSLEDSLHTSNE.R......R.......Q.......................
    68  101 A Y  S  > S+     0   0   57   34   75  YYYYYYYYYYYYHHHTHHHGYHNNYRHRYT.H......H.......H.......................
    69  102 A K  H  > S+     0   0   83   34   32  KKKKKKKKKKKKRRRKRRKSKKKKKRRNKK.R......R.......R.......................
    70  103 A S  H  > S+     0   0   93   34   78  SSSSSSSSSSSSKSNLSSDSDEENDDKEDQ.L......L.......K.......................
    71  104 A E  H  > S+     0   0   52   35   64  EEEEEEEEEEEEQEEKEEERIKTLEQRQEK.R......R.......Q.......................
    72  105 A F  H  X S+     0   0    0   37   16  FFFFFFFFFFFFFLLLLLFLFFFFFLFFFF.L......L.......L.......................
   104  137 A M  I  XS+     0   0    5  161   25  SSSSSSSSSSSSSSSSSSASSSSSSTSSSSSATTSSSSAStTSSSSASSSSSsssssssssssssssssA
   116  149 A D  H  <5S+     0   0   70  148   52  DDDDDDDDDDDDETSNTTTSsMTNNqETTSNEKK.K.KEEdKNKENEENNNNnkddddedheedeeqdd.
   117  150 A V  H  <5S+     0   0   83   43   82  VVVVVVVVVLLLTLQELLEQeQEEEtTEEE.T......T.......T......L............L...
   118  151 A L  H  <5S-     0   0   38   96   86  LLLLLLLLLLLLYLLFLLLMFLLLLAYLLL.L......L.......L......VDDDDDD.DDDDDP...
   119  152 A E  T  <5 +     0   0  173   98   50  EEEEEEEEEEEEKTEQTTNRQDDLNNHQDS.G......G.......G......PDDDDDD.DDDDDH...
   120  153 A V      < -     0   0    5  108   77  VVVVVVVVVVVVVVMVVVVVIVLLISIILI.V......V.......V......VHEVTEPVPEPPEVVV.
   121  154 A G  S    S-     0   0   36  125   26  GGGGGGGGGGGGGGGGGGGGPGPGPTGGPG.G..G.G.G.......G...G..KGGGGGGAGGGGGASSG
   123  156 A K  H 3> S+     0   0   75  161   70  KKKKKKKKKKKKSPPSPPPEsPnPsdSPrPDPDNDDDDPDSNDDDDPDDDDDPappppaprpdapikrrD
   124  157 A T  H 3> S+     0   0   70  119   68  TTTTTTTTTTTTTNDSNNKQtEaTqqTNnS.A..D.D.A.......S.E....dddddddsdddddsyyT
   144  177 A T  S    S-     0   0   16   45   52  TTTTTTTTTTTTSTSSTTTSSSTSSSSSNS.S......S..S....S....S..............N...
   214  247 A T  H  <5S+     0   0   78   37   84  TTTTTTTTTTTAhPArPPkqkyqKpRhhQS.A......A.......A.......................
   256  289 A H     << +     0   0   53  161   68  HHHHHHHHHHHHGHHHHHKHNSGHHGGHGHnRKNsnsdRnnNnnnnRRGnnnkknnnqnnGnnnnnGsys
   257  290 A E    >>  -     0   0   14  159   15  EEEEEEEEEEEEEEEEEEEEQEEEEEEEEEeEEEeeeeEeeEeeeeEEEeeeeeeeeeeeEeeeeeEeee
   333  366 A S     >  -     0   0   19  153   62  ssssssssssssddddddndddndndndndsdnnntttddtnnnnndtdnnnswntsgsnttsntstnnQ
   334  372 A K  H  > S+     0   0  117  154   57  kkkkkkkkkkkqqeeeeeaeeaeeeeqqeiaaeeaeaeaeeeeeeeaeeeaeaeeeeeededddeeekeL
   366  404 A N        +     0   0   26  161   61  NNNNNNNNNNNNNNNnNNnnNnnnnnndNrnsNnNnNNsNNnNNNNrkNNNNNnkeknennnnnneneet
   367  405 A D        -     0   0   41  161   60  DDDDDDDDDDDESDDeDDneDndsegnsDndeEdEeEDeEEdEEEEedNEEERdahpdqkgpakppqrqs
   369  407 A N        +     0   0  131   93   79  NNNNNNNNNNNNpApeAAEASEe..e..aR.E.KT.T.Eq.KTSKTEsPTSTDf..Qra.yE..H.SS.P
   371  409 A K              0   0  142  150   73  kkkkkkkkkkkeyiPRiisGQqPVTkEsptKH.QK.K.HKkQKKKKHKKKKKsKdkDMFdrdddSPSRRK
   372      ! !              0   0    0    0    0  
   373  411 A D              0   0  193  113   54  dddddddddddndqD.qqgR.s...nPnhrDDn.E.EED.q.....N.....dEdpEEDdedddEA.D..
   374  412 A G        +     0   0   51  131   65  GGGGGGGGGGGGNRNDKKNS.K.G.GNNDYESG.HGQDS.N.....S.....DDPaDTpPsPPPDnSDs.
   375  413 A W        -     0   0  107   87   94  WWWWWWWWWWWWWSAWSSWNYWYA.WWWWW.W......W.......W........pA.p.a...PpT.d.
   376  414 A W  E     -L  385   0G  62  102   95  WWWWWWWWWWWWWWWWWWWWEWWW.WWYWW.W......W.......W.......QDQ.DHLDNHQELVP.
   377  415 A R  E     -L  384   0G 152  107   80  RRRRRRRRRRRQVVLKVVKIFGKQ.KRQKE.E......E.......E.......AAA.AASAAAAASNS.
   378  416 A S        -     0   0    3  108   72  SSSSSSSSSSSSSSSASSSSDSSSDSSSSS.S......S.......S.......TET.EKKREKKEKSS.
   379  417 A S  S    S+     0   0   88  117   95  SSSSSSSSSSSSEPPPPPPEEPEAKPEFKP.P...N.SP.......P.....MPWWW.WWWWWWWWWWW.
   437  475 A K  T 34 S+     0   0  192   99   73  KKKKKKKKKKKNERHSYRKPSGEtNkgdKAKSEnedeASEDnedDeSdeeeeDk...K............
   438  476 A L  T <4 S+     0   0   85   69   76
   439  477 A R     <  +     0   0   40   85   80  RRRRRRRRRRRRSKIKSKPKKTRCRKVISIILVVSVT.LVIVSSVSLPTASSRD...T............
   440  478 A R  E     -O  431   0I   9   93   75  RRRRRRRRRRRRAA.FLAKVRKRARAARRTSTSRSSS.TSSRSSSSTRSSSSGG...G...........G
   447  485 A C  S    S+     0   0    0  161   66  CCCCCCCCCCCCVCCCCCCCCCIVCVVCDtVvVVkVkVvVVVdgMdvVndndkVAAAAAAVAAAAAVVVV
   478  516 A F        -     0   0   41  161   81  FFFFFFFFFFFFVVVVVVVVfVVVsVVVVFnFnvnnnnFnnvnnnnYtdnnneddddddddsdddddedd
   479  517 A D    >   -     0   0   70  161   50  DDDDDDDDDDDDDDDDDDDDkEDDkDEDDDpDpdppppDppdppppDddppppppppsppppppppsppp
   499  537 A I  H  > S+     0   0   67  107   87  IIIIIIIIIIIIRIQVIIDSETENERRVTKPEP  N PEL    K EP     HRPK TK DPKPQ RK 
   500  538 A L  H  <>S+     0   0    7  102   15  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLF  L LLL    L LF     LLLL LL LLLLL FF 
   501  539 A K  H ><5S+     0   0   53   53   80  KKKKKKKKKKKKDRRDRRNRTGAKELNELQ AT  H  AH      A                    QK 
   502  540 A S  H 3<5S+     0   0   94   51   71  SSSSSSSSSSSSEEESEESDNRVAKDEEKS RT  S  RK      R                    TT 
   503  541 A Q  T 3<5S-     0   0   45   41   84  QQQQQQQQQQQLLLLLLLKMMMRHLLLMKM R   T  R       R                       
   504  542 A S  T < 5 +     0   0   53   41   64  SSSSSSSSSSSSNDGKDDNKGQGNGNNSGN G   G  G       G                       
   505  543 A L      < +     0   0    5   40   11  LLLLLLLLLLLLLLLLLLLLLLLLLLLLFL L      L       L                       
   506  544 A T        -     0   0   85   39   78  TTTTTTTTTTTTTKKVKKKKTKKVVSTTED V      V       V                       
   507  545 A T        -     0   0   48   35    9  TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT T      T       T                       
   508  546 A G        +     0   0   56   35   20  GGGGGGGGGGGGGGGGGGGGTGNGGGGGNG G      G       G                       
   509  547 A W        -     0   0   24   35    0  WWWWWWWWWWWWWWWWWWWWWWWWWWWWWW W      W       W                       
   510  548 A S              0   0   88   32   56  SSSSSSSSSSSS ASSAASSSLSHSSKT S D      D       D                       
   511  549 A L              0   0  109   27   12  LLLLLLLLLLLL   L  L LLILIILL L L      L       L                       
## ALIGNMENTS   71 -  140
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....8....:....9....:....0....:....1....:....2....:....3....:....4
     1   34 A G     >        0   0   87   36   51                                           S              G A AA        
     2   35 A A  H  >  +     0   0   21   40   65                                           NA            TS A DD        
     3   36 A G  H  > S+     0   0   35   42   70                                           TA            AT SSEET       
     4   37 A E  H  > S+     0   0  114   74   27   E   ED        E           E   EEEEEEE   AE    EE E  D DR ESEEEEE EEEE
     5   38 A M  H  X S+     0   0   26  100   59  RR   RRR RRR RRR R    R    R RRRRRRRRR R KKRRR RR RR RRRRRKARRERR KKKK
    43   76 A G  T 3  S-     0   0   57   35   59  ........ ......................G..............GG. ....................
    44   77 A N    <   +     0   0   93   54   70  ........ .......P..............K......S.......KK. ..S......ATT....LAAA
    64   97 A S  H << S+     0   0   40   33   55  ................................................. ....................
    65   98 A S     <  +     0   0    8   33   58  ................................................. ....................
    66   99 A T  S    S+     0   0  110   34   71  ................................................. ....................
    67  100 A L  S    S+     0   0  105   34   96  ................................................. ....................
    68  101 A Y  S  > S+     0   0   57   34   75  ................................................. ....................
    69  102 A K  H  > S+     0   0   83   34   32  ................................................. ....................
    70  103 A S  H  > S+     0   0   93   34   78  ................................................. ....................
    71  104 A E  H  > S+     0   0   52   35   64  .................................................N....................
    72  105 A F  H  X S+     0   0    0   37   16  .................................................L..M......M..........
   104  137 A M  I  XS+     0   0    5  161   25  ssasssssssssssssqssaaasasassasssssssssTssTSsssssssssTssSSsSSttTsssssss
   116  149 A D  H  <5S+     0   0   70  148   52  eedddehepdeededesdgdddedddkdddddddddddKddQKngdpdededDddNQdN.dd.eegdddd
   117  150 A V  H  <5S+     0   0   83   43   82  ........g...................................................DD...a....
   118  151 A L  H  <5S-     0   0   38   96   86  DDSD.D.DIDDDDDDD.DM...D.D..D.DDDDDDDDD.DD..DDDIDDDDD..D..D..PP.DDL....
   119  152 A E  T  <5 +     0   0  173   98   50  DDGDAD.DADDDDDDD.DS...D.D..D.DDDDDDDDD.DD..DDDADDDDD.GD..D..KK.DDS....
   120  153 A V      < -     0   0    5  108   77  EEVESEVEEPEEPEPA.TSVVVEVEV.VVAAAEEPPEP.AA..ADDDADDDD.LT..A..II.DDP....
   123  156 A K  H 3> S+     0   0   75  161   70  ipeprpragaaapaapdpDqqqarlrpaqpppppppppNppQPDppapppspDDpDKpEDddTsskPPPP
   124  157 A T  H 3> S+     0   0   70  119   68  ddddhdsdddddddddddYfffdgdsddfddddddddd.dd...ddsdddddQ.dS.d.Tpp.dde....
   144  177 A T  S    S-     0   0   16   45   52  ..............................................s..................S....
   214  247 A T  H  <5S+     0   0   78   37   84  ....................................................S..a..............
   256  289 A H     << +     0   0   53  161   68  nnGnNnGnsnnnnnnnnqsSSSnsssssSssssssssskssEkassssssssnsqQfsknnngssgnnnn
   257  290 A E    >>  -     0   0   14  159   15  eeEeEeEeeeeeeeeeeeeEEEeeeeeeEeeeeeeeeeeeeDveeeeeeeeeeee.gevqeeneeveeee
   294  327 A L  T 3  S+     0   0   30  138   37  lLVLVLILLlLLlLlLILVIIILILILLILLlllLLlLILLvLLllLlLLLl.ILTLLLY...LL.....
   295  328 A H  T 3  S+     0   0  198  139   72  n..DG.G.Dn..n.nDEHGGGG.GAGDRGHHhhhRRhRDHH.NEhhNhDKTh.DHHEDN.ttRTTRdddd
   296  329 A G  S <  S-     0   0   20  153   45  AegGSeGeGDeeDeDGGGGGGGeGGGGEGGGEEEQQEQNGG.KGEEHEEHDEgQGpHGK.ggTEEnqqqq
   297  330 A Q        -     0   0  178  144   75  .ptKHpPpN.pp.p.QKVPKKKpAEPGSKKK...PP.PNKKpKY..E.SEP.kSVnAAKRaa.PPdqqqq
   333  366 A S     >  -     0   0   19  153   62  snggnstsgnssnsnsggtsssststssstngggggggennsssggggngsgeggEgtnNdd.nnseeee
   334  372 A K  H  > S+     0   0  117  154   57  edeeedeeedeededeeeseeeeedeeeeddeeeeeeekdddddeeeeeeeenee.edeQqq.eevrrrr
   366  404 A N        +     0   0   26  161   61  ennkennekneenenqennnnnedkdrinttqkkkkkknttNskeeqqeeeeshnndqairrnddrvvvv
   367  405 A D        -     0   0   41  161   60  qadkatgnssnnqnsakdnsssnqegegsddkppffpfdddDetppkkgpgpnqddddddeepggedddd
   369  407 A N        +     0   0  131   93   79
   370  408 A I              0   0   45  126   72  .F.FSFLVLFVVLVFLLI.LLLVTIGLYLAAILLGGLG.AA.ETLLIIELELI.I.TL.ILL.EE.....
   371  409 A K              0   0  142  150   73  PD.dRDrnDdnndnddDA.PPPnRdkkPPSSKkkggkgKSSPKtrrKKnrdrQ.AqKAKKAA.ddMrrrr
   372      ! !              0   0    0    0    0  
   373  411 A D              0   0  193  113   54  AESdDEe.Dd..ddddTKd....DegpD.TA.nkkknkNAADDtnn..knkn.QNd.T..DD.eeDnnnn
   374  412 A G        +     0   0   51  131   65  nDGPDDs.SP..PpPPdpEppp.SEgeppggSppsspsDggnSgpp.Sgpgp.SpG.gD.EE.gggEEEE
   375  413 A W        -     0   0  107   87   94  pP...PapE.pp.p..eq.sssp..srsskk.kkggkg.kks.hkk..kkgk..q..e.K...ggp....
   376  414 A W  E     -L  385   0G  62  102   95  EH.ELHLDDHDDNDHAGK.IIIDL.LNTISS.SSLLSL.SST.GSSS.ASKS..K..S.R...KKN....
   377  415 A R  E     -L  384   0G 152  107   80  AA.AKASAAAAAAAAAEA.SSSAAVAATSQQSAARRAR.QQT.AAASSKAVA..A..Q.E...AAA....
   378  416 A S        -     0   0    3  108   72  EE.TSKKEDKEEKEKEGS.AAAEAEEEPAGGTSSDDSD.GGS.GKLTTNLKL..S..H.W...KKQ....
   379  417 A S  S    S+     0   0   88  117   95  WW.WWWWWWWWWWWWWWGWWWWWWWWWHWVAAAADDAD.AAR.DAAAAEAEA..G..K.G..AEEY....
   387  425 A P  G >  S+     0   0   72  161   42  SSSSLSPSPASSASAPPsPPPPSPGPPpPpppppppppDppDSppppppppphksSRpQsssPppPpppp
   388  426 A L  G 3  S+     0   0  155  160   84  GNQNINLGAMGGMGMNAqLLLLGLNLNmLqqqnnppnpQqqRQqqqqqaqsqlgqRRq.liiLssLiiii
   430  468 A b  E  <  -O  441   0I   5  161   82  AATSRALALSAAAASAIAAIIIANSAVaIaasssaasaKaaHRassssasasHAaRRaRKKKKaaKRRRR
   431  469 A V  E    S+O  440   0I  26  117   49  VV.VVVVVVVVVVVVVVVV...V.I.Vv.gqvttaata.qqVLgmtvvaayt.Vd.LiLV...aa.....
   432  470 A D  S >  S+     0   0   80  125   86  RE.EQEPREERREREEEVE...R.N.PD.sSGKKPPKP.SSGPa..DDdK...Et.P.PK.....I..V.
   433  471 A b  T 3   +     0   0   45  142   86  ND.EDDGNDDNNDNDDDELPPPN.K.DGPEEAKKSSKS.EEKGA..AANR...DRLG.GAVV...SVVKV
   436  474 A P  T 34 S+     0   0   73  161   50  GGGGGGGGGGGGGGGGGPGGGGGgGgGvGaaarrAArAGaaGApppaaspppSGsGAGAAGGPSSGGGGG
   437  475 A K  T 34 S+     0   0  192   99   73  ..G..............K.EEE.dG..kEpppssssssGpp..pssppssssk.p.....GGSss.GG.G
   438  476 A L  T <4 S+     0   0   85   69   76  .................I.......g.i.iiiiiiiii.ii..iiiiiiiiif.i........ii.....
   439  477 A R     <  +     0   0   40   85   80  .................T.....K.R.K.TTRRRRRRR.TT..TRRRRRRRRG.T.......MRR.....
   440  478 A R  E     -O  431   0I   9   93   75  ..G..............G.GGG.G.G.GGGGSAAGGAG.GG..GAASSAAAAG.GG......GAA.....
   478  516 A F        -     0   0   41  161   81  ddddddddddddddddddddddddddddddddddddddnddrpeeedddedesdddfepsddpdddnddd
   479  517 A D    >   -     0   0   70  161   50  pppppppppppppppppspppppppppppssppppppppssgaappppppppppspppapaasppppppp
   499  537 A I  H  > S+     0   0   67  107   87  HPPPRP QKKQQKQK   KKKKQ P K K  REEKKEKS  D  QQRRKQKQVK  M   QQ KK YYYY
   500  538 A L  H  <>S+     0   0    7  102   15  LLLLYL LLLLLLLL   FFFFL L L F  LLL  L L  R  LLLLLLLLVL      FF LL IVFV
   501  539 A K  H ><5S+     0   0   53   53   80      K             SQQQ      Q            V          D             SSSS
   502  540 A S  H 3<5S+     0   0   94   51   71      T             TTTT      T            H                        SSSS
   503  541 A Q  T 3<5S-     0   0   45   41   84                                           R                        FFFF
   504  542 A S  T < 5 +     0   0   53   41   64                                           E                        AAAA
   505  543 A L      < +     0   0    5   40   11                                           T                        LLLL
   506  544 A T        -     0   0   85   39   78                                           L                        SSSS
   507  545 A T        -     0   0   48   35    9                                           Q                            
   508  546 A G        +     0   0   56   35   20                                           P                            
   509  547 A W        -     0   0   24   35    0                                           W                            
   510  548 A S              0   0   88   32   56                                                                        
   511  549 A L              0   0  109   27   12                                                                        
## ALIGNMENTS  141 -  160
 SeqNo  PDBNo AA STRUCTURE BP1 BP2  ACC NOCC  VAR  ....:....5....:....6....:....7....:....8....:....9....:....0....:....1
     1   34 A G     >        0   0   87   36   51   S S  S    A      AP
     2   35 A A  H  >  +     0   0   21   40   65   P P  PP   D  T   DP
     3   36 A G  H  > S+     0   0   35   42   70   N N  NN   V  N   AN
     4   37 A E  H  > S+     0   0  114   74   27   EDE  EE   E  D   DS
     5   38 A M  H  X S+     0   0   26  100   59   RKRRRRR   KR R  KRR
     6   39 A R  H  X S+     0   0   35  131   31   QQQQQQQRRRRQRQRRRQQ
     7   40 A D  H  X S+     0   0   38  136   56   QSRKKRKFDDDQDRDDDEK
     8   41 A R  H  X S+     0   0  130  138   75   AAAKKAGHAAAAAAAASAA
     9   42 A I  H  X S+     0   0    2  153   10  VVIVVVVVVVVVVVVVIVVV
    10   43 A E  H  X S+     0   0    0  153   77  VIRIKKIIQTTVLVVVVKLV
    11   44 A S  H  X S+     0   0   25  154   57  DDADEEDEKAAKEAAKKGGD
    12   45 A M  H  X S+     0   0    9  154   44  AAAAAAAAAAAAAAAAAAAA
    13   46 A F  H  X S+     0   0    0  154   11  FFFFFFFFMFFFFFFFFFFF
    14   47 A L  H  X S+     0   0    0  154   74  KRKLEGLLRKKQKKKKKQKR
    15   48 A E  H  X S+     0   0   14  154   90  HHHHHHHHFHHWHHHHHHHH
    16   49 A S  H  X S+     0   0    2  155   25  AAAAAAAAVAAASAAAAASA
    17   50 A W  H  X S+     0   0    0  155    0  WWWWWWWWWWWWYWWWWWWW
    18   51 A R  H  X S+     0   0   97  155   73  NADASSAKGLLHSLEHASSL
    19   52 A D  H  X S+     0   0   18  155   53  GGAGGGGGNAAAASGAAAAG
    20   53 A Y  H  X S+     0   0    1  155    0  YYYYYYYYYYYYYYYYYYYY
    21   54 A S  H  < S+     0   0   17  155   72  KRRRRRRQVEEEEEKEEERR
    22   55 A K  H  < S+     0   0  151  155   60  QKRKNNKKKRRKRRKRRRRK
    23   56 A H  H  < S+     0   0   76  155   66  FFDFYYFFYDDDDDFDDDDF
    24   57 A G  S >< S+     0   0    0  155   28  AAAAAAAAAAAAAAAAAAAA
    25   58 A W  T 3  S+     0   0   44  155   16  LWWWMMWWFMMMFMWMMFWW
    26   59 A G  T 3  S+     0   0    7  156    3  GGGGGGGGGGGGGGGGGGGG
    27   60 A Y    <   -     0   0   88  156   82  FHFHYHHHKDDYFDHDSFYH
    28   61 A D  S    S+     0   0    3  156    2  DDDDDDDDDDDDDDDDDDDD
    29   62 A V  E     -A   38   0A  31  156   67  EEDEEEEEEEEEDEQEEEEE
    30   63 A Y  E     -A   37   0A   0  156   17  LLYLLLLLLYYYYYLYYYYL
    31   64 A G  E  >> -A   36   0A   3  156   69  QKHKMMKKKHHHHHKHHHHK
    32   65 A P  T  45S+     0   0    2  156    7  PPPPPPPPPPPPPPPPPPPP
    33   66 A I  T  45S+     0   0   57  156   36  VVLVLLVVQIILIIVIIIIV
    34   67 A E  T  45S-     0   0  126  156   58  SSKSSSSSSGGSSGSEESSS
    35   68 A H  T  <5 +     0   0   61  156   62  RKRRRRRKAKKHHHGQKRKR
    36   69 A T  E   < +A   31   0A  62  156   68  RSGSRRSTSSSTRSGKKTHS
    37   70 A S  E     +A   30   0A  38  156   38  GFGFGGFFGGGGGGYGGGGF
    38   71 A H  E     -A   29   0A 105  156   77  ISTSVVSSSSSSSTSSSSSS
    39   72 A N        -     0   0   15  156   37  NENEDDEEDNNNNNDNNNNE
    40   73 A M  S    S+     0   0   98  159   33  GWLWGGWWQLLLMLWLLLLW
    41   74 A P  S >  S-     0   0   10  159   79  LFVFLLFFWTTGSTFTTSSF
    42   75 A R  T 3  S+     0   0  108  159   72  GGSGGGGGGSSGPDNKERgG
    43   76 A G  T 3  S-     0   0   57   35   59  ..................h.
    44   77 A N    <   +     0   0   93   54   70  ..S......AAGAA.AASG.
    45   78 A Q        -     0   0   74  147   67  ..G......GGNGG.GGKQ.
    46   79 A P        -     0   0   25  152   42  G.G.GG..GGGGPG.GGGG.
    47   80 A L        -     0   0    5  160   21  ILILLLLLQIIIVITIIIIL
    48   81 A G     >> +     0   0    1  160    0  GGGGGGGGGGGGGGGGGGGG
    49   82 A W  T  45S+     0   0   22  160   22  ALYLAALLIYYYYYLYYYYL
    50   83 A I  T  >5S+     0   0    2  160   43  TTTTTTTTTTTTFTTMFTTT
    51   84 A I  H >>5S+     0   0    0  160   11  ALILVVLLLVVVVVIVIIIL
    52   85 A V  H 3<5S+     0   0    1  160    9  IVVIVVIIVVVVIVVIVIVI
    53   86 A D  H 34 S+     0   0    0  160    0  DDDDDDDDDDDDDDDDDDDD
    57   90 A T  H <> S+     0   0    0  160    5  TTTTTTTTTTTTSTTTTTTT
    58   91 A L  H  X S+     0   0    0  160   16  AMLMAAMMLMMMLMAMMILM
    59   92 A M  H  X S+     0   0    0  160   40  MWHWIIWWWIILLLIQQQIW
    60   93 A L  H  X S+     0   0   17  160   26  IIIIIIIILIILLLILILLI
    61   94 A M  H >X S+     0   0    0  160    7  MLMLMMLLMMMMTMMMMMML
    62   95 A Y  H 3< S+     0   0   36  160   69  GGGGGGGGNGGHNGGGGGGG
    63   96 A N  H 3< S+     0   0   76  160   75  LLLLVALLLLLLSLLLLLLL
    64   97 A S  H << S+     0   0   40   33   55  ....................
    65   98 A S     <  +     0   0    8   33   58  ....................
    66   99 A T  S    S+     0   0  110   34   71  ....................
    67  100 A L  S    S+     0   0  105   34   96  ....................
    68  101 A Y  S  > S+     0   0   57   34   75  ....................
    69  102 A K  H  > S+     0   0   83   34   32  ....................
    70  103 A S  H  > S+     0   0   93   34   78  ....................
    71  104 A E  H  > S+     0   0   52   35   64  ....................
    72  105 A F  H  X S+     0   0    0   37   16  ....................
    73  106 A E  H  X S+     0   0   83  161   71  DKDKDDKKKDDDTDKKQTKK
    74  107 A A  H  X S+     0   0   55  161   71  DKTKDDKQDEEDKEGEEEDK
    75  108 A E  H  X S+     0   0   33  161   64  VEEEVIEEEEEEEEEEEEDE
    76  109 A I  H  X S+     0   0    0  161   46  VFFFVVFFFYYYYYVYYYYF
    77  110 A Q  H  X S+     0   0   58  161   74  EGTESSEKWQQKKEAAEREG
    78  111 A R  H  X S+     0   0  109  161   66  EEQEEEEQQRRRRRQRSREE
    79  112 A S  H  X S+     0   0    0  161   32  AAAAAAAAAAAAAAGSAAAA
    80  113 A E  H  X S+     0   0   12  161   48  GRRRSSRRRRRRRRTRRRRR
    81  114 A H  H  X S+     0   0  103  161   71  GRDKKKKKDTTEDKENNEDR
    82  115 A W  H  X>S+     0   0   21  161    0  WWWWWWWWWWWWWWWWWWWW
    83  116 A I  H  <5S+     0   0    0  161   21  IVVVIIVVVVVVVVIVVIVV
    84  117 A N  H  <5S+     0   0   85  160   76  ESASEESSRAAA.ARQAKRS
    85  118 A D  H  <5S+     0   0  120  161   67  KETKDDKEDEENEEDSNSDK
    86  119 A V  T  <5S+     0   0   80  161   73  EKEKNNKNHKKNKQSKKEEK
    87  120 A L      < +     0   0    5  161    5  LLLLLLLLLMMLLLLLQLLL
    88  121 A D        -     0   0   85  161   73  AQTRMMRDDSSSSSSSSTSQ
    89  122 A F        +     0   0    1  161   17  nFFFkkFFHFFFFFFFFFWF
    90  123 A D        +     0   0   67  160   37  sQDQssQQSEEDDEEDEEDQ
    91  124 A I        -     0   0    1  161   84  HKRKEEKKTRRQLRKRRVVK
    92  125 A D  S    S+     0   0  115  161   19  QDDDKKDNVDDEDDDDDDPD
    93  126 A A  S    S-     0   0   10  161   83  GVGVGGVVGGGGDAIDGDGV
    94  127 A E  E     -B  154   0B  95  161   50  QDKDQQDDSNNQKNYRNKRD
    95  128 A V  E     -B  153   0B  13  161   23  VVFVVVVVVFFFYFVFFFMV
    96  129 A N  E  >  -B  152   0B  41  161   15  NNNNNNNNSNNSHNNSNNNN
    97  130 A V  H  > S+     0   0    4  161   55  LLALLLLLVTTTTTLTTTVL
    98  131 A F  H  > S+     0   0   25  161    0  FFFFFFFFFFFFFFFFFFFF
    99  132 A E  H  >>S+     0   0   53  161    0  EEEEEEEEEEEEEEEEEEEE
   100  133 A T  I  X>S+     0   0    1  161   13  TSVSTTSSTTTTATTTTTTS
   101  134 A T  I  <>S+     0   0    0  161    1  TTTTTTTTTTTTsTTTTTTT
   102  135 A I  I  <5S+     0   0    4  161    0  IIIIIIIIIIIIiIIIIIII
   103  136 A R  I  X5S+     0   0   22  161    0  RRRRRRRRRRRRRRRRRRRR
   104  137 A M  I  XS+     0   0    5  161   25  sTSSssSSSSSSsTTSSsiS
   116  149 A D  H  <5S+     0   0   70  148   52  g.K.vv..K..DeK.NDee.
   117  150 A V  H  <5S+     0   0   83   43   82  a...TT..............
   118  151 A L  H  <5S-     0   0   38   96   86  L...SP..............
   119  152 A E  T  <5 +     0   0  173   98   50  S...KN..............
   120  153 A V      < -     0   0    5  108   77  P...RK..............
   121  154 A G  S    S-     0   0   36  125   26  GG.GATGG.GG.S.G.D..G
   122  155 A N    >>  -     0   0   81  159   64  PDDDNNDDDDD.DDDHD.DD
   123  156 A K  H 3> S+     0   0   75  161   70  kAEDPPDSRSSkRSRDPpAA
   124  157 A T  H 3> S+     0   0   70  119   68  e...ED.....p...P.aQ.
   125  158 A V  H <> S+     0   0   15  160   32  VLILRRLLVMMLMIMLILML
   126  159 A Y  H  X S+     0   0    0  161    6  YFFFLLFFFYYYLYFYFFFF
   127  160 A L  H  X S+     0   0   26  161   22  LLLLLLLLLVVLLLILLLIL
   128  161 A N  H  X S+     0   0   96  161   48  KQQKEAKTDEEEDEAEEDDQ
   129  162 A K  H  X S+     0   0   33  161   22  LKKKVVKKKRRKKRKKRLKK
   130  163 A A  H  X S+     0   0    0  161    3  AAAASSAAAAAAAAAAAAAA
   131  164 A I  H  X S+     0   0   48  161   73  KEVEKKEEVKKVVKEVQAVE
   132  165 A D  H  X S+     0   0   55  161   21  DDDDDDDDDDDDDDDEDDDD
   133  166 A L  H  X S+     0   0    0  160    2  LFLFLLFFLLLLLLLLLLLL
   134  167 A G  H  X S+     0   0    0  161   27  GGAGAAGGGAAAAAGAAGAG
   135  168 A D  H  X S+     0   0   77  161   30  DNENDDNKDDDEDDKDDEEN
   136  169 A R  H  < S+     0   0   42  161   22  RRRRRRRRRRRRRRRRRRRR
   137  170 A L  H >< S+     0   0    0  161    6  LLLLLLLLLIIMLMLILLLL
   138  171 A A  H >< S+     0   0   10  161   56  MMLMLLMMLVVLLMILLLKL
   139  172 A L  G >< S+     0   0   73  160   73  APPPLLPPRPPPPPVPSSPP
   140  173 A A  G X  S+     0   0    0  161   17  AAIAAAAAAAAAAAGVASAA
   141  174 A F  G <  S+     0   0    8  161    6  FFFFFFFFFFFFFFFFFFFF
   142  175 A L  G <  S+     0   0  124  161   68  ERSQTTQTDSSDDDTDDSDr
   143  176 A S  S <  S+     0   0   40  161   49  TTTTSSTTGTTTTTSTTTTr
   144  177 A T  S    S-     0   0   16   45   52  S...SS..A.....S....r
   145  178 A Q  S    S+     0   0  175  158   57  PPQPPPPPTKKPPPKPPNPA
   146  179 A T  S    S-     0   0   10  159   43  SSSSTSSSTTTTSTSSSSSV
   147  180 A G  S    S+     0   0    9  160   13  AKGKAAKKGGGGGGAGGGGA
   148  181 A I        -     0   0    0  161   19  IIIIIIIIILLLLLVLLLVI
   149  182 A P        -     0   0    4  161    3  PPPPPPPPPPPPPPPPPPPP
   150  183 A Y        -     0   0   38  161   25  FYLYFFYYWLLLLLLLKLLY
   151  184 A S  S    S+     0   0    9  161   44  SSSSSSSSGSSPSSSPSSRS
   152  185 A S  E     -BC  96 161B  21  161   41  DDFDDDDDEQQRFMDVMYED
   153  186 A I  E     -BC  95 160B   0  160   20  VVIVVVVVVVVVVVVIVVVV
   154  187 A N  E  >  -B   94   0B   9  161   15  VNNNVVNNNNNNNNNNNNDN
   155  188 A L  T  4 S+     0   0    3  161    7  LILILLIILLLLLLLLLLLL
   156  189 A H  T  4 S+     0   0  105  161   77  SGKGRRGGAAAKKAKAKKEG
   157  190 A S  T  4 S-     0   0   70  161   65  ATETDDTTSKKQTKTTMETT
   158  191 A G     <  +     0   0   18  161   80  RGRGRRGGGRRRRRRMRRGG
   159  192 A Q        -     0   0  113  148   72  S.Q.....NIIKQI.ETLE.
   160  193 A A  E     -C  153   0B  25  159   39  AVAA..AFRGGGGGKPGGAV
   161  194 A V  E     -C  152   0B  30  161   47  HALATSAAKVVEIVASVIFA
   162  195 A K        -     0   0   78  161   73  PHAHAAHHNPPEAPKHNPPR
   163  196 A N        -     0   0   31  161   60  APDPHHPSIDDDDDTMEDDP
   164  197 A H  S    S+     0   0  160  160   45  APSPAAPPGNNPKKPDAKLP
   165  198 A A  S >  S+     0   0   53  161   75  GWDRASRQWDDDDDPDGDNR
   166  199 A D  G >  S-     0   0   65  161   44  EWNWPPWWSNNNNNWFLNNW
   167  200 A G  G 3  S-     0   0   72  161   71  RTQTDDTTGRRKRRSPAGNT
   168  201 A G  G <  S+     0   0   10  161   17  GSGSGGSSDGGGGGSGSGNS
   169  202 A A    <   -     0   0    1  161   51  ADFDLLDDNLLLWLELLFSD
   170  203 A S  E     -D  223   0C   2  161   24  SSSSSSSSAVVITVSVVISS
   171  204 A S  E >>  -D  222   0C   0  161   11  STSTSSTTISSSSSSSSSST
   172  205 A T  H >> S+     0   0    0  160   29  TVTVTTVVVTTTVTLVTTLV
   173  206 A A  H >4 S+     0   0    2  161   10  SAAASSAAAAAAAASAAAAA
   174  207 A E  H <4 S+     0   0   32  161    1  EEEEEEEEEEEEEEEEEEEK
   175  208 A F  H << S+     0   0    3  161   68  VVAVAAVVFVVAAVVAAAAV
   176  209 A T  S << S+     0   0    0  161   42  TTATTTTTGSSAGSTGSATT
   177  210 A T  S    S+     0   0    0  161   19  TSTSTTSSTTTTTTSTTSTS
   178  211 A L     >  +     0   0    0  161   19  LILILLIIVLLLLLLLLLVI
   179  212 A Q  H  > S+     0   0    0  161    0  QQQQQQQQQQQQQQQQQQQQ
   180  213 A M  H  > S+     0   0    0  161    4  LLLLLLLLILLLLLLLLILL
   181  214 A E  H  > S+     0   0    0  161    0  EEEEEEEEEEEEEEEEEEEE
   182  215 A F  H  X S+     0   0    0  161   22  FFFFYFFFNLLFFLFFLFFF
   183  216 A K  H  X S+     0   0    0  161   13  WRKRSSRRRKKKKKRRRKKR
   184  217 A Y  H  X S+     0   0    5  161   18  YEYEYYEEYYYYYYDYYWYE
   185  218 A L  H  X S+     0   0    0  161    1  LLLLLLLLLLLLLLLLLLLL
   186  219 A A  H  X>S+     0   0    0  161   38  SSSSSSSSSSSASTSSSAAS
   187  220 A Y  H  <5S+     0   0   49  161   81  KRYRTRRRKLLHHMRHFEHR
   188  221 A L  H  <5S+     0   0   46  161   13  VLLLIILLLLLLLLVLLLLL
   189  222 A T  H  <5S-     0   0   49  161    9  TTTTSSTTTTTTTTTTTLTT
   190  223 A G  T  <5 +     0   0   36  161   19  GGEGGGGGADDDGEGGDEGG
   191  224 A N    >>< -     0   0   63  161   44  DVDNDDNIDEENKDKNNDEA
   192  225 A R  H 3> S+     0   0  114  161   83  PQYKPPKKDEEDKKSDDPHT
   193  226 A T  H 3> S+     0   0   72  161   86  KKVKKKKKKVVEVTVVEVEK
   194  227 A Y  H <> S+     0   0    7  161    6  YFYFYYFFYYYYYYYYYYYF
   195  228 A W  H  X S+     0   0    3  160   25  GQWQDDQQAWWWWWEWWWWR
   196  229 A E  H  X S+     0   0   85  160   60  KENELSEEKEERQDQRHTRE
   197  230 A L  H  < S+     0   0   37  160   76  AAAAEEAAKKKKKKIKKKIA
   198  231 A V  H  < S+     0   0    0  160   49  AAAAATAVTAAAVASVASAV
   199  232 A E  H >< S+     0   0   15  160   11  MEEEMMEEEEEEEEFEEEEE
   200  233 A R  T 3< S+     0   0  108  160   47  REKEKKEERQQQKTKKKRRE
   201  234 A V  T 3> S+     0   0    0  159   13  VVVVVVVVVVVVVVVVVVPV
   202  235 A Y  H <> S+     0   0    0  159   59  FTMTLLTTYMMMMMSMMLMT
   203  236 A E  H  > S+     0   0   70  159   59  ERDREERKEKKRDKTRKQEK
   204  237 A P  H  > S+     0   0    9  159   61  HHVRHHRHIVVVVVHVVIVH
   205  238 A L  H  X S+     0   0    0  159   31  IVIVMMVILIIIIIIIIIVV
   206  239 A Y  H  X>S+     0   0    4  159   82  KHRHRRHHDKKKRKHKKKRH
   207  240 A K  H  <5S+     0   0  136  159   67  GSNSKTSSEDDDEEDDADNS
   208  241 A N  H  <5S+     0   0   65  159   66  LLGLLLLLIAANQAIAASAL
   209  242 A N  H  <5S-     0   0   18  159   73  PSAPPPPSSRRMPKGRRPTS
   210  243 A D  T  X> +     0   0   73  159   86  KGLGTTGGYIIINICLLKKG
   211  244 A L  H  >< +     0   0    0  159   87  LKTKVVKKPAAPKAGPPMRK
   212  245 A L  H  >5S+     0   0   45  159   71  EKSKEEKKDTTQDSEHSDLK
   213  246 A N  H  45S+     0   0  122  160   37  GDGDGGDDGGGGGGNGGGID
   214  247 A T  H  <5S+     0   0   78   37   84  ..................H.
   215  248 A Y  H ><  -     0   0   73  161   84  NNRDNNDNrNNSRNNNSDNN
   225  258 A P  T  4 S+     0   0    1  159   42  PTPTPPTTrPPYPASIAPPV
   226  259 A D  T  4 S+     0   0   56  160   59  HHSHSYHNNDDVDNNDDRMH
   227  260 A T  T  4 S-     0   0   69  161   56  SSDSSSSSKDDGTDTRNVNS
   228  261 A G     <  +     0   0    0  161    3  GGGGGGGGGGGGGGGGGNGG
   229  262 A K        -     0   0  107  161   65  TLQRQQRLKKKQSKKQQQHL
   230  263 A F  B     -E  223   0C  23  161    4  FFFFFFFFFFFFFYFYFFFF
   231  264 A G        -     0   0    9  161   88  QtITSSTTlaaLvsrElyyT
   232  265 A A  S    S+     0   0  116  153   40  GgT.GG..dssA.sgSs.g.
   233  266 A S        -     0   0   26  157   73  NGShEEhhgPPT.PTSD.Eh
   234  267 A T        -     0   0   27  155   71  NVDvNNvvk..Pd.TA.q.v
   235  268 A I  B     +FG 220 290D   2  160    9  IFIFIIFFLIIIIIIIIIVF
   236  269 A R        -     0   0   37  161   16  RTRTRRTTTRRRRRTRRRRT
   237  270 A F  S    S+     0   0    2  161    9  LLFLLLLLFLLLLLFLLLLL
   238  271 A G  S >> S-     0   0    0  161    0  GGGGGGGGGGGGGGGGGGGG
   239  272 A S  T 34 S+     0   0   38  161   12  SASASSAAASSSSSAASSSA
   240  273 A R  T 34 S+     0   0   89  161    5  RRRRRRRRMRRRRRRRRRRR
   241  274 A G  T X> S+     0   0    0  161    7  GAGAGGAAAGGGGGAAGAGA
   242  275 A D  H >X S+     0   0   20  161    0  DDDDDDDDDDDDDDDDDDDD
   243  276 A S  H 3> S+     0   0    3  161    0  SSSSSSSSSSSSSSSSSSSS
   244  277 A F  H <> S+     0   0    0  161    3  YYYYYYYYLYYYYYYFYYYY
   245  278 A Y  H XX S+     0   0    0  161    0  YYYYYYYYYYYYYYYYYYYY
   246  279 A E  H 3X S+     0   0    4  161    1  EEEEEEEEEEEEEEEEEEEE
   247  280 A Y  H 3X S+     0   0    0  161    1  YYYYYYYYYYYYYYYYYYYY
   248  281 A L  H S+     0   0    0  161    8  VQQQVVQQTQQQQQQQQQQQ
   252  285 A Y  H  X5S+     0   0   41  161   17  WWYWWWWWWYYYYYWYYYWW
   253  286 A L  H  <5S+     0   0   30  161   12  IILVVMVILIILFILLILLI
   254  287 A L  H  <5S+     0   0    0  161   36  QQQQQQQQQQQQQQQQQQQQ
   255  288 A T  H  <5S-     0   0    5  161   19  QGTGQQGGGTTTTTTTTTTG
   256  289 A H     << +     0   0   53  161   68  gqngeegggnMdnngnnggg
   257  290 A E    >>  -     0   0   14  159   15  vdeelleeee.eeeieeeed
   258  291 A T  H >> S+     0   0   90  159   60  QTQPKKPTPP.DPPDVSHDQ
   259  292 A L  H 3> S+     0   0   20  159   39  YRQQYYQQLV.VVVWVVVVR
   260  293 A Y  H <> S+     0   0    0  159   11  LLYLLLLLYY.YYYLYYYYL
   261  294 A Y  H S+     0   0    0  160   28  VIMIVVIIMVVIIVMIIIII
   272  305 A K  H  <5S+     0   0   36  160   48  KRHRKKRKHHHHKTQHHKKR
   273  306 A K  H  <5S+     0   0  147  160   38  HRHRHHRADTTKKASSKRRK
   274  307 A H  H  <5S+     0   0   23  160   29  LHDHLLHHQHHTLHKYNHLH
   275  308 A L  T  <5S+     0   0    0  160    1  LLLLLLLLLLLLLLLLLLLL
   276  309 A L  E   < +H  287   0E  35  160   27  VLVLVVLLLIIVLILIIVTL
   277  310 A A  E     -H  286   0E  22  160   73  ARRRRRRRQKKSKRRQLKKR
   278  311 A Q  E     -H  285   0E  77  161   92  KRRRKKRQTKKRKKYEKIPR
   279  312 A S     >  -     0   0    0  161   41  SSTSTTSSSSSSSSSSGSSS
   280  313 A K  T  4 S-     0   0  100  161   78  VEPEITEQTEEMAEEKVQIE
   281  314 A P  T  4 S+     0   0   90  161   65  PPKPPPPPPEEGTTPNKGHP
   282  315 A S  T  4 S-     0   0   55  161   55  NSSGNNGRSEESKESAKpSS
   283  316 A S     <  -     0   0   65  159   70  GKNKGGKKKGGNGEKKHkKK
   284  317 A L        -     0   0   11  161   17  LLMLLLLLLLLLLLLMMLPL
   285  318 A W  E     +H  278   0E 101  161   70  TTLAVVATTTTLMIPTTIPT
   286  319 A Y  E     -H  277   0E   9  161   45  FFFFFFFFYYYYYYFYWHLF
   287  320 A I  E     -H  276   0E   3  161   34  VVIVVVVVITTTVTVTTTMV
   288  321 A G        -     0   0    1  161   32  GGAGGGGGAAASSQGSAIFG
   289  322 A E  B     -I  299   0F   6  161    2  EEEEEEEEDEEEEEEEEETE
   290  323 A R  B >   +G  235   0D  42  161   71  LLLLLLLLKIILLILLLLVL
   291  324 A E  T 3  S+     0   0  101  161   66  PAsApPAANLLVliLILaeA
   292  325 A Q  T 3  S-     0   0  152  161   79  SHrHnNHHRPPPkrPPPrrH
   293  326 A G    X   -     0   0   31  161   23  GGEGGgGGNeeeAdgeqdRG
   294  327 A L  T 3  S+     0   0   30  138   37  .........ddn..vhr.m.
   295  328 A H  T 3  S+     0   0  198  139   72  R.E..n..SqqqEr.dard.
   296  329 A G  S <  S-     0   0   20  153   45  n.q.GG..Gggggg.gnpg.
   297  330 A Q        -     0   0  178  144   75  dRkR.ARRTrrrvr.rrrqR
   298  331 A L        -     0   0   46  161   33  FFLFFFFFMMMLDMYLLPLF
   299  332 A S  B     -I  289   0F  26  161   60  SSVSSSSSDIIVTISTQYVS
   300  333 A P        +     0   0   18  161   26  PAPAPPAAHPPPPPPPPNPA
   301  334 A K  E     -J  364   0G  28  161    3  KKKKKKKKKKKKKKKKKKKK
   302  335 A M  E     -J  363   0G   3  161   25  MMQMMMMMMQQQQQMQQQQM
   303  336 A D  E >   -J  362   0G   9  161    0  DDDDDDDDDDDDDDDDDDDD
   304  337 A H  G >  S+     0   0    3  161    0  HHHHHHHHHHHHHHHHHHHH
   305  338 A L  G >  S+     0   0   21  161    0  LLLLLLLLLLLLLLLLLLLL
   306  339 A V  G X  S+     0   0    3  161    4  VVVVVVVVVVVVVVAVVVVV
   307  340 A a  G X   +     0   0    0  161    1  CCCCCCCCCCCCCCCCCCCC
   308  341 A F  G <> S+     0   0    6  161    0  FFFFFFFFFFFFFFFFFFFF
   309  342 A M  H <> S+     0   0    0  161   30  LLLLLLLLMFFLLFLLLLLL
   310  343 A G  H <> S+     0   0    0  161   45  APGPPPPPGGGGGGAGGPGP
   311  344 A G  H  > S+     0   0    1  161    1  GGGGGGGGGGGGAGGGGGGG
   312  345 A L  H  X S+     0   0    4  161   69  NTSTTTTTLSSSTSTSSLST
   313  346 A L  H  X S+     0   0    0  161   31  LLLLLLLLLLLLFLLLLLML
   314  347 A A  H  X S+     0   0    0  161   33  AALAAAAAAMMMLMAMMMMA
   315  348 A S  H  X S+     0   0   12  161   30  LLLLLLLLLLLLLLLLLLLL
   316  349 A G  H  < S+     0   0    0  161   17  GGGGGGGGgggGggGggGgG
   317  350 A S  H  < S+     0   0    0  161   41  AAVAAAAVyvvApvSttVdA
   318  351 A T  H >< S-     0   0    0  161   18  THTHTTHHTTTVPTRHAHTH
   319  352 A E  T 3< S-     0   0   50  161   61  RFEHKKHHDTTTDTNTTQTH
   320  353 A G  T 3  S+     0   0   10  161    5  GGGGGGGGPGGAEGGGGGKG
   321  354 A L    <   -     0   0   30  161   64  FLQLIILLLTTELALTAKRL
   322  355 A S    >>  -     0   0   31  161   61  PPGPTTPPGTIATTPVRDPP
   323  356 A I  H 3> S+     0   0   13  161   75  EAPAKKAALEELFGDTVELA
   324  357 A H  H 34 S+     0   0  111  161   75  KDFDKKDDDQHTSPGQRLPE
   325  358 A E  H X4 S+     0   0  110  161   55  DHPHKKHHSAADETHQSDPH
   326  359 A A  H >< S+     0   0    0  161   31  AMPMAAMMTAANSVMPVQIM
   327  360 A R  T 3< S+     0   0  152  161   47  KDEELLEDrssvQsKvpKSQ
   328  361 A R  T <  S+     0   0  207  141   57  E...EE...ppp.p.pp.D.
   329  362 A R  S X  S-     0   0  109  144   88  S...NS...PPP.P.PP.V.
   330  363 A P  T 3  S+     0   0  126  150   63  G...HN...RRR.R.RT.G.
   331  364 A F  T 3  S+     0   0   47  151   95  F.W.LL...AAP.A.PA.T.
   332  365 A F    <   -     0   0   34  152   39  L.D.LL...AAD.KLES.G.
   333  366 A S     >  -     0   0   19  153   62
   334  372 A K  H  > S+     0   0  117  154   57
   335  373 A S  H  > S+     0   0   60  154   65  Q.R.EE..RRRRDRSRREE.
   336  374 A D  H  > S+     0   0    0  155   36  D.D.NN..DDDDDDFDDND.
   337  375 A W  H  X S+     0   0   15  155   64  L.W.LL..LWWWWWLWWWW.
   338  376 A D  H  X S+     0   0   73  155   83  A.I.QQ..QIILVSQKTWR.
   339  377 A L  H  X S+     0   0   11  161   28  LLTLLLLLTSSTANNTTVLL
   340  378 A A  H  X S+     0   0    0  161   23  AAGAAAAAAGGGGGVGGGGA
   341  379 A K  H  X S+     0   0   85  161   63  KREREERRKVVVKVSVSTHR
   342  380 A G  H  X S+     0   0   12  161   30  EAEADDAAAEEEGGGEQEEA
   343  381 A I  H  X S+     0   0    3  161   15  LLLLLLLLLLLLLLILLLLL
   344  382 A T  H  X S+     0   0    1  161   62  AMIMAAMMTVVVIVGIILVM
   345  383 A D  H  X S+     0   0   49  161   78  REKDKKDEYRRKRQKKEKRD
   346  384 A T  H  X S+     0   0    1  161   15  TTTTTTTTTTTTTTATTTTT
   347  385 A a  H  < S+     0   0    1  161    0  CCCCCCCCCCCCCCCCCCCC
   348  386 A Y  H >X S+     0   0   15  161   45  YYVYVVYYYMMMVMQMMYMY
   349  387 A Q  H 3X S+     0   0   38  161   69  EQEQEEQQQEEADEANDDDQ
   350  388 A M  H 3< S+     0   0    0  161   46  MMTMMMMMMTTTTTMTTTTM
   351  389 A Y  H X4 S+     0   0    3  161   16  YNYNYYNNYHHHYHYHYYYN
   352  390 A K  H 3< S+     0   0  113  161   82  NRNRFFRQARRDTKKDDNTR
   353  391 A Q  T 3< S+     0   0    3  161   91  VQTQVVQQRTTTSTNTTSRQ
   354  392 A S  S X  S-     0   0   10  161   68  TMAMTTMMMAAQSAPAPTTM
   355  393 A S  T 3  S+     0   0   47  146   68  IA.ESSEEN...K....EAE
   356  394 A S  T 3  S-     0   0    5  161   30  TTTTTTTTTTTTTTTSTSTT
   357  395 A G  S <  S+     0   0   14  161    4  GGGGGGGGGGGGGGGGGGGG
   358  396 A L        -     0   0    0  161    2  LLLLLLLLILLLLLLLLLLL
   359  397 A A        -     0   0    1  161   33  ASGSAASSSSSSASGSASSS
   360  398 A P        -     0   0    2  161   21  PPPPPPPPAPPPPPPPPPPP
   361  399 A E  S    S+     0   0   30  161    0  EEEEEEEEEEEEEEEEEEEE
   362  400 A I  E     -J  303   0G  26  161    2  IIIIIIIIYIIIIIIIIIII
   363  401 A V  E     -J  302   0G   0  161   59  AAAVAAVAVVVVVVVVAIAA
   364  402 A V  E     -JK 301 384G  11  161   72  YHHHYYHHQHHHNHYYYHFH
   365  403 A F  E     - K   0 383G   1  161    0  FFFFFFFFFFFFFFFFFFFF
   366  404 A N        +     0   0   26  161   61  rnknhhnnYkkryrnryhvn
   367  405 A D        -     0   0   41  161   60  ddpqdeqdAddddnpdddeq
   368  406 A G  S    S+     0   0   50  161   61  AQGNGGNHGHHGADGGGpAP
   369  407 A N        +     0   0  131   93   79  Q............N...sQ.
   370  408 A I              0   0   45  126   72  Y........III.V...LM.
   371  409 A K              0   0  142  150   73  KK...g.KREErkkQMRKLQ
   372      ! !              0   0    0    0    0  
   373  411 A D              0   0  193  113   54  E.D..d.....qadHD...K
   374  412 A G        +     0   0   51  131   65  D.PDggD....GGSEGEEaS
   375  413 A W        -     0   0  107   87   94  ....kk............a.
   376  414 A W  E     -L  385   0G  62  102   95  ....SS.........Y..P.
   377  415 A R  E     -L  384   0G 152  107   80  ..D.SS.........DR.I.
   378  416 A S        -     0   0    3  108   72  ..A.QE.........IV.P.
   379  417 A S  S    S+     0   0   88  117   95  ..D.YY...SSV...AG.R.
   380  418 A V  S    S-     0   0   62  134   83  ..SRVIR..AAP.K.PE.NQ
   381  419 A G  S    S+     0   0    0  149   82  ..VKNSK..HHERH.SQ.VK
   382  420 A D  S    S+     0   0    0  160   32  .DDDDDDDDDDDDDDDDDDD
   383  421 A F  E     -K  365   0G   1  161   32  IVWVIIVVFWWWWWLWWWWV
   384  422 A F  E     -KL 364 377G  26  161   83  IQYQMTQEQYYYFYSYYFYL
   385  423 A V  E     - L   0 376G   0  161   42  IVIVIIVVIIIIIIIIIIIV
   386  424 A K    >   -     0   0   72  161   35  KKKKKKKKGKKKNKKRKKKK
   387  425 A P  G >  S+     0   0   72  161   42  PPgPPPPPRgggsgPggrkP
   388  426 A L  G 3  S+     0   0  155  160   84  LAfALLAAGyyyiyLyyliA
   389  427 A D  G <  S+     0   0   23  161    1  DDDDDDDDADDDDDDDDDDD
   390  428 A R    <   +     0   0   45  161   76  RRARRRRRPAAAAAAAAGAR
   391  429 A H        -     0   0   48  161   19  HHRHHHHHHRRRRRHRRRRH
   392  430 A N  B     -M  444   0H   4  161   16  NNYNNNNNYYYYNYSYYYNN
   393  431 A L        -     0   0   33  161   13  LLILLLLLLIIIIILMIIIL
   394  432 A Q        -     0   0    0  161   44  LLLLLLLLLLLLLLLLLLLL
   395  433 A R        -     0   0   47  161    0  RRRRRRRRRRRRRRRRRRRR
   396  434 A P     >  +     0   0    0  161    0  PPPPPPPPPPPPPPPPPPPP
   397  435 A E  H  > S+     0   0   17  161    0  EEEEEEEEEEEEEEEEEEEE
   398  436 A T  H  > S+     0   0    1  161    8  TTTTTTTTATTTTTATTTTT
   399  437 A V  H  > S+     0   0    0  161    7  VVVVVVVVVVVVAVIIVVVV
   400  438 A E  H  X S+     0   0    6  161    0  EEEEEEEEEEEEEEEEEEEE
   401  439 A S  H  X S+     0   0    0  161    2  SSSSSSSSSSSSSSASSSSS
   402  440 A I  H  X S+     0   0    0  161   17  LLLLLLLLFLLLLLWLLILL
   403  441 A M  H  X S+     0   0    0  161   25  FFFFFFFFFFFFFFFFFFFF
   404  442 A F  H  X S+     0   0   11  161   42  VYLYVVYYIIIIVIYLIIIY
   405  443 A M  H  X S+     0   0    0  161   28  LLALLLLLLAAAAALAAAAL
   406  444 A Y  H  X S+     0   0   27  161   18  YYWHYHHYHWWWYWYYFFFY
   407  445 A H  H  < S+     0   0   12  161   29  RRRRRRRRQRRRRRRRRRSR
   408  446 A L  H  < S+     0   0    1  161   33  ILLLIILVLLLLVLLLLLLF
   409  447 A S  H  < S-     0   0   19  161   33  TTTTTTTTTTTTTTTTTTTT
   410  448 A H     <  +     0   0   90  161   56  GGGGEEGRGGGGGGGGGGGG
   411  449 A D    >   -     0   0   69  161   12  DDNDDDDDDDDDDDDDDDDD
   412  450 A H  T >> S+     0   0  107  161   76  SRQPPPPRPPPRPPKPVAER
   413  451 A K  H 3> S+     0   0   72  161   67  MTTKKKKKVQQRMQMIRKIK
   414  452 A Y  H <> S+     0   0    3  161    1  YYYYYYYYYYYYYYYYYYYY
   415  453 A R  H <> S+     0   0   15  161    7  RQRQRRQQRRRRRRQQRRRQ
   416  454 A E  H  X S+     0   0   99  161   46  EDDDEEDDEQQDSEDDDEED
   417  455 A W  H  X S+     0   0   19  161   17  WWQWWWWWWWWWWWWHYWWW
   418  456 A G  H  X S+     0   0    0  161    5  GGGGGGGGGGGGGGGAGGGG
   419  457 A A  H  X S+     0   0   24  161   38  WWWWWWWWWWWWWWWWWWWW
   420  458 A E  H  X S+     0   0   79  161   42  KEKERQEEEEEDTGQAKQQA
   421  459 A I  H  X S+     0   0    3  161   29  IIIIIIIIVIIIIIAIIIII
   422  460 A A  H  X S+     0   0    8  161   24  FLFLFFLLFFFFFFFFFFFL
   423  461 A T  H  X S+     0   0   52  161   61  QQQQQQQQQEEQQEQQQQQQ
   424  462 A S  H  X S+     0   0   21  161   51  ASASAASSAAAAAAASASAN
   425  463 A F  H  X S+     0   0    0  160    7  FFIFFFFFIIIIFIIIIIFF
   426  464 A F  H  X S+     0   0   56  160   83  ENENEENNEEEEEEEEEEEN
   427  465 A E  H  < S+     0   0  121  160   56  ATKAKKAKKAATKKQKKKKT
   428  466 A N  H  < S+     0   0   31  160   54  HYYYYYYYYHHHHHYHYHHY
   429  467 A T  H  < S+     0   0    0  161   38  TTTTTTTTCCCCCCACCACT
   430  468 A b  E  <  -O  441   0I   5  161   82  KRKRKKRRKRRKKRRRRKKr
   431  469 A V  E    S+O  440   0I  26  117   49  ...................v
   432  470 A D  S >  S+     0   0   80  125   86  IV.VVVVV.VV.LI.V.IV.
   433  471 A b  T 3   +     0   0   45  142   86  SP.PDDPP.AA.PEVPVQPP
   434  472 A N  T 3  S+     0   0  164  149   73  TSVSSSSS.SSLASKTETSS
   435  473 A D    X>  -     0   0   62  156   65  GGEGGGGGTGGDGGNGTGGG
   436  474 A P  T 34 S+     0   0   73  161   50  GGGGGGGGPGGSGGGGGGGG
   437  475 A K  T 34 S+     0   0  192   99   73  ..G........G....G...
   438  476 A L  T <4 S+     0   0   85   69   76  ....................
   439  477 A R     <  +     0   0   40   85   80  ........Y...........
   440  478 A R  E     -O  431   0I   9   93   75  ..G.....G..G........
   441  479 A F  E     +O  430   0I   1  161   12  YYYYYYYYYYYYYYYYYYYY
   442  480 A T        -     0   0    0  160   47  SSTSSTSSGAAAAASAAASS
   443  481 A S        -     0   0    1  160   24  SSSSSSSSASSGSSSTSSSS
   444  482 A L  E     -MN 392 454H   1  160   23  IIIILLIILVVIIVVIIIII
   445  483 A S  E    S+     0   0H  57  160   77  DSLSDDSNNLLLRLKILKDS
   446  484 A D  E     + N   0 453H  21  161   39  DnNnDDnnNNNNDNSNDDDn
   447  485 A C  S    S+     0   0    0  161   66  VqVqVVqqVVVVVVVVVVVq
   448  486 A I  S    S+     0   0    6  161   82  TDNDTTDNADDDDDKDSDDD
   449  487 A T  S    S-     0   0   43  161   78  VPDPNSPSDAADAAKENQSP
   450  488 A L  S    S+     0   0  106  161   65  AHTLLLLHVLLVLLINTLKH
   451  489 A P  S    S-     0   0  112  161   39  NNNNPPNKNPPHPPPPEPRD
   452  490 A T        -     0   0    7  161   54  SPTPPPPPGVVSVVVASVPP
   453  491 A K  E     -N  446   0H 119  160   80  YQQQPPQEKAAPQESRRVKQ
   454  492 A K  E     -N  444   0H  70  160   87  KPRPRRPPPLLKHLYQLYQP
   455  493 A S        -     0   0   46  161   61  RRERRRRRREEDEEREEEMR
   456  494 A N  S    S+     0   0   42  161   10  DDDDDDDDDDDDDDDDDDDD
   457  495 A N        -     0   0   39  161   34  KKKKKKKKSKKKRKLKKKKK
   458  496 A M        -     0   0    5  161   21  MMMMMMMMMMMMMMMMMMMM
   459  497 A E    >>  -     0   0   40  161    0  EEEEEEEEEEEEEEEEEEEE
   460  498 A S  H >> S+     0   0    3  161   24  TSTSTTSSSTTTTTSTTTTS
   461  499 A F  H 3>>S+     0   0    7  161    0  FFFFFFFFFFFFFFFFFFFF
   462  500 A W  I <4>S+     0   0    0  161    7  FFFFFFFFFLLLWLFFLLWF
   463  501 A L  I <<5S+     0   0    0  161   15  LLLLLLLVLMMMLMLLMLLL
   464  502 A A  I  <5S+     0   0    0  161   21  GGSGGGGGASSSSSASSSSG
   465  503 A E  I  X5S+     0   0    5  161    0  EEEEEEEEEEEEEEEEEEEE
   466  504 A T  I  > S+     0   0    1  161    0  KKKKKKKKKKKKKKKKKKKK
   469  507 A Y  H  X S+     0   0    0  161    0  YYYYYYYYYYYYYYYYYYYY
   470  508 A L  H  X S+     0   0    0  161   13  LLLLLLLLLLLLLLLLLLLL
   471  509 A Y  H >< S+     0   0    2  161    9  FFYYYYYYYYYYYYFYYYYY
   472  510 A I  H >< S+     0   0    0  161    8  LLLLLLLLLLLLLLLLLLLL
   473  511 A L  H 3< S+     0   0    0  161    8  LLLLLLLLLLLLLLLLLLLL
   474  512 A F  T << S+     0   0    9  161    2  FFFFFFFFQFFFFFFFFFFF
   475  513 A L    <   -     0   0   15  161   65  GSSSGGSSDSSDSSASSEGS
   476  514 A D  S    S+     0   0  104  161   43  EDDDEEDDPDDDDDDDDDDD
   477  515 A E        +     0   0  166  161   71  DDSDSSDDDEEAKDDSASRD
   478  516 A F        -     0   0   41  161   81  dmapsnpltsssnsqdttdp
   479  517 A D    >   -     0   0   70  161   50  psssppssvpppppppppps
   480  518 A L  T 3  S+     0   0   17  161    0  LLLLLLLLLLLLLLLLLLLL
   481  519 A T  T 3  S+     0   0   49  161   59  SDDDDDDDHSSDDSDDNDND
   482  520 A K  S <  S+     0   0  134  161   60  YSKAKKASKEEERKRKEKKA
   483  521 A V  E     -P  493   0J  18  161   77  FYYYYYYCHYYYYYWYYVWY
   484  522 A V  E     -P  492   0J   7  161    7  VVVVVVVVVVVVVVVVVVVV
   485  523 A F  E     -P  491   0J   3  161   10  FFFFFFFFFFFFFFFFFFLF
   486  524 A N    >   -     0   0    0  161    3  NNNNNNNNNNNNSNNNNNNN
   487  525 A T  T 3  S+     0   0   22  161    0  TTTTTTTTTTTTTTTTTTTT
   488  526 A E  T 3  S-     0   0    7  161    0  EEEEEEEEEEEEEEEEEEEE
   489  527 A A  S <  S+     0   0    0  161    6  AAAAAAAAAAAAAAAAAAAA
   490  528 A H        -     0   0    0  161    0  HHHHHHHHHHHHHHHHHHHH
   491  529 A P  E     -P  485   0J   4  161   44  PPPPPPPPPPPPPPPPPLPP
   492  530 A F  E     -P  484   0J   0  161    9  LLLLLLLLLFFLLFLLFFLL
   493  531 A P  E     -P  483   0J  26  161    1  PPPPPPPPRPPPPPPPPPPP
   494  532 A V        -     0   0   44  161   70  IIRIIVIIIIIIVIIVIIVI
   495  533 A L        -     0   0    1  154   15    F II   FFFFFYFFFFW
   496  534 A D     >  -     0   0   80  148   58    D Q    HHHTTDTTETG
   497  535 A E  H  > S+     0   0  117  147   80    P S    PPPPPHPPPPP
   498  536 A E  H  > S+     0   0  144  138   65      A    TTST   SS A
   499  537 A I  H  > S+     0   0   67  107   87      E       R   I   
   500  538 A L  H  <>S+     0   0    7  102   15      Q       F       
   501  539 A K  H ><5S+     0   0   53   53   80      T       R       
   502  540 A S  H 3<5S+     0   0   94   51   71      S               
   503  541 A Q  T 3<5S-     0   0   45   41   84      H               
   504  542 A S  T < 5 +     0   0   53   41   64      S               
   505  543 A L      < +     0   0    5   40   11      V               
   506  544 A T        -     0   0   85   39   78                      
   507  545 A T        -     0   0   48   35    9                      
   508  546 A G        +     0   0   56   35   20                      
   509  547 A W        -     0   0   24   35    0                      
   510  548 A S              0   0   88   32   56                      
   511  549 A L              0   0  109   27   12                      
 SeqNo PDBNo   V   L   I   M   F   W   Y   G   A   P   S   T   C   H   R   K   Q   E   N   D  NOCC NDEL NINS ENTROPY RELENT WEIGHT
    1   34 A   0   0   0   0   0   0   0  50  14   3  17   0   0   0   0   0   0   0   0  17    36    0    0   1.318     43  0.49
    2   35 A   3   0   0   0   0   0   0   5  43  20  10   5   0   0   0   0   0   0   5  10    40    0    0   1.688     56  0.34
    3   36 A   5   0   0   0   0   0   0  29  21   0  10  12   0   0   2   0   0   7  14   0    42    0    0   1.866     62  0.29
    4   37 A   0   0   0   0   0   0   0   1   5   0   3   1   0   0   1   0   1  74   0  12    74    0    0   0.965     32  0.72
    5   38 A   6   0   0  14   0   0   0   0   7   0   0   1   0   0  59  12   0   1   0   0   100    0    0   1.288     42  0.41
    6   39 A   0   0   0   0   0   0   0   0   1   0   1   0   0   0  73   9  16   0   0   0   131    0    0   0.815     27  0.69
    7   40 A   0   0   0   0   1   0   1   4   2   0   3   2   0   1   3   7   8  36   3  27   136    0    0   1.895     63  0.43
    8   41 A   0   1   1   0   0   0   0   1  22   0   5   0   0   3  27  21   7  12   0   0   138    0    0   1.865     62  0.25
    9   42 A  75   0  25   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   153    0    0   0.561     18  0.89
   10   43 A  22   1   3   0   0   0   0   0   0   0   0   1   0   0  27  23   1  22   0   0   153    0    0   1.599     53  0.23
   11   44 A   1   1   0   0   0   0   0   2   4   0  10   5   0   1   1   7   8  31   1  31   154    0    0   1.847     61  0.43
   12   45 A  12   0   1  11   0   0   0   0  70   0   1   5   0   0   0   0   0   0   0   0   154    0    0   0.980     32  0.55
   13   46 A   1   2   1   7  89   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   154    0    0   0.458     15  0.88
   14   47 A   5  41  12   3   0   0   0   1   1   0   0   2   0   1   3  10   6  16   0   0   154    0    0   1.863     62  0.25
   15   48 A  14  15   5   1   1   5   0   0   1   0   3   6   0  14   0   3   2  21   1   9   154    0    0   2.299     76  0.10
   16   49 A   1   0   0   0   0   0   0   0  14   0  83   3   0   0   0   0   0   0   0   0   155    0    0   0.562     18  0.75
   17   50 A   0   0   0   0   1  99   1   0   0   0   0   0   0   0   0   0   0   0   0   0   155    0    0   0.078      2  0.99
   18   51 A   1   3   1   0   0   0   1   2   5   0   6   3   0  12  12   3   2   5   7  37   155    0    0   2.126     70  0.26
   19   52 A   0   0   0   0   0   0   0  20  35   0   6   7   0   1   0   0   0   0   1  30   155    0    0   1.469     49  0.47
   20   53 A   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   155    0    0   0.000      0  1.00
   21   54 A   8   0   1   0   0   0   0   0  12   0  15   5   0   1   9   9   1  41   0   0   155    0    0   1.768     59  0.27
   22   55 A   0   3   0   0   0   0   0   0   5   0   3   5   0   1  30  37  10   4   3   1   155    0    0   1.738     58  0.40
   23   56 A   0   0   0   0   8   0  33   0   0   0   2   0   1  37   1   1   0   0   5  12   155    0    0   1.536     51  0.33
   24   57 A   0   0   0   0   0   0   0  35  63   1   1   0   0   0   0   0   1   0   0   0   155    0    3   0.759     25  0.72
   25   58 A   0   1   0   5   7  86   1   0   0   0   0   0   0   0   0   0   0   0   0   0   155    0    0   0.561     18  0.83
   26   59 A   0   0   0   0   0   0   0  97   1   0   1   0   0   0   0   0   0   1   0   1   156    0    0   0.184      6  0.96
   27   60 A   0   2   0   0  13   1  38   1   3   0   4   3   1   8   4  13   4   0   3   3   156    0    3   2.077     69  0.18
   28   61 A   0   1   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0  99   156    0    0   0.077      2  0.97
   29   62 A  29   1  12   0   0   0   0   0   0   0   0   0   0   0   3   1   4  49   0   2   156    0    0   1.358     45  0.32
   30   63 A   0   9   0   0  19   0  71   1   0   0   0   0   0   0   0   0   0   0   0   1   156    0    2   0.844     28  0.82
   31   64 A   0   0   0   1   1   0   5  11   1   0   3   0   0  49   3  15   4   2   3   1   156    0    0   1.755     58  0.30
   32   65 A   1   0   0   0   0   0   0   0   3  96   0   1   0   0   0   0   0   0   0   0   156    0    0   0.226      7  0.93
   33   66 A  24  17  51   0   0   0   0   0   2   0   2   1   0   1   2   0   1   0   0   0   156    0    0   1.331     44  0.63
   34   67 A   0   1   1   0   0   0   0   2  13   0  52  10   0   0   3   8   1   9   1   0   156    0    0   1.590     53  0.41
   35   68 A   0   0   0   0   0   0   0   6   1   0   0   0   1  17  12  45  14   3   0   0   156    0    0   1.587     52  0.38
   36   69 A   0   0   0   0   0   0   0   3   1   0  11  40   0   2  10  20   4   6   4   0   156    0    0   1.800     60  0.32
   37   70 A   0   0   0   0   4   0   3  78   3   0   9   1   0   3   1   0   0   0   0   0   156    0    0   0.902     30  0.61
   38   71 A   1   0   1   0   1   0   1   1   0   0  22   3   0  12  17  15   3  21   1   1   156    0    0   2.034     67  0.23
   39   72 A   0   1   0   0   1   0   1   0   0   0   0   1   0   3   0   0  17   3  67   8   156    0    0   1.123     37  0.62
   40   73 A   0  11   0  74   3   5   2   3   1   0   0   0   0   0   0   0   1   0   1   0   159    0    0   0.997     33  0.66
   41   74 A  12   6   6   1   4   1   1  16  23  11  11   8   0   0   0   0   0   0   0   0   159    0    0   2.154     71  0.21
   42   75 A   0   1   0   0   0   1   0  10   2  36   7   1   0   0  16   8   3  10   1   4   159  124    3   2.003     66  0.27
   43   76 A   0   0   0   0   0   0   0  43   0   0  31   3   0   3   0   3   0   3   6   9    35    0    0   1.507     50  0.40
   44   77 A   0   2   0   0   0   0   0  22  20   2   7   4   0   0   0   9   0   2  28   4    54    0    0   1.893     63  0.29
   45   78 A   0   1   1   0   0   0   0  30   3   0   1   0   0   0   2  36  12   2   8   5   147    0    0   1.711     57  0.33
   46   79 A   0   0   0   0   0   0   0  62   0  37   1   0   0   0   0   0   0   0   0   0   152    0    0   0.722     24  0.58
   47   80 A   3  68  12  15   0   0   0   0   0   0   1   1   0   0   0   0   1   0   0   0   160    0    0   1.003     33  0.78
   48   81 A   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   160    0    0   0.000      0  1.00
   49   82 A   0   5   1   0   1  80  11   0   3   0   0   0   0   0   0   0   0   0   0   0   160    0    0   0.745     24  0.77
   50   83 A   0   0  66  16   3   0   0   0   0   0   0  16   0   0   0   0   0   0   0   0   160    0    0   0.954     31  0.56
   51   84 A   6   4  89   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0   1   0   160    0    0   0.477     15  0.89
   52   85 A  78   0  22   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   160    0    0   0.525     17  0.91
   53   86 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   160    0    0   0.000      0  1.00
   54   87 A   2   0   0   0   0   0   0   0  27   0  66   5   0   0   0   0   0   0   0   0   160    0    0   0.850     28  0.62
   55   88 A   9  78  13   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   160    0    0   0.675     22  0.82
   56   89 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   160    0    0   0.000      0  1.00
   57   90 A   0   0   0   0   0   0   0   0   0   0   3  97   0   0   0   0   0   0   0   0   160    0    0   0.139      4  0.95
   58   91 A   0  51   3  44   0   0   0   0   3   0   0   0   0   0   0   0   0   0   0   0   160    0    0   0.907     30  0.84
   59   92 A   1   9  15  63   3   4   1   0   1   0   0   0   0   3   0   0   2   0   0   0   160    0    0   1.282     42  0.59
   60   93 A   3  49  44   3   0   0   0   0   0   0   0   0   0   0   0   0   1   0   0   0   160    0    0   0.958     31  0.73
   61   94 A   0   4   1  93   1   0   0   0   0   0   0   2   0   0   0   0   0   0   0   0   160    0    0   0.347     11  0.93
   62   95 A   0   1   0   0   0   0  18  17   0   0   0   0   0   1   1   1   2   1  47  11   160    0    0   1.488     49  0.31
   63   96 A   1  60   0   0   1   0   0   0   3   0   2   0   9   0   0   0   4   1  18   1   160  127   10   1.308     43  0.24
   64   97 A   0   0   0   0   0   0   0   6   0   0  67   6   0   0   0   9   6   0   3   3    33    0    0   1.210     40  0.44
   65   98 A   0   0   3   0   0   0   0   0   0   0  64  12   0   0   0   0   0   0   3  18    33    0    0   1.065     35  0.42
   66   99 A  12   0   0   0   0   0   0   0   6   3  15  50   0   0   0   3   0   9   0   3    34    0    0   1.572     52  0.29
   67  100 A   0  38   0   0   0   0   0   3   0   0   9  15   0   3  12   0   3   6   6   6    34    0    0   1.927     64  0.03
   68  101 A   0   0   0   0   0   0  47   3   0   0   0   6   0  32   6   0   0   0   6   0    34    0    0   1.324     44  0.25
   69  102 A   0   0   0   0   0   0   0   0   0   0   3   0   0   0  29  65   0   0   3   0    34    0    0   0.849     28  0.67
   70  103 A   0   9   0   0   0   0   0   0   0   0  50   0   0   0   0   9   3   9   6  15    34    0    0   1.541     51  0.22
   71  104 A   0   3   3   0   0   0   0   0   0   0   0   3   0   0  11   9  11  57   3   0    35    0    0   1.432     47  0.36
   72  105 A   0  30   0   5  65   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    37    0    0   0.799     26  0.83
   73  106 A   0   4   3   0   0   0   0   0   2   6   2  46   0   1   3   9   2  10   1  11   161    0    0   1.885     62  0.28
   74  107 A   0   0   0   0   0   0   0   2  12   2  29  10   0   1   2  11   2  20   1   9   161    0    0   2.023     67  0.29
   75  108 A   2   0   1   0   0   0   1   2   1   5   1   0   0   1  28   1  12  44   1   1   161    0    0   1.590     53  0.36
   76  109 A  37  26  19   0   7   0  11   0   0   0   0   0   0   0   0   1   0   0   0   0   161    0    0   1.491     49  0.54
   77  110 A   1   6   1   1   0   1   0   5  11   0   9   4   0   2   4   6  36  10   2   2   161    0    0   2.205     73  0.25
   78  111 A   0   1   1   0   0   0   0   0   1   0   1   1   0  18  32   4   8  15  10   9   161    0    0   1.927     64  0.34
   79  112 A   5   0   1   0   0   0   0   1  76   0  14   0   2   0   0   0   0   0   0   0   161    0    0   0.811     27  0.67
   80  113 A   0   0   0   0   0   0   0   1   1   0   2   2   0   0  69   2   6  15   0   1   161    0    0   1.117     37  0.51
   81  114 A   1   1   0   1   0   0   1   2   2   0   6   4   0  11   7  17   5  19  12  13   161    0    0   2.307     77  0.29
   82  115 A   0   0   0   0   1  98   1   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.105      3  0.99
   83  116 A  22  12  64   0   0   0   0   0   0   0   0   0   2   0   0   0   0   0   0   0   161    1    0   0.951     31  0.78
   84  117 A   0   1   0   0   0   0   0   1  10   0  17   3   0  18   8  14   9   6   9   6   160    0    0   2.230     74  0.23
   85  118 A   0   0   0   0   0   0   0   0   0   0   4  20   0   4  10  11   1   7  22  22   161    0    0   1.948     65  0.32
   86  119 A  11   0   0   0   0   0   0   2   1   0  37   5   0   3   0   6   3  15   6  12   161    0    0   1.941     64  0.26
   87  120 A   0  96   1   1   0   0   0   0   0   0   0   0   0   1   0   0   1   0   0   1   161    0    0   0.217      7  0.94
   88  121 A   0   1   0   1   0   0   1   0   1   0  11  29   0   5   9   1   6   0   7  29   161    0    0   1.899     63  0.27
   89  122 A   0   0   0   0  27  16  53   0   0   0   0   0   0   1   0   2   0   0   1   0   161    1   11   1.146     38  0.83
   90  123 A   1   0   0   0   0   0   0   0   1   0   3   3   0   1   1   1   6   9  12  62   160    0    0   1.367     45  0.63
   91  124 A   4   1  17   3  11   0   1   2   0   0   0   1   0   1   5   9  43   1   0   1   161    0    0   1.837     61  0.16
   92  125 A   1   0   0   0   0   0   0   0   0   1   1   0   0   1   0   2   1   1  10  83   161    0    0   0.692     23  0.81
   93  126 A   3   0   1   0   0   0  12   9  17   0   6   2   0  16   1   0  29   2   1   2   161    0    0   2.055     68  0.16
   94  127 A   0   0   0   0   0   0   1   0   0   8   2   1   0   0   1   2   6  29   9  40   161    0    0   1.648     55  0.50
   95  128 A  83   1   4   2   9   0   1   0   1   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.665     22  0.77
   96  129 A   0   0   0   0   0   0   0   0   0   0   9   0   0   1   0   0   0   0  90   0   161    0    0   0.347     11  0.84
   97  130 A  24  10   4   0   0   0   0   0   2   0   0  58   0   0   0   0   0   0   2   0   161    0    0   1.175     39  0.45
   98  131 A   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.000      0  1.00
   99  132 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   161    0    0   0.000      0  1.00
  100  133 A   1   0   1   1   0   0   0   0   1   0   3  93   0   0   0   0   0   0   0   0   161    0    0   0.375     12  0.87
  101  134 A   0   0   0   0   0   0   0   0   0   0   1  99   0   0   0   0   0   0   0   0   161    0    1   0.038      1  0.99
  102  135 A   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.000      0  1.00
  103  136 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   161    0    0   0.000      0  1.00
  104  137 A  10   4   4  79   0   0   0   0   1   0   0   1   0   0   0   0   0   0   0   1   161    0    0   0.816     27  0.75
  105  138 A   1  93   2   4   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.337     11  0.96
  106  139 A   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.000      0  1.00
  107  140 A   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.000      0  1.00
  108  141 A   0  99   0   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.067      2  1.00
  109  142 A   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.000      0  1.00
  110  143 A   0   0   0   0   0   0   0   1   2   0  97   0   0   0   0   0   0   0   0   0   161    0    0   0.154      5  0.95
  111  144 A   1   0   1   0   0   0   0   1  94   0   2   1   0   0   0   0   0   0   0   0   161    0    0   0.324     10  0.90
  112  145 A   0   0   0   0   8   0  36   0   1   0   0   0   0  55   0   0   0   0   0   0   161    0    0   0.930     31  0.53
  113  146 A   0   0   0   0   1   0  56   0   1   0   0   1   0  40   0   0   0   0   0   1   161    0    0   0.863     28  0.54
  114  147 A   1  86   4   0   4   3   1   0   0   0   0   0   1   0   0   0   0   0   0   0   161    0    0   0.639     21  0.85
  115  148 A   0   0   1   0   0   0   0   0   7   0  83   9   0   0   0   0   1   0   0   0   161   13   85   0.627     20  0.75
  116  149 A   1   0   0   1   0   0   0   3   0   1   3   5   0   1   0   9   3  20  10  43   148  105    5   1.790     59  0.48
  117  150 A  23  19   0   0   0   0   0   2   5   0   0  19   0   0   0   0   7  21   0   5    43    0    0   1.851     61  0.17
  118  151 A   1  31   2   2   2   0   2   0   1   4   2   0   0   0   0   0   0   0   0  52    96    0    0   1.334     44  0.14
  119  152 A   0   1   0   0   0   0   0   5   3   1   4   3   0   2   1   4   3  14   4  54    98    0    0   1.694     56  0.49
  120  153 A  36   4   6   1   0   0   0   0   8  11   3   3   0   1   1   1   0  17   0   8   108    0    0   1.997     66  0.22
  121  154 A   0   0   0   0   0   0   0  78  10   3   4   2   0   0   0   1   1   0   0   2   125    0    0   0.881     29  0.74
  122  155 A   0   0   1   0   0   0   0   1  25   1  13   3   0   1   1   3   3   2  21  26   159    0    0   1.869     62  0.35
  123  156 A   0   1   1   0   0   0   0   1   9  34   8   1   0   0   7  11   3   2   2  19   161   42   78   1.977     66  0.29
  124  157 A   0   0   0   0   3   0   3   1   3   3   8  16   0   1   0   1   4   4   4  49   119    0    0   1.793     59  0.32
  125  158 A  28  51  11   6   1   0   0   0   1   1   0   0   0   0   1   0   0   0   0   0   160    0    0   1.284     42  0.67
  126  159 A   0   2   0   0  11   0  86   1   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.488     16  0.93
  127  160 A   2  77  17   0   0   0   0   0   2   0   0   0   0   0   1   0   0   1   0   0   161    0    0   0.734     24  0.78
  128  161 A   0   0   0   0   0   0   0   0   5   0   6   3   0   0   0   2   3  47  15  19   161    0    0   1.569     52  0.52
  129  162 A   1   5   0   0   0   0   0   0   0   0   0   0   0   0   6  87   1   0   0   0   161    0    0   0.541     18  0.78
  130  163 A   0   0   0   0   0   0   1   0  98   0   1   0   0   0   0   0   0   0   0   0   161    0    0   0.105      3  0.97
  131  164 A  24   0  22   1   0   0   0   0   4   0   1  21   0   0   4  17   1   5   0   0   161    0    0   1.834     61  0.26
  132  165 A   0   1   0   0   0   0   0   8   0   0   1   0   0   0   1   1   4   7   0  78   161    1    0   0.869     28  0.79
  133  166 A   0  97   0   0   3   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0   160    0    0   0.155      5  0.97
  134  167 A   0   1   0   0   0   0   0  31  67   0   1   0   1   0   0   0   0   0   0   0   161    0    0   0.726     24  0.72
  135  168 A   0   0   0   0   0   0   0   1   2   0   1   2   0   1   1   1   0  10  11  70   161    0    0   1.120     37  0.70
  136  169 A   0   0   1   0   0   0   0   1   4   0   4   0   1   0  88   1   0   0   1   1   161    0    0   0.587     19  0.77
  137  170 A   0  93   5   2   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.327     10  0.93
  138  171 A   4  51   6  15   0   0   0   1  13   0   4   2   0   3   0   1   0   0   1   1   161    1    0   1.631     54  0.44
  139  172 A   3  13   0   2   0   0   0  39   9  17  11   1   1   1   1   1   0   1   1   1   160    0    0   1.855     61  0.26
  140  173 A   1   0   2   0   0   0   0   5  88   0   4   0   1   0   1   0   0   0   0   0   161    0    0   0.557     18  0.82
  141  174 A   0   2   0   0  80   0  17   0   1   0   1   0   0   0   0   0   0   0   0   0   161    0    0   0.624     20  0.94
  142  175 A   1  11   1   1   1   0   1   1   2   0   6   6   0   0   1   1   1  32   6  30   161    0    1   1.927     64  0.31
  143  176 A   1   1   0   0   0   0   1   1   2   0  66  19   1   0   1   0   6   1   1   1   161  116    2   1.194     39  0.51
  144  177 A   0   0   0   0   0   0   0   0   2   0  51  40   0   0   2   0   0   0   4   0    45    1    0   1.017     33  0.47
  145  178 A   0   0   0   1   0   0   0   3   1  55   2   3   0   1   1  13   9   6   4   2   158    0    0   1.619     54  0.42
  146  179 A   3   0   1   0   0   0   1   0   0   0  68  25   0   0   1   1   0   0   0   1   159    0    0   0.901     30  0.56
  147  180 A   0   0   1   0   0   0   0  92   4   0   1   0   0   0   0   3   0   0   0   0   160    0    0   0.373     12  0.86
  148  181 A  20   9  69   0   0   0   0   0   0   1   0   1   0   0   0   0   0   0   1   0   161    0    0   0.893     29  0.80
  149  182 A   0   0   0   0   0   0   1   1   0  98   1   0   0   0   0   0   0   0   0   0   161    0    0   0.113      3  0.96
  150  183 A   0   9   0   0   9   5  73   1   1   0   0   0   0   0   1   1   0   0   0   0   161    0    0   0.968     32  0.75
  151  184 A   0   0   1   0   0   0   0   1  49   2  47   0   0   0   1   0   1   0   0   0   161    0    0   0.906     30  0.56
  152  185 A   1   0   0   1   2   0   1   4   0   1  77   1   0   0   1   0   2   1   1   7   161    1    0   1.040     34  0.58
  153  186 A  55   3  38   0   3   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0   160    0    0   0.945     31  0.80
  154  187 A   3   0   1   0   0   0   0   0   0   0   0   0   0   4   0   0   1   0  91   1   161    0    0   0.437     14  0.84
  155  188 A   1  94   5   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.272      9  0.93
  156  189 A   1   1   0   1   0   0   0  11  14   0   2   0   1  15   8  20   3   5  17   1   161    0    0   2.151     71  0.23
  157  190 A   1   1   0   1   0   0   0   0   2   0  22  43   0   1   2  18   3   4   1   2   161    0    0   1.678     56  0.35
  158  191 A   0   1   0   2   6   0   6  42   1   0  19   0   0   0  19   5   0   0   0   0   161   13    1   1.620     54  0.20
  159  192 A  10   1   3   0   0   0   0   0   3   0   2   5   0   0   2  25  26  20   3   1   148    0    0   1.936     64  0.28
  160  193 A   2   0   0   0   1   0   0  65  23   1   2   3   1   0   1   2   0   0   0   1   159    0    0   1.114     37  0.61
  161  194 A  25   8  48   1   1   0   0   1   6   0   3   1   0   1   0   1   1   1   0   0   161    0    0   1.573     52  0.52
  162  195 A   6   2   1   1   0   0   1   0   5  30   0   0   0   4   9  31   2   8   1   0   161    0    0   1.880     62  0.27
  163  196 A   1   0   1   1   0   0   0   0   2   2  48   1   0   1   0   2   0   1  29  11   161    1    0   1.466     48  0.39
  164  197 A   0   1   0   1   1   0   3   1   4   5   1   0   0  74   6   3   0   0   1   1   160    0    0   1.151     38  0.54
  165  198 A  18   0   0   7   1   1   0   6  35   1   6   9   0   0   2   0   2   1   1  11   161    0    0   2.015     67  0.25
  166  199 A   1   1   1   0   1   4   0   2   0   1   1   0   0   1   2   0   0   2  11  74   161    0    0   1.081     36  0.56
  167  200 A   0   0   1   7   2   0   1  31   2   1   3   3   0   0   4   1   4   1  31   7   161    0    0   1.965     65  0.29
  168  201 A   0   0   0   0   0   0   2  89   0   1   4   1   0   0   0   0   0   1   1   1   161    0    0   0.514     17  0.82
  169  202 A   3   6   0   2   2   1   1   0  71   1   6   1   1   0   0   0   0   2   1   4   161    0    0   1.261     42  0.49
  170  203 A   5   0   2   0   0   0   0   0   5   0  87   1   0   0   0   0   0   0   0   0   161    0    0   0.549     18  0.75
  171  204 A   0   1   1   0   0   0   0   0   1   1  94   4   0   0   0   0   0   0   0   0   161    1    0   0.309     10  0.88
  172  205 A   5   8   0   3   0   0   0   0   0   0   0  84   0   0   0   0   0   0   0   0   160    0    0   0.596     19  0.70
  173  206 A   0   0   0   0   0   0   0   0  93   0   7   0   0   0   0   0   0   0   0   0   161    0    0   0.249      8  0.89
  174  207 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1   0  99   0   0   161    0    0   0.038      1  0.99
  175  208 A  17   0   1   0  21   0   0   0  57   0   1   2   1   0   0   0   0   0   0   0   161    0    0   1.162     38  0.32
  176  209 A   0   0   0   0   0   0   0   9  22   0   7  61   0   0   0   0   0   0   0   0   161    0    0   1.052     35  0.57
  177  210 A   0   0   0   0   0   0   0   0   0   0  13  87   0   0   0   0   0   0   0   0   161    0    0   0.387     12  0.81
  178  211 A  20  75   4   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   161    0    0   0.712     23  0.81
  179  212 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   161    0    0   0.000      0  1.00
  180  213 A   0  85   1  14   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.464     15  0.95
  181  214 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   161    0    0   0.000      0  1.00
  182  215 A   0  10   0  17  71   0   1   0   0   0   0   0   0   0   0   0   0   0   1   0   161    0    0   0.837     27  0.78
  183  216 A   0   0   0   0   0   1   0   0   0   0   1   0   0   0   9  88   0   0   0   0   161    0    0   0.441     14  0.86
  184  217 A   0   0   0   0   1   1  93   0   0   0   0   0   0   0   0   0   2   3   0   1   161    0    0   0.371     12  0.81
  185  218 A   1  99   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.075      2  0.99
  186  219 A   0   0   0   0   0   0   0   0  59   0  40   1   0   0   0   0   0   0   0   0   161    0    0   0.709     23  0.62
  187  220 A   1   1   0   1   4   0  22   0   1   0   0   1   0  12   5  45   2   2   3   0   161    0    0   1.695     56  0.18
  188  221 A   7  86   6   0   0   0   0   0   1   0   0   1   0   0   0   0   0   0   0   0   161    0    0   0.535     17  0.86
  189  222 A   0   1   1   1   0   0   0   0   0   0   2  95   0   0   0   0   0   0   0   0   161    0    0   0.263      8  0.91
  190  223 A   0   0   0   0   0   0   0  88   1   0   1   0   0   0   1   2   2   2   0   3   161    0    0   0.599     20  0.81
  191  224 A   2   0   1   0   0   0   0   0   1   0   1   0   0   0   0   2   0  47  31  16   161    0    0   1.267     42  0.56
  192  225 A   4   0   2   1   0   0   3   0  16   9   4   9   0   1  11  19   1  10   2   7   161    0    0   2.392     79  0.17
  193  226 A  11   9   6   1   1   0   1   0   1   0   4  17   0   4   4   9   1  11  12   9   161    0    0   2.427     81  0.14
  194  227 A   0   1   0   0  20   6  73   0   0   0   0   0   0   1   0   0   0   0   0   0   161    1    0   0.773     25  0.93
  195  228 A   0   0   0   0   0  92   0   1   1   0   0   0   0   0   1   0   3   1   0   1   160    0    0   0.421     14  0.75
  196  229 A   0   1   1   0   0   0   0   0   0   0   2   1   0   1  14  15   9  34   5  16   160    0    0   1.845     61  0.39
  197  230 A   6  23   2   1   0   0   0   0  13   0   1   1   0   1   7  45   0   1   0   0   160    0    0   1.578     52  0.23
  198  231 A  41   0   0   0   0   0   0   0  52   0   4   1   1   0   0   0   0   0   0   0   160    0    0   0.927     30  0.51
  199  232 A   0   0   0   3   1   0   0   0   0   0   1   0   0   0   0   0   1  94   0   2   160    0    0   0.322     10  0.88
  200  233 A   0   0   0   1   0   0   0   1   3   0   0   1   0   2  17  57   8   4   6   0   160    1    0   1.433     47  0.52
  201  234 A  85   1   9   0   0   0   0   0   4   1   0   1   0   0   0   0   0   0   0   0   159    0    0   0.581     19  0.86
  202  235 A   0   2   4  61   2   0  21   0   1   0   2   7   0   0   0   0   0   0   0   0   159    0    0   1.210     40  0.40
  203  236 A   0   1   0   0   1   0   0   0   3   3   1   3   0   0   5  20  23  36   0   4   159    0    0   1.744     58  0.40
  204  237 A  53   3   9   1   1   0   0   0   3  20   1   1   0   6   2   1   0   0   0   0   159    0    0   1.497     49  0.38
  205  238 A  30  40  23   3   3   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0   159    0    0   1.300     43  0.68
  206  239 A   0   2   0   1   3   0  19   0   0   0   1   0   0   4   8   7   0  14   0  42   159    0    0   1.712     57  0.17
  207  240 A   0   1   0   1   0   0   0   8  12   0  13   1   0   1   3  13   3  13   8  26   159    0    0   2.138     71  0.32
  208  241 A   3   9   3   0   0   0   0   2   6   0   1   0   0   1   0   1  18   3  51   3   159    0    0   1.638     54  0.34
  209  242 A   0   0   1   1   0   0   0  21   7   7   3   1   0   4   4  15   8   2  26   1   159    0    0   2.125     70  0.27
  210  243 A   1   2   5  18   0   0   1   4  14  18   3   3   1   0   4   6   1   1   5  14   159    0    0   2.368     79  0.13
  211  244 A   3  20   1   1   0   3   3   1   3   3   1   5   0   3   3  12  16  22   2   1   159    0    0   2.298     76  0.12
  212  245 A   1  16   1   1   0   0   0   5   4   3   4   3   0   1   0   3   1   3   2  52   159    0    0   1.765     58  0.28
  213  246 A   0   0   2   0   0   0   0  73   2   0   3   0   0   2   0   2   1   1  10   6   160  123   11   1.075     35  0.63
  214  247 A   0   0   0   0   0   0   3   0  16  11   5  32   0  11   5   8   8   0   0   0    37    0    0   1.962     65  0.15
  215  248 A   0   8   0   5   8   8  70   0   0   0   0   0   0   0   0   0   0   0   0   0    37    0    0   1.017     33  0.73
  216  249 A   2   2   5   0   0   0   0   0   0   0   2   2   0   2   0   2  10   2   5  64    42    0    0   1.421     47  0.46
  217  250 A   0   0   0   0   0   0   0  98   0   0   2   0   0   0   0   0   0   0   0   0    49    0    0   0.100      3  0.98
  218  251 A   1  95   4   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   158    0    0   0.219      7  0.95
  219  252 A  69  14   2   1   1   0   1   0  11   0   1   1   1   0   0   0   0   0   0   0   160    0    0   1.063     35  0.63
  220  253 A   0   0   0   0   0   0   0   0   0  96   4   0   0   0   0   0   0   0   0   1   160    0    0   0.198      6  0.93
  221  254 A   3   0  93   4   0   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   160    0    0   0.313     10  0.92
  222  255 A   0   2   0   0  44   0  49   3   0   0   1   1   0   0   0   0   0   0   0   0   160    0    0   0.962     32  0.82
  223  256 A  27   7  43   3   1   0   0   0   0   0   0  19   0   0   0   0   0   0   0   0   161    0    0   1.376     45  0.55
  224  257 A   1   2   1   2   9   0  25   1   0   0   6   0   0   7   2   0   5   4  25   9   161    2    1   2.138     71  0.16
  225  258 A   3   2   1   0   0   0   1   0  23  66   1   3   0   0   1   0   0   0   0   0   159    0    0   1.061     35  0.58
  226  259 A   2   0   1   1   0   0   1   0   2   1   6  13   0   5   1   1   7   8   6  47   160    0    0   1.857     61  0.40
  227  260 A   1   0   0   1   0   0   0   1   0   1  25  54   0   2   1   2   0   0   8   5   161    0    0   1.378     45  0.44
  228  261 A   0   0   0   0   0   0   0  97   2   0   0   0   0   0   0   0   0   0   1   1   161    0    0   0.168      5  0.96
  229  262 A   1   2   1   2   0   0   0   1   2   0   3   3   0   7  11  43   9  12   3   0   161    0    0   1.947     64  0.35
  230  263 A   0   0   0   0  84   0  15   0   0   0   1   0   0   0   0   0   0   0   1   0   161    0    0   0.495     16  0.95
  231  264 A   6   2   2  13   4   2   1   7   2   0   4  11   0   1  22   4  17   1   0   0   161    8    9   2.356     78  0.11
  232  265 A   0   0   0   0   1   0   1  65  12   0   5  12   1   1   0   0   0   0   1   3   153    0    0   1.195     39  0.60
  233  266 A   0   0   0   0   1   0   0   3   2   4  24   2   0   6   8   7  11  15   8  10   157    5    5   2.267     75  0.26
  234  267 A   5  10   1   0   0   0   2   0   3   1   0  13   0   1   0   1   1  14  46   3   155    0    0   1.747     58  0.28
  235  268 A   6   1  88   0   5   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   160    0    0   0.466     15  0.90
  236  269 A   0   0   0   0   0   0   0   0   0   0   0   6   0   0  92   2   0   0   0   0   161    0    0   0.324     10  0.84
  237  270 A   1  81   2   1  14   1   1   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.663     22  0.90
  238  271 A   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.000      0  1.00
  239  272 A   0   0   0   0   0   0   0   0   8   0  92   0   0   0   0   0   0   0   0   0   161    0    0   0.281      9  0.87
  240  273 A   0   0   0   1   0   0   0   0   0   0   0   0   0   2  97   0   0   0   0   0   161    0    0   0.159      5  0.95
  241  274 A   0   0   0   0   0   0   0  93   7   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.249      8  0.92
  242  275 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   161    0    0   0.000      0  1.00
  243  276 A   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   161    0    0   0.000      0  1.00
  244  277 A   0   1   0   0  19   0  80   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.526     17  0.97
  245  278 A   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.000      0  1.00
  246  279 A   0   0   0   0   0   0   0   1   1   0   0   0   0   0   0   0   0  99   0   0   161    0    1   0.075      2  0.98
  247  280 A   1   0   0   0   0   0  99   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.038      1  0.99
  248  281 A   0  99   0   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   1   0   161    0    0   0.075      2  0.98
  249  282 A   0  50  46   1   0   0   0   1   1   1   1   0   0   0   0   0   0   0   0   0   161    0    0   0.909     30  0.68
  250  283 A   0   0   1   0   0   0   0   0   0   0   0   0   0   0   0  99   0   0   0   0   161    0    0   0.038      1  0.98
  251  284 A   2   0   0   0   0   0   0   0   0   0   0   1   0   0   0   1  96   0   0   0   161    0    0   0.191      6  0.91
  252  285 A   0   0   0   0   4  11  80   0   0   0   1   0   0   1   0   1   0   0   1   1   161    0    0   0.772     25  0.82
  253  286 A   2  89   6   1   1   0   0   0   0   0   0   0   0   1   0   0   1   0   0   0   161    0    0   0.501     16  0.87
  254  287 A   0  16   0   2   1   0   0   0   0   0   0   0   0   1   0   0  81   0   0   0   161    0    0   0.604     20  0.64
  255  288 A   0   2   1   1   0   0   0   4   0   0   1  90   0   0   0   0   2   0   0   0   161    0    0   0.478     15  0.81
  256  289 A   0   0   0   1   1   0   1  13   1   0  24   0   0  14   2   4   3   2  33   1   161    2  110   1.844     61  0.31
  257  290 A   3   1   1   0   0   0   0   1   0   0   0   0   0   0   0   0   1  91   1   2   159    0    0   0.457     15  0.84
  258  291 A   2   3   0   0   0   0   0   1   0  56   5  15   0   1   1   7   4   3   1   3   159    0    0   1.596     53  0.40
  259  292 A  30  19  43   0   0   1   3   0   1   0   0   0   0   0   1   0   3   0   0   0   159    0    0   1.345     44  0.61
  260  293 A   0   6   0   0   0   0  94   0   0   0   0   0   0   0   0   0   0   0   0   0   159    0    0   0.235      7  0.89
  261  294 A   0  23   0   0   1   8  19   1   1   0   1   0   0   0  21   9   6   8   1   0   159    0    0   2.021     67  0.13
  262  295 A   0   0   1   0   0   0   0   1   1   0   1   2   0   0   1   5   4  33   3  50   159    0    0   1.353     45  0.65
  263  296 A   0  26   1  67   0   0   0   0   2   0   0   0   0   0   0   0   0   1   0   4   159    0    0   0.896     29  0.76
  264  297 A   0   0   0   0   3  43  54   0   0   0   0   0   0   1   0   0   0   0   0   0   160    0    0   0.837     27  0.85
  265  298 A   1   4   1   0   0   0   4   0   1   0   3   1   0   3  24   4   3   8  14  30   160    0    0   2.025     67  0.25
  266  299 A   3   1   3   0   1   0   0   0   4   0   0   3   0   3   0  11   5  59   1   8   160    0    0   1.547     51  0.46
  267  300 A   1   0   0   0   0   0   0   0  51   0  44   4   0   0   0   0   0   0   0   0   160    0    0   0.873     29  0.58
  268  301 A  17  42   6  33   1   0   0   0   0   0   0   0   1   0   0   0   0   0   1   0   160    0    0   1.299     43  0.72
  269  302 A   5   0   0   8   0   0   1   3  16   0   1   9   0   1   5   2   4  31   4  11   160    0    0   2.167     72  0.27
  270  303 A   0   0   0   0   0   0   0  93   5   0   2   1   0   0   0   0   0   0   0   0   160    0    0   0.328     10  0.91
  271  304 A  42   0  40  17   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0   160    0    0   1.068     35  0.71
  272  305 A   0   1   1   1   0   0   0   0   2   0   1   1   0   4  41  41   5   3   0   0   160    0    0   1.406     46  0.52
  273  306 A   0   0   0   0   0   0   0   0   1   0   2   3   0   4  12  70   1   5   1   1   160    0    0   1.155     38  0.61
  274  307 A   0   4   0   0   0   0   3   0   0   0   0   1   0  83   1   3   1   1   4   1   160    0    0   0.789     26  0.71
  275  308 A   0  94   0   6   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   160    0    0   0.234      7  0.98
  276  309 A  45  26  28   1   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   160    0    0   1.150     38  0.73
  277  310 A   1   1   0   0   1   0   0   9  19   0   6  38   0   1  15   5   1   0   4   1   160    0    0   1.843     61  0.26
  278  311 A   0   2   1   0   1   0  37   0   1   1   1   6   0   3   9  22  11   2   0   2   161    0    0   1.914     63  0.08
  279  312 A   0   0   0   0   0   0   0   1   0   0  55  45   0   0   0   0   0   0   0   0   161    0    0   0.722     24  0.58
  280  313 A   5   1   3   1   1   0   6   0   2   1   9   4   0   4   5  39   6  13   1   0   161    0    0   2.123     70  0.22
  281  314 A   0   0   1   0   2   0   1   4   0  52   1   2   0  17   0   7   0   1  12   0   161    0    0   1.536     51  0.34
  282  315 A   0   0   0   0   0   0   0   3  21   1  50   1   1   1   1   2   2   3  13   2   161    2    5   1.559     52  0.44
  283  316 A   0   0   0   0   0   0   0  26   3   0  19   0   0   6   3  16   6   4  15   2   159    0    0   1.984     66  0.30
  284  317 A   1  71   1   2  19   1   6   0   0   1   0   0   0   0   0   0   0   0   0   0   161    0    0   0.923     30  0.82
  285  318 A   7   9   4   4   0   8   0   0   4   1   0  55   0   2   0   4   1   0   0   0   161    0    0   1.653     55  0.29
  286  319 A  16   1  19   1  30   1  32   0   0   0   0   0   0   1   0   0   0   0   0   0   161    0    0   1.479     49  0.54
  287  320 A  19  17  55   1   1   0   0   0   0   0   0   9   0   0   0   0   0   0   0   0   161    0    0   1.218     40  0.65
  288  321 A   0   0   1   0   1   0   0  71  21   0   2   0   0   1   0   0   3   0   0   0   161    0    0   0.890     29  0.68
  289  322 A   0   0   0   0   0   0   0   0   1   0   0   1   0   0   0   0   0  98   0   1   161    0    0   0.113      3  0.97
  290  323 A   1  40   2   0   1   0   0   0   0   0   0   0   0   0  45  11   0   0   0   0   161    0    0   1.122     37  0.28
  291  324 A   1   4   1   1   0   0   2   0   4  56   1   1   0   4   0   0   1  18   1   4   161    0   13   1.575     52  0.33
  292  325 A   0   0   0   1   3   2   1   3   4   4  14   2   0   9   7   4  10   2  27   4   161    0    0   2.382     79  0.20
  293  326 A   0   0   1   0   0   0   0  85   1   4   1   2   0   0   1   0   1   3   1   2   161   23    9   0.729     24  0.77
  294  327 A   5  63  23   1   1   0   1   0   0   1   0   1   0   1   1   0   1   0   1   2   138   14   19   1.186     39  0.62
  295  328 A   0   0   0   0   0   0   0  19   3   0   4   6   0  22  10   2   3   5  14  12   139    0    0   2.133     71  0.27
  296  329 A   0   0   0   0   0   0   0  62   2   1   1   1   0   2   0   3   6  14   5   3   153   16   32   1.400     46  0.55
  297  330 A   3   1   0   0   0   0   1   4   8  26   4   1   0   1  10  15  13   7   3   2   144    0    0   2.277     76  0.24
  298  331 A   2  64   4   4  17   0   1   0   1   1   1   2   0   0   0   1   2   0   0   1   161    0    0   1.320     44  0.67
  299  332 A  12   5   2   3   1   0   1   0   0   0  65   2   0   2   0   0   1   1   0   4   161    0    0   1.338     44  0.40
  300  333 A   0   0   0   0   1   0   0   0   4  83   6   4   0   1   0   0   0   0   3   0   161    0    0   0.735     24  0.73
  301  334 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1  98   2   0   0   0   161    0    0   0.130      4  0.96
  302  335 A   0   1   1  86   1   0   0   0   0   0   0   0   0   0   0   0  11   0   0   0   161    0    0   0.489     16  0.74
  303  336 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1   0  99   161    0    0   0.038      1  1.00
  304  337 A   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   161    0    0   0.000      0  1.00
  305  338 A   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.000      0  1.00
  306  339 A  98   1   0   0   0   0   0   0   2   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.130      4  0.96
  307  340 A   0   0   0   0   0   0   0   1   0   0   0   0  99   0   0   0   0   0   0   0   161    0    0   0.038      1  0.99
  308  341 A   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.000      0  1.00
  309  342 A   1  37   4  43   2   0  12   0   1   0   0   0   0   0   0   0   0   0   0   0   161    0    0   1.256     41  0.69
  310  343 A   0   0   0   0   0   0   0  45   3  50   1   0   0   0   0   0   0   0   0   0   161    0    0   0.867     28  0.54
  311  344 A   0   0   0   0   0   0   0  99   1   0   1   0   0   0   0   0   0   0   0   0   161    0    0   0.075      2  0.98
  312  345 A   1  29   0   1   0   0   0   0   2   0  12  50   0   0   0   0   0   0   3   0   161    0    0   1.273     42  0.31
  313  346 A   1  45  40   3   7   0   3   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   1.166     38  0.69
  314  347 A   0   6   1   7   0   0   0   1  82   0   3   0   0   0   0   0   0   0   0   0   161    0    0   0.700     23  0.66
  315  348 A   5  68   1  16   0   2   0   0   0   0   8   0   0   0   0   0   0   0   0   0   161    0    0   1.031     34  0.69
  316  349 A   0   0   0   0   0   0   0  80  19   0   0   0   0   0   1   0   0   0   0   0   161    0    9   0.526     17  0.82
  317  350 A  11   0   2   0   0   0   1   0  72   1   9   4   0   0   0   0   0   0   0   1   161    0    0   1.003     33  0.59
  318  351 A   1   0   0   0   0   0   1   0   1   1   0  91   0   4   1   1   0   1   0   0   161    0    0   0.440     14  0.81
  319  352 A   1   1   0   0   2   0   0  36   0   0   1   4   0   2   2   2   1  32  11   4   161    0    0   1.732     57  0.39
  320  353 A   0   0   0   0   0   0   0  97   1   1   0   0   0   0   0   1   0   1   0   1   161    0    0   0.188      6  0.95
  321  354 A   4  58   7   0   1   0   2   4   2   0   0   4   0   1   8   4   1   1   0   1   161    0    0   1.648     55  0.35
  322  355 A   1   0   1   0   0   0   0   1   1  39  12  35   0   1   1   5   1   0   1   2   161    0    0   1.562     52  0.38
  323  356 A   8  29  25   0   1   0   6   1   3   1   0   1   0   0   4   1   0  21   0   1   161    0    0   1.862     62  0.25
  324  357 A   0   1   0   0   1   0   1   1  23   1  25   2   0   8   2   6   6   9   7   8   161    0    0   2.173     72  0.24
  325  358 A   3   3   0   0   0   0   0   0   2   1   1   4   0   5   0   9  11  57   0   4   161    0    0   1.591     53  0.45
  326  359 A   2   1   1   4   1   0   0   0  83   1   1   1   0   0   0   0   1   1   1   4   161    0    0   0.848     28  0.68
  327  360 A   1   1   1   0   0   4   0   0   1   1   4   0   0   0  62  14   4   5   0   2   161   20   11   1.405     46  0.53
  328  361 A   0   0   0   1   0   0   0   0   1   5   4   1   0   1  21  45   9  10   2   1   141    0    0   1.710     57  0.43
  329  362 A   1  26   3   0   0   0   0   1   3   5  26   6   0   0   9   3  12   0   1   3   144    0    0   2.088     69  0.12
  330  363 A   1   0   0   0   0   1   0   7   4  53   5   2   0   3   4  11   1   3   1   3   150    0    0   1.790     59  0.36
  331  364 A   1   3   0   1  21   9   1  11   3   1   8  18   0   0   1   1   1   1   7  13   151    0    0   2.310     77  0.05
  332  365 A   0   5   1   3  10  73   0   1   1   0   2   0   0   0   0   2   0   1   1   1   152    0    0   1.121     37  0.60
  333  366 A   0   0   0   0   0   1   0  14   1   0  26  12   0   0   0   1   1   8  22  14   153    1  149   1.833     61  0.37
  334  372 A   1   2   1   0   1   0   0   0   6   0   1   1   0   1   5  10   6  53   1  12   154    0    0   1.685     56  0.43
  335  373 A   0   2   0   0   1   0   0   1   8   0  18   0   0   0   7   4   5  43   4   8   154    0    0   1.824     60  0.35
  336  374 A   1   0   1   0   1   0   3   0   1   0   0   1   0   1   0   0   8  22   2  61   155    0    0   1.240     41  0.63
  337  375 A   3   6  18  27  15  29   1   0   0   0   0   0   0   0   0   0   0   0   0   0   155    0    0   1.649     55  0.36
  338  376 A   2  19   4   1   1   1   0   0   3   0   2   4   0   2   6  22  17   4   4  10   155    0    0   2.309     77  0.16
  339  377 A   3  78   7   1   3   0   0   0   2   0   1   3   0   0   0   0   0   0   1   0   161    0    0   0.936     31  0.72
  340  378 A   1   0   0   0   0   0   0  23  75   0   2   0   0   0   0   0   0   0   0   0   161    0    0   0.663     22  0.76
  341  379 A   3   0   1   0   0   0   0   0   1   0   1   3   0   1  31  31  10  17   1   0   161    0    0   1.698     56  0.37
  342  380 A   0   0   0   0   0   0   0  14   4   0   0   0   0   0   0   0   2  70   1  10   161    0    0   0.996     33  0.69
  343  381 A   4  81  14   0   1   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.644     21  0.84
  344  382 A   6   1   6  40   0   0   0   1   2   0   0  43   1   0   0   0   0   0   0   0   161    0    0   1.273     42  0.38
  345  383 A   0   1   0   0   1   0  16   0   0   0   0   0   0   8   9  35   9  12   1   9   161    0    0   1.882     62  0.22
  346  384 A   0   0   0   0   0   0   0   1   1   0   9  89   0   0   0   0   0   0   0   0   161    0    0   0.398     13  0.84
  347  385 A   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   161    0    0   0.000      0  1.00
  348  386 A   5   1   0   8   1  40  43   0   0   0   0   1   0   1   0   0   1   0   0   0   161    0    0   1.262     42  0.54
  349  387 A   0   0   0   1   0   0   0  22  20   0   0   0   0   0   6  13  19  14   1   4   161    0    0   1.894     63  0.31
  350  388 A   0   1   1  68   0   0   0   0   0   0   0  30   0   0   0   0   1   0   0   0   161    0    0   0.721     24  0.54
  351  389 A   0   0   0   0   0   0  91   0   0   0   0   0   0   6   0   0   0   0   3   0   161    0    0   0.352     11  0.83
  352  390 A   4  12   0   0   2   0   0   0   7   0   1   2   0  16   6  30   1   4   8   5   161    0    0   2.159     72  0.17
  353  391 A  15   1   2   1   1   4   9   1  15   0   3   9   0   0   2   1  22   2   1  12   161    0    0   2.308     77  0.09
  354  392 A  12   1   3  19   0   0   0   0   6   3  11  44   0   0   0   0   1   0   1   0   161   15   13   1.654     55  0.32
  355  393 A   1   0   1   0   1   0   0   1  33  23  12   1   0   0   0  10   1  10   3   3   146    0    0   1.906     63  0.31
  356  394 A   0   0   0   0   0   0   0   0   0   0  22  78   0   0   0   0   0   0   0   0   161    0    0   0.531     17  0.70
  357  395 A   0   0   0   0   0   0   0  98   0   0   0   0   0   0   0   2   0   0   0   0   161    0    0   0.093      3  0.96
  358  396 A   0  98   2   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.116      3  0.97
  359  397 A   0   0   0   0   0   0   0   3  68   0  29   0   0   0   0   0   0   0   0   0   161    0    0   0.726     24  0.67
  360  398 A   0   0   0   0   0   0   0   1  17  81   1   0   0   0   0   0   0   0   0   0   161    0    0   0.581     19  0.78
  361  399 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   161    0    0   0.000      0  1.00
  362  400 A   0   0  99   0   0   0   1   0   0   0   0   1   0   0   0   0   0   0   0   0   161    0    0   0.075      2  0.97
  363  401 A  43   0   1   1   0   0   0   0  23   0   2  30   0   0   0   0   0   0   0   0   161    0    0   1.216     40  0.41
  364  402 A  30   0   0   4   7   9  37   0   0   0   0   0   0  11   0   0   1   1   1   0   161    0    0   1.604     53  0.27
  365  403 A   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.000      0  1.00
  366  404 A   3   0   1   0   0   0   2   0   1   0   2   3   0   2   6  10   3  12  50   4   161    0  124   1.790     59  0.39
  367  405 A   0   0   0   0   2   0   0   6   4   9   7   1   0   1   1   4   6  17   8  34   161    0    0   2.078     69  0.39
  368  406 A   0   0   0   0   0   0   0  27   5   7  11   4   0   2   2   2   1   9   6  24   161   68   24   2.076     69  0.38
  369  407 A   0   2   0   0   1   0   1   3  10  13  11  15   0   1   3   4   4  12  16   3    93    0    0   2.394     79  0.21
  370  408 A  14  20  21   1  10   0   2   3   7   0   6   9   0   0   1   0   0   6   0   1   126    0    0   2.176     72  0.28
  371  409 A   1   1   2   2   1   0   1   3   3   7   6   2   0   2  12  33   5   3   4  13   150   43   65   2.297     76  0.26
  372          0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0     0    0    0   0.000      0  1.00
  373  411 A   0   0   0   0   0   0   0   2   5   3   2   4   0   2   2   7   5  13  15  41   113    0    0   1.918     64  0.46
  374  412 A   0   0   0   0   0   0   1  27   2  21  15   1   0   1   1   2   1  10   7  13   131   51   43   1.975     65  0.35
  375  413 A   0   0   0   0   0  29   2   7   7  15  11   1   0   1   1  17   2   3   1   1    87    0    0   2.109     70  0.05
  376  414 A   1   9   4   0   0  30   2   2   2   2  15   2   0   6   1   5   3   4   4   9   102    0    0   2.348     78  0.04
  377  415 A   6   1   2   0   1   0   0   1  37   0  12   2   0   0  16   7   7   6   1   2   107    0    0   2.009     67  0.19
  378  416 A   1   3   1   0   0   1   0   6   6   2  37   6   0   1   1  13   2  15   1   6   108    0    0   2.082     69  0.27
  379  417 A   2   0   0   1   1  34   3   3  14  11  14   0   0   1   2   3   0   8   1   4   117    0    0   2.092     69  0.05
  380  418 A  10   0   2   1   0   0   1   1   4   3  13   4   0   1  23  10   4   5   1  16   134    0    0   2.335     77  0.16
  381  419 A   1  11   1   1   0   0   0  19   1   2   4   1   0   5   4  22  10   9   3   5   149    0    0   2.336     77  0.17
  382  420 A   0   2   2   1   0   0   0   0   1   5   0   0   0   7   0   1   0   3   3  77   160    0    0   0.960     32  0.67
  383  421 A   3   8   8   6  51  11  13   0   0   0   1   0   0   0   0   0   0   0   0   0   161    0    0   1.554     51  0.67
  384  422 A   6   4  16   3  15   1  21   0   0   0   3  12   0   1   2   3   4   2   2   3   161    0    0   2.384     79  0.16
  385  423 A  39   0  43   0   1   0   0   0   0   1  13   1   0   0   0   2   0   0   0   0   161    0    0   1.229     41  0.57
  386  424 A   0   0   0   0   1   0   0   1   1   1   4   0   1   7   2  75   6   0   3   0   161    0    6   1.039     34  0.64
  387  425 A   0   1   0   0   0   1   0   6   2  68  14   0   0   1   2   2   1   1   1   1   161    1   46   1.201     40  0.58
  388  426 A   1  33   6   4   2   0   4   6  10   2   2   2   0   0   3   0  12   0  14   0   160    0    0   2.156     71  0.15
  389  427 A   0   0   0   0   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0  99   161    0    0   0.038      1  0.99
  390  428 A  14   1   0   0   0   0   0   4  24   1   4   0   0   0  39  12   2   0   1   0   161    0    0   1.664     55  0.24
  391  429 A   0   0   0   0   0   0   1   0   0   0   0   0   0  86  11   0   2   0   0   1   161    0    0   0.514     17  0.81
  392  430 A   0   0   0   0   0   0   6   0   0   0   1   1   1   0   0   0   0   0  93   0   161    0    0   0.328     10  0.83
  393  431 A   0  86  12   1   0   0   0   0   0   0   0   0   0   0   1   0   0   0   0   0   161    0    0   0.449     14  0.86
  394  432 A   0  21   0   2   0   0   0   0   0   0   0   0   0   0   0   0  76   0   0   0   161    0    0   0.626     20  0.56
  395  433 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   161    0    0   0.000      0  1.00
  396  434 A   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   161    0    0   0.000      0  1.00
  397  435 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   161    0    0   0.000      0  1.00
  398  436 A   0   0   0   0   0   0   0   0   3   0   2  94   0   0   0   0   0   1   0   0   161    0    0   0.268      8  0.91
  399  437 A  91   0   7   0   0   0   0   0   2   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.356     11  0.93
  400  438 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   161    0    0   0.000      0  1.00
  401  439 A   0   1   0   0   0   0   0   0   1   0  99   0   0   0   0   0   0   0   0   0   161    0    0   0.075      2  0.97
  402  440 A   0  79  20   0   1   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.571     19  0.82
  403  441 A   0   7   0  21  70   0   2   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.834     27  0.74
  404  442 A   7   9  11   4  18   0  51   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   1.431     47  0.58
  405  443 A   0  34   0  55   0   0   0   0  11   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.939     31  0.71
  406  444 A   0   0   0   0   2  32  62   0   0   0   1   0   0   3   0   0   0   0   0   0   161    0    0   0.891     29  0.81
  407  445 A   0   0   0   0   0   0   0   0   0   0   1   0   0  19  75   2   3   0   0   0   161    0    0   0.759     25  0.71
  408  446 A   6  41  47   1   1   0   0   0   2   0   1   1   0   0   0   0   0   0   0   0   161    0    0   1.139     38  0.66
  409  447 A   0   6   0   0   0   0   0   0   0   0  15  79   0   0   0   0   0   0   0   0   161    0    2   0.643     21  0.67
  410  448 A   0   0   0   0   0   0   0  58   0   0   0   0   0   9   3   9   1  14   6   0   161    0    0   1.340     44  0.44
  411  449 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   2   0   4   6  88   161    0    0   0.503     16  0.87
  412  450 A  10   0   1   0   0   0   1   0   2  18   6   1   0   8   2   6   5  26   7   8   161    0    0   2.234     74  0.24
  413  451 A   2   1  19  11   0   0   0   0   0   0   0  11   0   0   6  46   6   0   0   0   161    0    0   1.585     52  0.32
  414  452 A   0   0   0   0   0   0  99   0   0   0   0   0   0   1   0   0   0   0   0   0   161    0    0   0.038      1  0.99
  415  453 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0  95   1   4   0   0   0   161    0    0   0.216      7  0.92
  416  454 A   0   0   0   0   2   0   0   0   0   0   1   1   0   9   4   4  18  50   0  12   161    0    0   1.510     50  0.54
  417  455 A   0   0   0   4   0  89   5   0   1   0   0   0   0   1   0   0   1   0   0   0   161    0    0   0.485     16  0.83
  418  456 A   0   0   0   0   0   0   0  96   2   0   0   0   0   0   0   0   0   0   2   0   161    0    0   0.209      6  0.94
  419  457 A   0   1   0   0   0  72  16   0   9   0   0   0   0   0   1   1   1   0   0   0   161    0    0   0.896     29  0.62
  420  458 A   0   1   1   0   0   0   0   1   1   0   1   1   0   0   1  13  14  61   2   5   161    0    0   1.325     44  0.58
  421  459 A   1   1  65  33   0   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.739     24  0.70
  422  460 A   0   7   0   1  83   2   0   0   8   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.650     21  0.75
  423  461 A   1   0   0   0   0   0   0   0   1   0   2   8   0   0   4  35  28  16   4   2   161    0    0   1.701     56  0.38
  424  462 A   0   0   0   0   0   0   0   1  31   0  48   0   0   0   0   1   0   0  19   0   161    1    0   1.119     37  0.48
  425  463 A   0   0   6   0  94   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   160    0    0   0.234      7  0.93
  426  464 A  21   4  12  14   8   0   0   0   2   0   0   1   0   1   6   1   7  17   4   4   160    0    0   2.254     75  0.16
  427  465 A   0   0   0   0   0   0   0   0   5   0   0   3   0   0   6  46   3  15  22   1   160    0    0   1.530     51  0.43
  428  466 A   0   0   0   0   1   3  29   1   0   0   0   0   0  51   0   1   0   0  15   0   160    0    0   1.189     39  0.46
  429  467 A   0   1   0   0   1   0   0   1   5   0   8  75  11   0   0   0   0   0   0   0   161    0    0   0.903     30  0.62
  430  468 A   1   3   3   1   0   0   0   1  26   0  12   1  12   1  17  21   0   0   1   1   161   44   26   1.954     65  0.17
  431  469 A  64   3   7   1   0   0   5   2   7   0   1   4   0   0   0   2   3   1   0   1   117    8    4   1.450     48  0.51
  432  470 A  20   2   5   0   0   0   2   2   1   9   6   5   0   3   6   5   1  15   2  17   125    0    0   2.395     79  0.14
  433  471 A   6   2   0   0   0   0   1   4   5   8   6   2  14   0   6   5   1   6  15  19   142    0    0   2.417     80  0.13
  434  472 A   3   1   0   1   0   0   0  19   7   5  10   4   0   1   5   8   3  12  10  12   149    0    0   2.410     80  0.26
  435  473 A   6   1   1   0   0   0   0  31   3   0   3   4   0   4   1   7   3  11   3  23   156    0    0   2.083     69  0.35
  436  474 A   1   1   0   0   1   0   0  57  11  16   6   2   0   0   4   1   0   0   1   1   161   62   26   1.445     48  0.50
  437  475 A   0   0   0   0   0   0   1  13   2  10  20   1   0   1   2  21   0  16   4   8    99   31   39   2.075     69  0.27
  438  476 A   0  19  38   0  14   0   0   7   0   0   1   4   0   1   3   4   0   3   4   0    69    0    0   1.889     63  0.23
  439  477 A   8   4   6   1   0   0   1   1   1   2  11  13   1   0  40   9   0   0   0   1    85    1    0   1.983     66  0.19
  440  478 A   1   1   0   0   1   0   0  30  18   0  19   4   0   0  23   2   0   0   0   0    93    0    0   1.690     56  0.25
  441  479 A   0   4   1   0  48   0  45   0   0   0   0   0   0   0   0   1   1   0   0   0   161    1    0   0.965     32  0.87
  442  480 A   4   1   0   0   0   0   1   1   9   0  17  66   0   1   0   0   0   0   1   0   160    0    0   1.131     37  0.53
  443  481 A   1   0   0   0   0   0   0   3   2   0  82   1   4   0   0   0   0   0   1   6   160    0    0   0.768     25  0.75
  444  482 A  10  70  19   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   1   0   160    0    0   0.830     27  0.76
  445  483 A   0   6   1   0   1   0   0   1   1   0  29   6   1   1   8   5   3   8  11  17   160    0    0   2.178     72  0.23
  446  484 A   0   0   0   0   0   0   0   1   0   0  11   1   0   0   0   0   0   0  45  43   161    0   22   1.022     34  0.60
  447  485 A  46   0   1   1   0   0   0   1  25   0   0   1  15   0   0   2   3   2   1   3   161    0    0   1.534     51  0.33
  448  486 A   3   2  11   2   2   1   0   1   2   1   4  14   0   0   4   2   4   2  24  20   161    0    0   2.277     76  0.17
  449  487 A  18   1   1   0   0   0   0   0   4   2  13  29   0   0   3   4   4   7   5   7   161    0    0   2.151     71  0.22
  450  488 A  19  16  34   5   0   0   0   9   2   0   1   3   0   2   0   2   1   1   2   2   161    0    0   2.012     67  0.34
  451  489 A   1   3   2   0   0   0   0   0   0  78   2   1   0   1   2   2   1   1   4   1   161    0    0   1.021     34  0.61
  452  490 A   5   1   1   0   1   0   1   1   9  58   4  20   0   0   0   1   0   0   0   0   161    1    0   1.343     44  0.45
  453  491 A  17   1   2   0   0   0   1   3   4   8   4   8   0   0   3  33   6   4   3   2   160    0    0   2.203     73  0.20
  454  492 A  14   7   0   1   7   0   3   0   1  11   0   8   0   2   8  26  13   0   0   0   160    0    0   2.169     72  0.13
  455  493 A   1   4   3   1   0   0   0   2   1   0   9   0   0   0  57  13   0   7   0   1   161    0    0   1.499     50  0.38
  456  494 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  10  90   161    0    0   0.324     10  0.90
  457  495 A   0   1   0   0   0   0   0   0   0   0   1   0   0   0   6  14   0   1  77   1   161    0    0   0.778     25  0.65
  458  496 A   1  11   1  78   0   0   0   0   0   0   0   9   0   0   0   0   0   0   0   0   161    0    0   0.749     24  0.78
  459  497 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0  99   0   1   161    0    0   0.038      1  1.00
  460  498 A   0   0   0   0   0   0   0   0   0   0  84  16   0   0   0   0   0   0   0   0   161    0    0   0.432     14  0.76
  461  499 A   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.000      0  1.00
  462  500 A   0   4   0   0   9  87   0   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.465     15  0.92
  463  501 A   1  73   1  12   7   6   0   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.917     30  0.85
  464  502 A   0   0   0   0   0   0   0   8  83   0   9   0   0   0   0   0   0   0   0   0   161    0    0   0.568     18  0.79
  465  503 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   161    0    0   0.000      0  1.00
  466  504 A   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   161    0    0   0.000      0  1.00
  467  505 A   0  99   0   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.038      1  1.00
  468  506 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   161    0    0   0.000      0  1.00
  469  507 A   0   0   0   0   0   1  99   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.038      1  1.00
  470  508 A   1  62   1   6  30   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.905     30  0.87
  471  509 A   0   1   0   0   6   0  89   0   0   0   0   0   0   5   0   0   0   0   0   0   161    0    0   0.447     14  0.90
  472  510 A   0  91   8   0   0   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.318     10  0.92
  473  511 A   0  96   0   0   0   0   0   0   0   0   0   4   0   0   0   0   0   0   0   0   161    0    0   0.159      5  0.91
  474  512 A   0   0   0   0  99   0   1   0   0   0   0   0   0   0   0   0   1   0   0   0   161    0    0   0.075      2  0.98
  475  513 A   2   8   0   0   0   0   0   5   1   0  53   0   0   1   0   0   6   4   1  19   161    0    0   1.494     49  0.34
  476  514 A   0   0   0   0   0   0   0   0   0  29   0   0   0   0   0   0   0  10   0  61   161    0    0   0.886     29  0.57
  477  515 A   1   0   0   0   0   0   0   0   6   5   6  10   0   0  16   3   0  17  17  20   161    0    0   2.058     68  0.29
  478  516 A  11   1   0   1  11   0   1   0   1   4   6   2   0   0   1   0   1   5  12  46   161    0  129   1.806     60  0.19
  479  517 A   1   0   0   0   0   0   0   1   3  63   9   0   0   0   0   1   0   1   0  21   161    0    0   1.122     37  0.49
  480  518 A   0  97   0   2   1   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.154      5  0.99
  481  519 A   0   0   0   0   0   0   0   0   0   0   7  33   0   2   1   1   1  14   4  36   161    0    0   1.569     52  0.41
  482  520 A   0   0   0   0   0   0   1   4   4   0   4   2   0   0   3  45   4  18   2  12   161    0    0   1.770     59  0.39
  483  521 A  32   1  12   4   2   2  24   0   2   0   2   7   1   7   0   0   0   0   4   0   161    0    0   1.975     65  0.22
  484  522 A  93   0   4   0   0   0   0   0   0   0   0   2   0   0   0   0   0   0   0   0   161    0    0   0.294      9  0.93
  485  523 A   0   7   8   0  84   0   1   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.576     19  0.90
  486  524 A   0   0   0   0   0   0   0   0   0   0   1   1   0   0   0   0   0   0  98   0   161    0    0   0.105      3  0.97
  487  525 A   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   0   0   161    0    0   0.000      0  1.00
  488  526 A   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   161    0    0   0.000      0  1.00
  489  527 A   0   0   0   0   0   0   0   7  93   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.249      8  0.94
  490  528 A   0   0   0   0   0   0   0   0   0   0   0   0   0 100   0   0   0   0   0   0   161    0    0   0.000      0  1.00
  491  529 A  12   1  12   0   0   0   0   0   3  72   0   0   0   0   0   0   0   0   0   0   161    0    0   0.903     30  0.56
  492  530 A   0  37   0   0  63   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   161    0    0   0.660     22  0.90
  493  531 A   0   0   0   0   0   0   0   0   0  99   0   0   0   0   1   0   0   0   0   0   161    0    0   0.038      1  0.99
  494  532 A  29   0  12   0   0   0   0   0   0   0   0   0   0   0  52   4   0   0   2   0   161    0    0   1.185     39  0.29
  495  533 A   0  18   7   1  71   1   2   0   0   0   0   0   0   0   0   0   0   0   0   0   154    0    0   0.909     30  0.84
  496  534 A   0   0   0   0   0   0   0   1   1   1   5   9   0   3   3  10   9   5  11  43   148    0    0   1.870     62  0.41
  497  535 A   1   6   0  28   0   0   0   0   3  31   5   9   0   1   1   1   3  10   1   0   147    0    0   1.923     64  0.20
  498  536 A   2   0   0   0   0   0   0  36   4   1   7  16   0   0   1   5   1  19   7   1   138    0    0   1.883     62  0.35
  499  537 A   3   1  16   1   0   0   4   0   0  11   2   3   0   2   9  22  12   9   2   3   107    0    0   2.306     76  0.13
  500  538 A   3  80   1   0  13   0   1   0   0   0   0   0   0   0   1   0   1   0   0   0   102    0    0   0.723     24  0.84
  501  539 A   2   4   0   0   0   0   0   2   8   0   9   6   0   4  11  30  11   4   4   6    53    0    0   2.242     74  0.19
  502  540 A   2   0   0   0   0   0   0   0   2   0  43  18   0   2   8   6   0  14   2   4    51    0    0   1.743     58  0.28
  503  541 A   0  24   0  12  10   0   0   0   0   0   0   2   0   5  12   5  29   0   0   0    41    0    0   1.829     61  0.16
  504  542 A   0   0   0   0   0   0   0  22  10   0  37   0   0   0   0   5   2   2  15   7    41    0    0   1.729     57  0.35
  505  543 A   3  93   0   0   3   0   0   0   0   0   0   3   0   0   0   0   0   0   0   0    40    0    0   0.349     11  0.88
  506  544 A  15   3   0   0   0   0   0   0   0   0  13  44   0   0   0  21   0   3   0   3    39    0    0   1.520     50  0.22
  507  545 A   0   0   0   0   0   0   0   0   0   0   0  97   0   0   0   0   3   0   0   0    35    0    0   0.130      4  0.91
  508  546 A   0   0   0   0   0   0   0  89   0   3   0   3   0   0   0   0   0   0   6   0    35    0    0   0.474     15  0.79
  509  547 A   0   0   0   0   0 100   0   0   0   0   0   0   0   0   0   0   0   0   0   0    35    0    0   0.000      0  1.00
  510  548 A   0   3   0   0   0   0   0   0   9   0  69   3   0   3   0   3   0   0   0   9    32    0    0   1.135     37  0.43
  511  549 A   0  89  11   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0    27    0    0   0.349     11  0.88
 AliNo  IPOS  JPOS   Len Sequence
     1   334   367     5 sLSLERk
     1   372   410     1 kQd
     2   334   367     5 sLSLERk
     2   372   410     1 kQd
     3   334   367     5 sLSLERk
     3   372   410     1 kQd
     4   334   367     5 sLSLERk
     4   372   410     1 kQd
     5   334   367     5 sLSLERk
     5   372   410     1 kQd
     6   334   367     5 sLSLERk
     6   372   410     1 kQd
     7   334   367     5 sLSLERk
     7   372   410     1 kQd
     8   334   367     5 sLSLERk
     8   372   410     1 kQd
     9   334   367     5 sLSLERk
     9   372   410     1 kQd
    10   334   367     5 sLSLERk
    10   372   410     1 kQd
    11   334   367     5 sLSLERk
    11   372   410     1 kQd
    12   334   369     5 sLFPDRq
    12   372   412     1 eQn
    13    61    93     2 nKSs
    13   211   245     1 gRh
    13   280   315     1 nLa
    13   331   367     3 dPTKq
    13   366   405     1 nYp
    13   369   409     1 yEd
    14   334   364     3 dATRe
    14   372   405     1 iPq
    15   334   366     3 dSQRe
    15   369   404     1 gRp
    16    56    91     2 sSTn
    16    82   119     1 yKd
    16   206   244     1 gPr
    16   326   365     3 dSVRe
    16   359   401     4 nGDELe
    16   361   407     1 eHe
    17   334   364     3 dTTRe
    17   372   405     1 iPq
    18   334   364     3 dTTRe
    18   372   405     1 iPq
    19   214   249     1 gDk
    19   334   370     3 nKDRa
    19   367   406     6 nDNTEFLn
    19   372   417     1 sNg
    20   212   242     1 gPq
    20   332   363     3 dTTRe
    20   365   399     1 nKe
    21    20    97     1 gGw
    21    85   163     1 yKd
    21   112   191     1 sLe
    21   119   199     2 sNPt
    21   209   291     2 sQDk
    21   278   362     1 sNe
    21   323   408     1 rVq
    21   329   415     5 dAKDDMe
    21   402   493     9 sSNEEEDDEAk
    21   471   571     3 fDTTk
    22   214   260     1 dEy
    22   334   381     3 dAKRa
    22   367   417     6 nDNSEGLn
    22   372   428     1 qRs
    23   119   156     2 nYSa
    23   209   248     1 sSq
    23   329   369     3 nSRRe
    23   362   405     1 nVd
    23   364   408     1 nSe
    24    38    68     1 gSk
    24    59    90     2 nSTt
    24   328   361     3 dQKRe
    24   361   397     4 nDKYAs
    24   428   468     1 sDt
    25    82   127     1 ySv
    25   116   162     2 sTPq
    25   206   254     2 sPEp
    25   275   325     1 pSh
    25   286   337     1 gLq
    25   320   372     2 rTAa
    25   326   380     3 nDDRe
    25   347   404     1 nEv
    25   359   417     5 nDGTHNe
    25   395   458     4 sSDPAq
    25   464   531     2 sESk
    26    40   117     1 aAs
    26    61   139     2 nNTq
    26   114   194     1 qTt
    26   121   202     1 dGq
    26   331   413     3 dSIRe
    26   364   449     2 nDKg
    26   366   453     1 aRe
    26   369   457     1 kEn
    26   433   522     1 aSk
    27    56    93     2 nKTk
    27   206   245     1 gRh
    27   275   315     1 qLh
    27   326   367     3 nPTKq
    27   359   403     4 nSNYPn
    27   426   474     1 aDg
    27   427   476     2 gEEk
    28    58    96    25 nYTLAENVNVTLYKTTDGSIDQSKLDs
    28   208   271     1 sPh
    28   288   352     1 gLd
    28   328   393     3 dEKRq
    28   361   429     3 dDGTs
    28   365   436     1 sTn
    28   429   501     1 dTd
    28   430   503     2 dDSt
    29   124   152     2 rYSn
    29   334   364     3 nSERe
    29   369   402     1 gKa
    29   372   406     1 pGh
    30    64   123     2 sGTd
    30   334   395     3 dTNRi
    30   367   431     1 rTn
    30   372   437     1 tNr
    30   445   511     1 sVt
    31   232   345     2 nNKe
    31   309   424     3 sQDKa
    31   342   460     1 nTd
    31   444   563     2 nKLp
    32    62   100     2 aHTk
    32   331   371     3 dGDRa
    32   364   407     2 sVRe
    32   442   487     1 sVv
    33   306   375     3 nEERe
    33   341   413     1 eDn
    33   441   514     2 nKIp
    34   306   351     3 nPERe
    34   327   375     1 vSa
    34   339   388     1 nTd
    34   401   451     1 nNn
    34   442   493     4 vAEQWd
    35   228   328     2 sEEe
    35   305   407     3 nEERa
    35   326   431     1 vMp
    35   401   507     2 eISf
    35   410   518     1 sLk
    35   442   551     2 nKIp
    36   227   310     2 nQQe
    36   304   389     3 tAKKe
    36   337   425     1 nTe
    36   396   485     1 gSd
    36   437   527     2 nLVp
    37   226   328     2 sEEe
    37   303   407     3 tEERa
    37   324   431     1 vSp
    37   399   507     2 eISf
    37   408   518     1 sLk
    37   440   551     2 nRIp
    38   232   342     2 dEQe
    38   309   421     3 tPLKe
    38   441   556     2 nLIp
    39    62   100     2 aHTk
    39   331   371     3 dGDRa
    39   364   407     2 sVRe
    39   442   487     1 sVv
    40   232   268     2 nNQe
    40   309   347     3 dADKe
    40   344   385     1 nPq
    40   444   486     2 nKFp
    41    98   184     1 tNd
    41   227   314     2 nLQe
    41   304   393     3 tDEKe
    41   340   432     1 kTq
    41   439   532     2 nKVp
    42   306   351     3 nPERe
    42   327   375     1 vSa
    42   339   388     1 nTd
    42   401   451     1 nNn
    42   442   493     4 vAEQWd
    43   227   318     2 nKQe
    43   304   397     3 nEERe
    43   325   421     1 vSp
    43   400   497     2 eVSf
    43   409   508     1 sFd
    43   441   541     2 nKIp
    44   227   324     2 nNNe
    44   304   403     3 nADRe
    44   325   427     1 vSp
    44   400   503     2 dVSf
    44   409   514     1 sLg
    44   441   547     2 nKIp
    45   227   266     2 nEQe
    45   304   345     3 nTKKe
    45   440   484     2 nKLp
    46   227   318     2 nKQe
    46   304   397     3 nEERe
    46   325   421     1 vSp
    46   400   497     2 eVSf
    46   409   508     1 sFd
    46   441   541     2 nKIp
    47    62   100     2 aHTt
    47   331   371     3 dRERa
    47   364   407     2 rVRe
    47   442   487     1 sVv
    48   273   273     3 tDEKe
    48   294   297     1 vPa
    48   306   310     1 kQd
    48   308   313     1 aNs
    48   367   373     1 dSk
    48   408   415     4 tDPKWd
    49   265   349     1 gVi
    49   268   353     4 gGGLSa
    49   305   394     3 dAERe
    49   326   418     1 vDa
    49   401   494     2 eVSf
    49   410   505     1 sFn
    49   442   538     2 dTId
    50   227   268     2 nKQe
    50   304   347     3 nEERe
    50   325   371     1 vTp
    50   400   447     2 eVSf
    50   409   458     1 sLd
    50   441   491     2 nKIp
    51   228   264     2 nKQe
    51   305   343     3 nEERa
    51   326   367     1 vDp
    51   401   443     2 eVSf
    51   410   454     1 sLn
    51   442   487     2 nKIp
    52   227   268     2 nKQe
    52   304   347     3 nEERe
    52   325   371     1 vSp
    52   400   447     2 eVSf
    52   409   458     1 sFd
    52   441   491     2 nKIp
    53    76   147     1 wDq
    53   102   174     1 sGn
    53   234   307     2 kRAe
    53   311   386     3 sKRRa
    53   349   427     1 sEd
    53   415   494     1 sVk
    53   447   527     3 eSVLp
    54   102   199     3 sQDLk
    54   110   210     2 aVEd
    54   227   329     2 kNQe
    54   298   402     2 rKAe
    54   304   410     4 wGVRQe
    54   337   447     7 nLKHGKSGd
    54   339   456     1 gEf
    54   400   518     1 gAk
    54   441   560     2 dILp
    55   101   264    10 sNEYPNLAPVKd
    55   108   281     2 pGEd
    55   236   411     2 nKQe
    55   313   490     3 nKKKe
    55   346   526    15 kIADPPLPESAPHHPPa
    55   350   545     1 dTd
    55   451   647     2 dLLp
    56   100   234    10 sTTYPDMAPLKd
    56   107   251     2 pGEd
    56   236   382     2 nKKe
    56   313   461     3 tKQNe
    56   346   497    11 eIATPPPVYGAPh
    56   349   511     1 kPp
    56   351   514     5 aQLDASp
    56   451   619     2 dVLp
    57   101   265    10 sTEYPQLAPLNd
    57   108   282     2 pGEd
    57   236   412     2 nQQe
    57   313   491     3 sKKKe
    57   346   527    15 kIANPPHAESAPHQAPp
    57   453   649     2 dLLp
    58   100   185    10 sTNYPELAPLTd
    58   107   202     2 pGEd
    58   235   332     2 qETe
    58   312   411     3 gQRQe
    58   345   447     1 nVd
    58   347   450     1 dPr
    58   360   464     8 wRDDLNIHKq
    58   446   558     2 dFIs
    59   100   174    10 sNEFPHLAPLAe
    59   107   191     2 aGEd
    59   235   321     2 nKQe
    59   274   362     1 dRa
    59   311   400     3 sKKNe
    59   344   436    12 eIDNPPQPFGSPRq
    59   346   450     1 sPa
    59   351   456     1 pAp
    59   451   557     2 dLLp
    60   100   276    10 sNEFPELAPIKd
    60   107   293     2 pGEd
    60   235   423     2 nKQe
    60   312   502     3 nKKKd
    60   345   538    15 nIDDPPAPVTASHHPPk
    60   349   557     1 dPd
    60   450   659     2 dLLp
    61   102   173     4 sTRLPh
    61   107   182     2 rRDs
    61   312   389     3 tTHHe
    61   345   425    10 nATDADLQPQPg
    61   347   437     1 dRy
    61   350   441     1 rRe
    61   352   444     1 sSa
    61   452   545     2 dYMp
    62   101   264    10 sTEFPELAPIKe
    62   108   281     2 pGEd
    62   236   411     2 nKKe
    62   313   490     3 tAQHd
    62   346   526    15 nTANPPAAPDAPHHQPp
    62   351   546     1 dSd
    62   452   648     2 sLMp
    63   102   257    10 sNEFPDLAPLTe
    63   109   274     2 dGEd
    63   237   404     2 nKKe
    63   276   445     1 eYp
    63   313   483     3 sKKKd
    63   346   519    15 nTYNPPPAASAPHQAPa
    63   350   538     1 dPd
    63   451   640     2 dLLp
    64   100   277    10 sTEFPELAAIKd
    64   107   294     2 aGEd
    64   235   424     2 nKQe
    64   312   503     3 nKKKd
    64   345   539    15 nIDKPPAPASASHHPPk
    64   349   558     1 dPd
    64   450   660     2 dLLp
    65   100   241    10 sTEFPDMAPLAe
    65   107   258     2 pGEd
    65   235   388     2 nKKe
    65   274   429     1 gRp
    65   311   467     3 tRQDe
    65   344   503    15 nVGDPAAREGDAHATPp
    65   451   625     2 dVLp
    66   101   243    10 sTEFPGLAPLAe
    66   108   260     2 iGEd
    66   236   390     2 nKKe
    66   274   430     1 lSn
    66   312   469     3 sKKNe
    66   345   505    12 eIDDKPPAYGNPRp
    66   350   522     4 nFEPSp
    66   450   626     2 dLLp
    67    66    66     1 sTq
    67    74    75     2 kRDs
    67   279   282     3 tPYHe
    67   312   318    14 nATEYDLQPKPGDRKq
    67   418   438     2 dYMs
    68   100   177     4 sTILPd
    68   105   186     2 rRDy
    68   233   316     2 sGQe
    68   310   395     3 nAQKk
    68   343   431    14 eVDEADLGPSSGPSPr
    68   449   551     2 eFLp
    69   100   172     4 sTQLPd
    69   105   181     2 rRDy
    69   233   311     2 yGQe
    69   310   390     3 nAKKe
    69   343   426    14 eADPSDLEPGPASRSq
    69   347   444     2 sSDd
    69   447   546     2 dFIp
    70   231   300     2 sRTe
    70   338   409     2 tSLs
    70   435   508     2 dQIp
    71   101   243    10 sTEFPGLAPLAe
    71   108   260     2 iGEd
    71   236   390     2 nKKe
    71   274   430     1 lSn
    71   312   469     3 sKKNe
    71   345   505    12 eIDDKPPAYGNPRq
    71   350   522     4 nFEPSp
    71   450   626     2 dLLp
    72   102   243    10 sTEFPELAPLTe
    72   109   260     2 pGEd
    72   237   390     2 nKQe
    72   276   431     1 eHp
    72   313   469     3 nKKKd
    72   346   505    15 nIPNPPPESSAPHQAPa
    72   452   626     2 dVLp
    73   100   175     5 aTTHKMd
    73   107   187     1 eAd
    73   274   355     1 gTt
    73   311   393     3 gQREe
    73   344   429     1 nMd
    73   442   528     2 dLLp
    74   100   234    10 sTEFPQLAPLAd
    74   107   251     2 pGEd
    74   235   381     2 nKQe
    74   312   460     3 gAKQe
    74   345   496    15 kVNDPPLPESAPHKAPk
    74   349   515     1 dSd
    74   450   617     2 dLMp
    75    23    98     1 gQd
    75   100   176     4 sTQLPd
    75   106   186     1 rDh
    75   311   392     3 nAQKe
    75   344   428    14 eTEDANLEPSTKAPRa
    75   449   547     2 dFLp
    76   102   238    10 sTEFPTLAPLAe
    76   109   255     2 pGEd
    76   237   385     2 nKQe
    76   276   426     1 eYp
    76   313   464     3 sKKKd
    76   346   500    15 nIPNPPPEESAPHQAPt
    76   452   621     2 dLLp
    77   102   187     4 sTQLPh
    77   107   196     2 rRDs
    77   312   403     3 tKHHe
    77   345   439    10 nASEADLQPRPg
    77   347   451     1 dRl
    77   350   455     1 rRe
    77   352   458     1 sSa
    77   452   559     2 dYMp
    78   101   244    10 sTEFPGLAPLAe
    78   108   261     2 aGEd
    78   236   391     2 nKQe
    78   275   432     1 eMp
    78   312   470     3 sKKNe
    78   345   506    12 eIDNPPTAYGNPRn
    78   350   523     4 nFDTSp
    78   450   627     2 dLLp
    79    61    61     7 sSEFPHYAp
    79    62    69     1 pIg
    79    69    77     2 gGEd
    79   197   207     2 sKQe
    79   274   286     3 gKKQe
    79   307   322    16 kVDDPPRMWEENGDKVSs
    79   309   340     1 pAe
    79   414   446     2 dVLp
    80   101   278    10 sNEYPDLAATKd
    80   108   295     2 aGEd
    80   236   425     2 nKQe
    80   274   465     1 lSn
    80   312   504     3 nKKKd
    80   345   540    15 nVNSPPAPASASHNPPs
    80   349   559     1 dPd
    80   450   661     2 dLLp
    81   101   244    10 sTEFPGLAPLAe
    81   108   261     2 aGEd
    81   236   391     2 nKQe
    81   275   432     1 eMp
    81   312   470     3 sKKNe
    81   345   506    12 eIDNPPTAYGNPRn
    81   350   523     4 nFDTSp
    81   450   627     2 dLLp
    82   101   244    10 sTEFPGLAPLAe
    82   108   261     2 aGEd
    82   236   391     2 nKQe
    82   275   432     1 eMp
    82   312   470     3 sKKNe
    82   345   506    12 eIDNPPTAYGNPRn
    82   350   523     4 nFDTSp
    82   450   627     2 dLLp
    83   100   278    10 sNEYPQLAPVKd
    83   107   295     2 pGEd
    83   235   425     2 nKQe
    83   273   465     1 lKn
    83   311   504     3 nKKKd
    83   344   540    15 nVDNPPPAESASHHPPq
    83   348   559     1 dTd
    83   449   661     2 dLLp
    84   101   209    10 sTEFPGLAPLAe
    84   108   226     2 aGEd
    84   236   356     2 nKQe
    84   275   397     1 eMp
    84   312   435     3 sKKNe
    84   345   471    12 eIDNPPTAYGNPRn
    84   350   488     1 nFd
    84   352   491     1 pSp
    84   452   592     2 dLLp
    85   101   278    10 sNEYPDLAPTKd
    85   108   295     2 aGEd
    85   236   425     2 nKQe
    85   274   465     1 lSn
    85   312   504     3 nKKKd
    85   345   540    15 nVDSPPAPASASHNPPs
    85   349   559     1 dPd
    85   450   661     2 dLLp
    86   102   263    10 sTEFPNMAPLEe
    86   109   280     2 pGEd
    86   237   410     2 nKKe
    86   314   489     3 sKKSe
    86   347   525    15 qIPTPPLPESAAHEAPa
    86   351   544     1 dPd
    86   452   646     2 dVLp
    87   101   220    10 qDTLPGLKPANs
    87   104   233     1 dEd
    87   232   362     2 nKQe
    87   309   441     3 gKEQe
    87   342   477    15 eLDDPPKMYRTEILASk
    87   349   499     2 dVPe
    87   449   601     2 dLLp
    88   101   245    10 sTNYPELAPLTd
    88   108   262     2 pGEd
    88   236   392     2 qETe
    88   313   471     3 gQRQe
    88   346   507    13 nVDDPRVMETDMYPd
    88   353   527     4 pSSGQq
    88   366   544    19 sIYPVSDYSTKWRDDLNIHKq
    88   457   654     2 dFIs
    89   100   182     4 sKELPg
    89   235   321     2 sEQe
    89   312   400     3 tAQKs
    89   345   436    15 nMDEQRTSSARIRKSRn
    89   347   453     1 sPd
    89   445   552     2 dFLp
    90   100   173     4 aGQLPd
    90   105   182     2 qRDf
    90   310   389     3 sDKKe
    90   343   425    14 nAHDADLQPVPGEKKs
    90   348   444     3 pSRDs
    90   448   547     2 dLLp
    91   100   173     4 aGQLPd
    91   105   182     2 qRDf
    91   310   389     3 sDKKe
    91   343   425    14 nAHDADLQPVPGEKKs
    91   348   444     3 pSRDs
    91   448   547     2 dLLp
    92   100   173     4 aGQLPd
    92   105   182     2 qRDf
    92   310   389     3 sDKKe
    92   343   425    14 nAHDADLQPVPGEKKs
    92   348   444     3 pSRDs
    92   448   547     2 dLLp
    93   101   244    10 sTEFPGLAPLAe
    93   108   261     2 aGEd
    93   206   361     2 nKQe
    93   245   402     1 eMp
    93   282   440     3 sKKNe
    93   315   476    12 eIDNPPTAYGNPRn
    93   320   493     4 nFDTSp
    93   420   597     2 dLLp
    94   100   168     4 aGRLPd
    94   105   177     2 rRDg
    94   233   307     2 sGQe
    94   304   380     2 rARp
    94   310   388     3 tARKe
    94   343   424    14 dAAEEDLRPRPGDRQq
    94   407   502     1 gLd
    94   448   544     2 dFLp
    95   100   174    10 sTEFPNLAPLAd
    95   107   191     2 lGEd
    95   235   321     2 sKEe
    95   312   400     3 sKKRd
    95   345   436    15 kIKSPPLPESAQHKAPe
    95   350   456     1 dTe
    95   451   558     2 dLIp
    96    80    81     4 aGRLPd
    96    85    90     2 rRDs
    96   213   220     2 sATe
    96   290   299     3 tARKe
    96   323   335    16 dVEEEELRPRPAGGRGDg
    96   325   353     1 gEd
    96   328   357     1 kKg
    96   330   360     5 gKAKRDs
    96   388   423     1 gLg
    96   429   465     2 dFLp
    97    99   190    12 sTELPHYAPMHIAk
    97   103   206     2 pGEd
    97   231   336     2 sQQe
    97   308   415     3 sKGQe
    97   341   451     9 rTWEPHKMAWe
    97   343   462     1 gWd
    97   346   466     1 kSp
    97   348   469     5 eSFDPDr
    97   448   574     2 dVLp
    98   102   178    10 sTRYPTLAPIAd
    98   109   195     2 aGEd
    98   237   325     2 sGQe
    98   314   404     3 sQQRe
    98   347   440     8 iLDSPPVMMg
    98   354   455     5 pSSTSGs
    98   367   473    19 pLSRQSGDSESWRQDIEIHNm
    98   410   535     9 aVVEVEETELv
    98   416   550     1 vVk
    98   417   552     1 kRi
    98   458   594     2 dFIp
    99   100   173     4 aGQLPd
    99   105   182     2 qRDf
    99   310   389     3 sDKKe
    99   343   425    14 nAHDADLQPVPGEKKs
    99   348   444     3 pSRDs
    99   448   547     2 dLLp
   100   101   241    10 sTAHPGLAPIAd
   100   108   258     2 pGEd
   100   236   388     2 sKQe
   100   313   467     3 tQRQd
   100   346   503    13 tLDDPPKMFHDMYPd
   100   353   523     2 gNRk
   100   366   538    19 pLYPLDDKTLQWREDIQIQSq
   100   409   600    21 aVVEHDHSHETDVPADADAAAAg
   100   410   622     2 gTQs
   100   415   629     1 aRp
   100   416   631     2 pSRi
   100   457   674     2 dFIs
   101   101   241    10 sTAHPGLAPIAd
   101   108   258     2 pGEd
   101   236   388     2 sKQe
   101   313   467     3 nQRRd
   101   346   503    13 tLDDPPKMFHDMYPd
   101   353   523     2 gNRk
   101   366   538    19 pLYPLDDETLKWREDIQIQSq
   101   409   600    20 aVVEHDHSHETDSPADAAAGSq
   101   415   626     1 aRp
   101   416   628     2 pSRi
   101   457   671     2 dFIs
   102   104   233    10 sTTYPNLAPIAd
   102   111   250     2 pGEd
   102   239   380     2 sHEe
   102   277   420     1 lNh
   102   315   459     3 gRRQe
   102   348   495    16 qLDSPSRMMKNVFPDLTk
   102   350   513     1 sSa
   102   365   529    19 pLYPLTNENSEWRKDIIIHPq
   102   408   591    18 sIIVEDEEPLTQDYYYNKSv
   102   414   615     1 aTp
   102   415   617     1 pHi
   102   456   659     2 dFLp
   103   102   234    10 sTTYPHLAAIEd
   103   109   251     2 pGEd
   103   237   381     2 sREe
   103   275   421     1 lRh
   103   313   460     3 gRKQe
   103   346   496    12 kTDSPPRMMKDVFp
   103   350   512     1 kKn
   103   352   515     3 pSAAk
   103   365   531    19 pLYPLTDANSAWRKDIIIQPn
   103   408   593    21 sISEKDKEPPIRDSYNKNVDPEt
   103   414   620     1 rTs
   103   415   622     1 sHi
   103   456   664     2 dFLp
   104   102   234    10 sTTYPHLAAIEd
   104   109   251     2 pGEd
   104   237   381     2 sREe
   104   275   421     1 lRh
   104   313   460     3 gRKQe
   104   346   496    12 kTDSPPRMMKDVFp
   104   350   512     1 kKk
   104   352   515     3 pSAAk
   104   365   531    19 pLYPLTDANSAWRKDIIIQPn
   104   408   593    21 sISEKDKEPPIRDSYNKNVDPEt
   104   414   620     1 rTs
   104   415   622     1 sHi
   104   456   664     2 dFLp
   105   102   251    10 sTTYPELAPIAd
   105   109   268     2 pGEd
   105   237   398     2 sNEe
   105   314   477     3 gRKQe
   105   347   513    16 kIDDPPRTIKDVYPDFDf
   105   349   531     1 sFg
   105   352   535     1 gEk
   105   354   538     5 sKKKKTg
   105   366   555     1 sHp
   105   367   557    19 pLYPLDREKSIWLKDITIRGp
   105   410   619     9 aVFEDEPSPGa
   105   417   635     1 sYi
   105   458   677     2 dFIp
   106   102   244    10 sTTYPELAPIAd
   106   109   261     2 pGEd
   106   237   391     2 sNEe
   106   314   470     3 gRKQe
   106   347   506    16 kIDDPPRTIKDVYPDFDf
   106   349   524     1 sFg
   106   352   528     1 gEk
   106   354   531     5 sKKKKTg
   106   366   548     1 sHp
   106   367   550    19 pLYPLDREKSIWLKDITIRGp
   106   410   612     9 aVFEDEPSPGa
   106   417   628     1 sYi
   106   458   670     2 dFIp
   107   102   234    10 sTTYPHLAAIEd
   107   109   251     2 pGEd
   107   237   381     2 sREe
   107   275   421     1 lRh
   107   313   460     3 gRKQe
   107   346   496    12 kTDSPPRMMKDVFp
   107   350   512     1 kKn
   107   352   515     3 pSAAk
   107   365   531    19 pLYPLTDANSAWRKDIIIQPn
   107   408   593    21 sISEKDKEPPIRDSYNKNVDPEt
   107   414   620     1 rTs
   107   415   622     1 sHi
   107   456   664     2 dFLp
   108   102   251    10 sTTYPELAPIAd
   108   109   268     2 pGEd
   108   237   398     2 sNEe
   108   314   477     3 gRKQe
   108   347   513    16 kIDDPPRTIKDVYPDFDf
   108   349   531     1 sFg
   108   352   535     1 gEk
   108   354   538     5 sKKKKTg
   108   366   555     1 sHp
   108   367   557    19 pLYPLDREKSIWLKDITIRGp
   108   410   619     9 aVVEDEPSPGa
   108   417   635     1 sYi
   108   458   677     2 dFIp
   109   227   255     2 kKRe
   109   303   333     2 eKYk
   109   336   368     1 nLd
   109   433   466     2 nVLp
   110   101   241    10 sTAHPGLAPIAd
   110   108   258     2 pGEd
   110   236   388     2 sKQe
   110   313   467     3 nQRRd
   110   346   503    13 tLDDPPKMFHDMYPd
   110   353   523     2 gNRk
   110   366   538    19 pLYPLDDETLKWREDIQIQSq
   110   409   600    20 aVVEHDHSHETDSPADAAAGSq
   110   415   626     1 aRp
   110   416   628     2 pSRi
   110   457   671     2 dFIs
   111   100   128    10 sTAHPGLAPIAd
   111   107   145     2 pGEd
   111   235   275     2 sKQe
   111   312   354     3 nQRRd
   111   345   390    13 tLDDPPKMFHDMYPd
   111   352   410     2 gNRk
   111   365   425    19 pLYPLDDETLKWREDIQIQSq
   111   408   487    20 aVVEHDHSHETDSPADAAAGSq
   111   414   513     1 aRp
   111   415   515     2 pSRi
   111   456   558     2 dFIs
   112   273   363     2 vASp
   112   310   402     3 sDLQd
   112   348   443     1 nPs
   112   448   544     5 rDEKALg
   113    78   119     1 wDq
   113   235   277     2 kDQv
   113   312   356     3 sEHQd
   113   345   392     6 sTDTKTHe
   113   347   400     1 kNn
   113   413   467     1 nVe
   113   445   500     3 pSVLa
   114   101   248    10 sTAHPELAPVAn
   114   235   392     2 aKQe
   114   312   471     3 sVRQd
   114   345   507    16 kMDDPPLMFQDVYPDATt
   114   350   528     1 tTt
   114   352   531     5 gSNRKSh
   114   365   549    19 pLYPLSDKTLRWREDIEIHTq
   114   408   611    26 aVVEHDEAAATGDDGLDAPQTTPVDTNg
   114   409   638     1 gAa
   114   414   644     1 pRp
   114   415   646     2 pSRi
   114   456   689     2 eFIa
   115   101   238    10 sTTYPNLAPIAg
   115   108   255     2 pGEd
   115   236   385     2 sREe
   115   274   425     1 lKh
   115   312   464     3 gHKQe
   115   345   500    12 eIDDPPRMMKNVFp
   115   349   516     1 rKn
   115   351   519     3 pAAAk
   115   364   535    19 pLYPLTDANSAWRKDVVIMPq
   115   407   597    25 sISVQDRDPPIRDPHNKNADLEAKRRm
   115   409   624     1 pSs
   115   410   626     1 sHi
   115   451   668     2 eFLp
   116   101   237    10 sTTYPNLAPIAd
   116   108   254     2 pGEd
   116   236   384     2 sREe
   116   274   424     1 lKh
   116   312   463     3 gHKQe
   116   345   499    12 eIDDPPRMMKNVFp
   116   349   515     1 rKn
   116   351   518     3 pAAAk
   116   364   534    19 pLYPLTNANSAWRKDVVIMPq
   116   407   596    25 sISVQDRDPPIRDPHNKNVDLEAKRRt
   116   409   623     1 pSs
   116   410   625     1 sHi
   116   451   667     2 eFLp
   117    68    68     7 sTTYPDLAp
   117    75    82     1 aGs
   117    95   103     3 gAFEs
   117   204   215     2 sHEe
   117   281   294     3 gRRQe
   117   314   330    16 qLDSPSRMMKNVFPDLTk
   117   316   348     1 sSa
   117   331   364    19 pLYPLTNENSEWRKDIIIHPq
   117   374   426    18 sIIVEDEEPPTQDYYYNKSv
   117   380   450     1 aTp
   117   381   452     1 pHi
   117   422   494     2 dFLp
   118   104   233    10 sTTYPNLAPIAd
   118   111   250     2 pGEd
   118   229   370    21 gRIHPLDYTYLLALSFSHWFLEy
   118   239   401     2 sHEe
   118   277   441     1 lNh
   118   315   480     3 gRKQe
   118   348   516    16 qLDSPSRMTKSVFADLTk
   118   350   534     1 sSa
   118   365   550    19 pLYPLTNENSEWRKDIIIHPq
   118   408   612    17 sIIVEDEEPPVQDYYNKSv
   118   414   635     1 aTp
   118   415   637     1 pHi
   118   456   679     2 dFLp
   119   102   242    10 sKTYPDLAPLQe
   119   109   259     2 pGDd
   119   237   389     2 sGEe
   119   314   468     3 nRQKe
   119   347   504    16 eVDKPPRMMDDVFGGPKg
   119   352   525     1 nGk
   119   354   528     5 gKEETGk
   119   367   546    19 pLEPLDDKDSAWRKDVIIKPa
   119   410   608    19 aVIEEEGINNQDHDGSPEPPa
   119   411   628     2 aSNd
   119   416   635     1 sSs
   119   417   637     2 sSYi
   119   458   680     2 dFIp
   120    46    47    10 sTTYPNLSPIAd
   120    53    64     2 pGEd
   120   181   194     2 sREe
   120   258   273     3 gHKQe
   120   291   309    12 eIDDPPRMMKNVFp
   120   295   325     1 rKn
   120   297   328     3 pAAAk
   120   310   344    19 pLYPLTNANSVWRKDVVIMPq
   120   353   406    21 sISVQDRDPPIRDPHNKNVDLEa
   120   359   433     1 pSs
   120   360   435     1 sHi
   120   401   477     2 eFLp
   121   102   242    10 sKTYPDLAPLMe
   121   109   259     2 sGDd
   121   237   389     2 sGEe
   121   314   468     3 sRRKe
   121   347   504    16 eVDKPPRMMEDVFSKSKg
   121   352   525     1 dGk
   121   354   528     4 gTKETg
   121   366   544     1 sKp
   121   367   546    19 pLEPLDDKNSAWREDVIIKPs
   121   410   608    24 aVIEEEIPARPTHDGSSEKSNSDDKy
   121   414   636     1 pKs
   121   415   638     2 sSYi
   121   456   681     2 dFIp
   122   101   236    10 sTTYPNLSPIAd
   122   108   253     2 pGEd
   122   236   383     2 sREe
   122   274   423     1 lKh
   122   312   462     3 gHKQe
   122   345   498    12 eIDDPPRMMKNVFp
   122   349   514     1 rKn
   122   351   517     3 pAAAk
   122   364   533    19 pLYPLTNANSVWRKDVVIMPq
   122   407   595    25 sISVQDRDPPIRDPHNKNVDLEAKRRt
   122   409   622     1 pSs
   122   410   624     1 sHi
   122   451   666     2 eFLp
   123    10    10     1 qAw
   123   226   227     2 nRTe
   123   263   266     4 gPGTYk
   123   299   306     2 eDQn
   123   332   341     5 sGQSNVn
   123   343   357     7 hYHKSSPPl
   123   388   409     2 kDQf
   123   429   452     2 sVLp
   124   102   196    11 sVAFPGTYAPVQd
   124   235   340     2 sQQe
   124   312   419     3 gPQQe
   124   344   454    15 hIHDPPLMYKDFTPETq
   124   356   481    19 kDKACTEKEAVGGEDYIWKQg
   124   443   587     2 dILp
   125   101   245    10 sTNYPELAPLTd
   125   108   262     2 pGEd
   125   236   392     2 qETe
   125   313   471     3 gQRQe
   125   346   507    13 nVDDPRVMETDMYPd
   125   353   527     4 pSSGQq
   125   366   544    19 sIYPVSDYSTKWRDDLNIHKq
   125   409   606    26 aVVEDIPVDELSKEDASSSTSSSEAEEd
   125   410   633     2 dDGt
   125   415   640     1 sKp
   125   416   642     2 pQKi
   125   457   685     2 dFIs
   126   193   227     2 kNLa
   126   255   291     1 pSn
   126   322   359     1 nTd
   126   325   363     1 qTd
   126   420   459     2 dFIp
   127    79   120     1 wNq
   127   139   181     1 gTr
   127   235   278     2 fSSg
   127   312   357     3 gTRQe
   127   345   393     1 dVd
   127   411   460     1 sVe
   127   443   493     3 fSILp
   128   101   246    10 sSTFPDLAPITd
   128   108   263     2 pGEd
   128   236   393     2 sEQe
   128   313   472     3 tQRHd
   128   346   508    13 qMDTPAVMESDAYPd
   128   353   528     2 gNRe
   128   366   543    19 pLYPLADETLTWRDDIQIHTq
   128   409   605    25 aVVEHDPLVSEDAANGQEPAAQRPSRi
   128   450   671     2 eFLp
   129    79   119     1 wDq
   129   236   277     2 kDHv
   129   313   356     3 nEQQe
   129   346   392     1 aTd
   129   412   459     1 nVe
   129   444   492     3 pNVLa
   130    23   109     1 pAw
   130   211   298     1 fYv
   130   234   322     2 nRTq
   130   268   358     3 hPSRk
   130   291   384     1 gVt
   130   302   396     2 dVLk
   130   341   437     6 iNRPEDFd
   130   358   460     2 sPPl
   130   445   549     2 sLIp
   131   106   177     3 tSISd
   131   114   188     1 dAp
   131   241   316     2 nREe
   131   276   353     3 tPARh
   131   278   358     1 pEt
   131   280   361     4 gTQSWa
   131   315   400     3 dQVDq
   131   347   435     2 rMRe
   131   361   451     4 sGKNLi
   131   447   541     2 dHIa
   132   106   177     3 tSISd
   132   114   188     1 dAp
   132   241   316     2 nREe
   132   276   353     3 tPARh
   132   278   358     1 pEt
   132   280   361     4 gTQSWa
   132   315   400     3 dQVDq
   132   347   435     2 rMRe
   132   361   451     4 sGKNLi
   132   447   541     2 dHIa
   133   205   220     1 rPs
   133   230   246     2 gKKn
   133   327   345     2 nLAp
   133   424   444     3 pLFLs
   134    25   165     1 qCl
   134    28   169    12 gQWLTLHVGKDIYe
   134   102   255    10 sKTYPDLAPLAe
   134   109   272     2 sGDd
   134   237   402     2 sGEe
   134   314   481     3 nRRKe
   134   347   517    16 dIDKPPRMMADVFSKSRg
   134   352   538     1 dGe
   134   354   541     4 gLKTTg
   134   366   557     1 sKp
   134   367   559    19 pLEPLDDKNSPWREDVIIKPs
   134   410   621    25 aVIEDEIPKQNQDGSSEQSTSDDSSPa
   134   415   651     1 sYi
   134   456   693     2 dFIp
   135    25   165     1 qCs
   135    28   169    12 dQWLTLHVGKDIYe
   135   102   255    10 sKTYPDLAPLAe
   135   109   272     2 sGDd
   135   237   402     2 sGEe
   135   314   481     3 nRRKe
   135   347   517    16 dIDKPPRMMDDVFSKPKg
   135   352   538     1 dGe
   135   354   541     4 gQKTTg
   135   366   557     1 sKp
   135   367   559    19 pLEPLGDKNSAWREDVIIKPs
   135   410   621    25 aVIEDETPKQNQDGSSEQSTSDDNSPa
   135   415   651     1 sYi
   135   456   693     2 dFIp
   136    70   137     2 nRFs
   136    96   165    14 sGGDTSVPGIDGSKNg
   136    97   180     1 gVa
   136   104   188     1 kPe
   136   233   318     7 gGVGDGQDv
   136   272   364     1 nEd
   136   309   402     3 sEKDv
   136   342   438     6 rTEGDHTe
   136   347   449     2 gGKp
   136   446   550     2 dVLp
   137   103   207    10 sSTHSSPAIQAd
   137   233   347     2 nRQe
   137   268   384     3 hPARh
   137   270   389     1 pRd
   137   272   392     4 qSATWq
   137   307   431     3 eEKDr
   137   339   466     3 vQWSd
   137   342   472     1 rAn
   137   351   482     6 pNHNGILi
   137   437   574     2 nHIp
   138   103   207    10 sSTHSSPAIQAd
   138   233   347     2 nRQe
   138   268   384     3 hPARh
   138   270   389     1 pRd
   138   272   392     4 qSATWq
   138   307   431     3 eEKDr
   138   339   466     3 vQWSd
   138   342   472     1 rAn
   138   351   482     6 pNHNGILi
   138   437   574     2 dHIp
   139   103   207    10 sSTHSSTAIQTd
   139   233   347     2 nRQe
   139   268   384     3 hPARh
   139   270   389     1 pRd
   139   272   392     4 qSATWq
   139   307   431     3 eEKDr
   139   339   466     3 vQWSd
   139   342   472     1 rAn
   139   351   482     6 pNHNGILi
   139   437   574     2 dHIp
   140   103   207    10 sSTHSSPAIQAd
   140   233   347     2 nRQe
   140   268   384     3 hPARh
   140   270   389     1 pRd
   140   272   392     4 qSATWq
   140   307   431     3 eEKDr
   140   339   466     3 vQWSd
   140   342   472     1 rAn
   140   351   482     6 pNHNGILi
   140   437   574     2 dHIp
   141    70   137     2 nRFs
   141    96   165    14 sGGDTSVPGIDGSKNg
   141    97   180     1 gVa
   141   104   188     1 kPe
   141   233   318     7 gGVGDGQDv
   141   272   364     1 nEd
   141   309   402     3 sEKDv
   141   342   438    14 rTEGDHTEGMDGGKPd
   141   440   550     2 dVLp
   142   208   246     1 tHg
   142   233   272     2 qRQd
   142   329   370     5 nLHAQKd
   142   392   438     1 nVq
   142   424   471     3 mDLLs
   143   233   281     2 nQAe
   143   268   318     4 sPKFKr
   143   272   326     4 qKFDWk
   143   306   364     5 tLSNTEk
   143   338   401     1 kMp
   143   353   417    10 gLDRENPSLTSf
   143   439   513     2 aLLs
   144   209   259     2 hPGv
   144   232   284     2 gKQe
   144   328   382     3 nLYPq
   144   393   450     1 nVq
   144   425   483     3 pSLLs
   145    74   175     2 kKLs
   145   100   203    13 sGGDKARGSDSGVPv
   145   235   351     6 eKYRNTSl
   145   270   392     3 pYGRn
   145   309   434     3 tVEDl
   145   342   470     9 hIEGNSEGGPd
   145   345   482     1 gNk
   145   444   582     2 sILp
   146    74   176     2 kKIs
   146   100   204    13 sGGDQAGGGDSGIAv
   146   235   352     6 eNYRNTSl
   146   272   395     1 gRn
   146   311   435     3 tNEDi
   146   344   471     5 hIEGNPe
   146   347   479     1 gPd
   146   349   482     2 gGNk
   146   448   583     2 nILp
   147   209   212     2 hPGv
   147   232   237     2 gKQe
   147   328   335     3 nLYPq
   147   393   403     1 nVq
   147   425   436     3 pSLLs
   148   208   213     2 hPGv
   148   231   238     2 gKKe
   148   327   336     5 nMYPRAd
   148   390   404     1 nVq
   148   422   437     3 lELLs
   149   198   224     3 rNDPr
   149   205   234     1 lRd
   149   207   237    10 gVTIRPEFSNDk
   149   230   270     2 gRTe
   149   289   331     1 gAy
   149   300   343     1 rAq
   149   427   471     3 tEVDv
   150   206   213     1 aIs
   150   230   238     2 nYTe
   150   267   277     1 eRd
   150   268   279     1 dTq
   150   270   282     4 gKITWr
   150   290   306     1 gAv
   150   301   318     1 sVp
   150   307   325     5 eLTAQGt
   150   339   362     3 kTATd
   150   352   378     7 gARPGHTPy
   150   438   471     2 sVLp
   151   206   213     1 aIs
   151   260   268     1 eRd
   151   261   270     1 dTq
   151   263   273     4 gKITWr
   151   283   297     1 gAv
   151   294   309     1 sVp
   151   300   316     5 eLTAQGt
   151   332   353     3 kTATd
   151   345   369     7 gARPGHTPy
   151   431   462     2 sVLp
   152   108   110     1 kDp
   152   236   239     2 dGIe
   152   273   278     1 eRn
   152   274   280     1 nAq
   152   276   283     4 gNVQWr
   152   307   318     2 vSVp
   152   313   326     5 eLTEAGq
   152   345   363     3 rIPSd
   152   349   370     1 rQq
   152   360   382     8 gAAVGKPAVy
   152   446   476     2 sTLp
   153    87   173     5 sFPSITi
   153   101   192     1 sGe
   153   207   299     2 vFSd
   153   230   324     2 nRTe
   153   265   361     3 lPRRk
   153   269   368     4 gTFEMv
   153   289   392     9 gASNSNTLPLp
   153   333   445     4 yLRAAd
   153   336   452     1 kAa
   153   345   462     9 sRKLTYPEPPi
   153   431   557     2 nLLp
   154   206   261     1 sIs
   154   230   286     2 nYTe
   154   265   323     2 iPEr
   154   267   327     1 dRr
   154   269   330     4 gQITWr
   154   289   354     1 gAv
   154   300   366     1 sIp
   154   306   373     5 eLTSVGr
   154   338   410     2 rMPn
   154   343   417     1 kTd
   154   353   428     7 gAGPGKTPy
   154   439   521     2 sVLp
   155   209   231     1 rSg
   155   234   257     2 gKTi
   155   271   296     1 gAv
   155   304   330     5 aEVIITf
   155   336   367     2 nMLp
   155   432   465     4 qNELFp
   156   232   241     2 nKSe
   156   269   280     1 eHh
   156   270   282     1 hEd
   156   272   285     4 gEISWr
   156   292   309     1 gAt
   156   303   321     2 vSIp
   156   309   329     5 eLAENGr
   156   341   366     3 rVPSd
   156   358   386     8 gAQEGEFPPy
   156   444   480     2 dVVp
   157   207   212     1 lIs
   157   231   237     2 nRTe
   157   268   276     1 qHr
   157   269   278     1 rPa
   157   271   281     4 nQIDWr
   157   291   305     1 gAt
   157   302   317     1 pIp
   157   308   324     5 dLSSVGk
   157   340   361     3 yVPNd
   157   355   379     6 gNEYVPSy
   157   441   471     2 tVLp
   158   102   175    11 sSNPFNQNIALHe
   158   104   188     1 pDa
   158   207   292     2 yFSq
   158   230   317     2 gKSe
   158   256   345     1 pKk
   158   265   355     3 aPSRr
   158   267   360     1 dNr
   158   269   363     2 pEYr
   158   301   397     5 kMTIQEh
   158   334   435     3 hPIGd
   158   336   440     1 pLs
   158   346   451     8 rSENSKVDLl
   158   432   545     2 tIAp
   159    43    60     1 gKh
   159   107   125    12 iRDPPHPAFTPNEe
   159   217   247     1 yNg
   159   241   272     2 gRSe
   159   276   309     3 eLAPr
   159   279   315     1 mPd
   159   281   318     4 gRPYMq
   159   301   342     9 gSTSLTDIFGd
   159   318   368     3 dETDr
   159   351   404     8 vTPTDANITe
   159   357   418     3 aANRa
   159   370   434    12 kPPPSYSKRPNPLi
   159   456   532     2 dTLp
   160   125   250     3 rASPr
   160   210   338     2 hRGv
   160   233   363     2 gKTd
   160   329   461     1 nLq
   160   385   518    18 rVSTHQRLAGTAKGGRAGQv
   160   396   547     1 nVq
   160   428   580     3 pALLs